Microbes: In Action - M.MOAM.INFO (2024)

Pandoraea pnomenusa. N. tabacum. CYP71A10. Cytochrome P450 monoxygenase. Glycine max. N. tabacum. Mn peroxidase. Peroxidase. C. versicolor.

Microbes: In Action

Microbes: In Action Editor(s) Joginder Singh Assistant Professor Department of Biotechnology Lovely Professional University, Punjab Praveen Gehlot Associate Professor Department of Botany Jai Narain Vyas University, Rajasthan

AGROBIOS (INDIA)

Published by: AGROBIOS (INDIA) Agro House, Behind Nasrani Cinema Chopasani Road, Jodhpur 342 002 Phone: 91-0291-2643993, 2643994, Fax: 2642319 E. mail: [emailprotected]; [emailprotected] Website: agrobiosindia.com

All rights reserved. No part of the book or part thereof, including the title of the book and figures, be reprinted in any form or language without the explicit written permission of the author and the publishers. The copyists shall be positively prosecuted.

ISBN No. (13): 978-81-7754-576-0

Published by: Dr. Updesh Purohit for Agrobios (India), Jodhpur Laser Typeset at: Yashee Computers, Jodhpur Cover Design by: Reena

Prof. L. S. Rathore Ph.D., D. Litt. Emeritus Professor in Political Science & Former Vice-Chancellor, Jai Narain Vyas University, Jodhpur

Foreword In the present era of unprecedented advances in Science and Technology, Microbiology too has emerged as one of the most sought after subject in the science stream. Its fluid dynamics are, perhaps, linked to the prospects and carrier options. Microbes have a very significant role in this era of Biotechnology; and hence it is essential that the students of Biological Sciences should develop a thoughtful understanding of this subject and acquire its basics in order to advance further. Perhaps, it is with this objective in mind, the editors have prepared and launched this excellent book titled “Microbes: In action”. It contains 25 articles in original chapter form, along with a few reviews and sources of reliable information. Edited with commitment and dedication, the editors have shown familiarity with the recent trends in Microbiology and simultaneously have kept aloft the quality and academic standards, despite its being slightly bulky. I would like to convey my congratulations to the editors of the said work for their arduous labour and critical insight towards the preparation of this volume, which clearly demonstrates information, understanding and knowledge of Microbes. It is undeniably a unique work; it uniqueness lies in exploring, dissecting and displaying the recent trends in Microbiology in a befitting manner. I am sure that this work would prove highly useful to the researchers and teachers both, who are either engaged or interested in the study of Microbes and Microbiology.

(Professor L.S. Rathore) Emeritus Professor of Political Science Former Vice- Chancellor Jai Narain Vyas University, Jodhpur

Preface

We feel privileged to introduce book Microbes: In Action with recent development in Microbiology subject that have led to much understanding of the latest advances in the subject. Development of innovative techniques in the field of microbiology for industrial, medicinal and environmental issue etc. are being revolutionized these days, due to sophisticated analytical tool, database and awareness on the need of society. Keeping in view these facts, We edited Microbes:In Action in microbiology mainly for undergraduate, postgraduate students, researchers and teachers of microbiology. They would be benefited by this book. We also hope that this book will be appreciated by them. The editors wish that when it will reach to young scientist, many new ideas will be sensitized in their brilliant minds and progress of microbiology will take automatically jump in step forward ways. The present book is a joint effort made by contributors for their understanding on the microbes. We have presented the latest information lesson, well defined topics in a concise form. We have put in much hard work to make the matter, neither too elaborate so that we do not lose the interest of students nor too concise so as to leave vital topics uncovered. All lessons are written in simple language and is easy to understand even for beginners. The students, researchers and young microbiologist would be encouraged by this book and therein lies our happiness. As editors, we seek suggestions for further improvement; readers are welcome to contact us through mail, letter, and personal meet for any discussion, criticisms and suggestion in the way of further development in the subject. The editors wish to express their gratitude to all the contributors for sparing their valuable time for this academic venture and also for their timely submission to their manuscripts and cooperation. The authors also express their appreciation and thanks to their family members and friends for their unwavering support and encouragement. The publisher is also acknowledged for doing an excellent job of printing and publishing. Needless to say, we have immensely enjoyed editing the book. Joginder Singh Praveen Gehlot

Contents

Competent Soil Microorganisms for Agricultural Sustainability: New Dimension .......................................................................................... 1 Ashok K Rathoure 2 Role of Microbes in Agriculture ............................................................... 19 Leela Wati, Kushal Raj and Annu Goel 3 Plant Growth Promotion by Soil Microorganisms through Root Interaction ................................................................................................ 41 Sanjeev Singh and Joginder Singh 4 Bio-fertilizers – Most Prominent Option for Revitalization of Soil Health ....................................................................................................... 59 Umesh C. Pachouri, Joginder Singh, Manoj Kumar, Ashish Vyas, Avinash Bohraand Sachendra Bohra 5 Plant Growth Promoting Rhizobacteria – An Environment Friendly Approach for Improving Plant Growth ...................................... 77 Ashish Sharma and Leena Parihar 6 Microbial Osmoadaptation – A Road Towards Sustainability in Extreme Conditions .................................................................................. 95 Abhishek Vashishtha and Pawan Kumar Dhawal 7 Phytoremediation: A Plant Microbe Based Heavy Metal Removal System..................................................................................................... 109 Debjani Mukherjee, Mohit Kumar and Yashika Thakur 8 A Beneficial Combination of Bioaugmentation and Phytoremediation: Rhizoremediation .................................................... 127 Jasmine Shrivastav, Shiwani Chahal, Abhineet Goyal 9 Factors Affecting Diversity of Rhizospheric Fungal Population ............ 135 Sangeeta Singh, Sunil Choudhary, Bindu Nirwan, Kuldeep Sharma, Shiwani Bhatnagar and K K Shrivastava 10 Biodegradation of Polycyclic Aromatic Hydrocarbons with Special Reference to Naphthalene ...................................................................... 145 Abhishek Vashishtha and Gautam Kumar Meghwanshi

11 Endophytic Microorganism and their Functions ................................... 167 Praveen Gehlot, Naveen Bohra and Dharmesh Harwani 12 Horizontal Gene Transfer: A Determining Factor of Microbial Diversity ................................................................................................. 189 Santosh Kumar Mehar and S. Sundaramoorthy 13 Endophytes Diversity: Scope and Applications ...................................... 201 Sheelendra M Bhatt and Shilpa 14 Microbial Carbon Sequestration ............................................................ 227 Loveleen Kaur, Robinka Khajuria and Aditi Kaushik 15 Microbial Biofilms .................................................................................. 241 Surendra Kumar, Dilip Singh Solanki and Praveen Gehlot 16 Metagenomics ......................................................................................... 253 Dilip Singh Solanki, Surendra Kumar and Praveen Gehlot 17 Progress and Recent Trends in Biofuels ................................................. 271 Ajay Kumar, Joginder Singh and Chinnappan Baskar 18 Application of Enzymes in Food Processing .......................................... 281 Gautam Kumar Meghwanshi and Abhishek Vashishtha 19 Food Preservation: Methods and Practices............................................. 303 Gautam Kumar Meghwanshi and Bharti Dhabai 20 Role of Fungi in Biosynthesis of Nanoparticles ..................................... 317 Praveen Gehlot, Ramesh Raliya S K SinghRakesh Pathak 21 Secondary Structure Modelling of ITS1, 5.8S and ITS2 Ribosomal Sequences for Intra-Specific Differentiation among Aspergillus Species .................................................................................................... 337 Praveen Gehlot, S K Singh, Jyoti Lakhani and Dharmesh Harwani 22 Halophiles of Sambhar Salt Lake ........................................................... 355 Archana Gaur 23 RNA Interference and its Application in Plant Disease Management ........................................................................................... 369 Rakesh Pathak, S K Singh and Praveen Gehlot 24 Association and Impact of AM Fungi on some Economic Important Medicinal Plants of Rajasthan .............................................. 381 K K Srivastava, Divya Keswani, Sangeeta Singh , Neelam Verma, K C Jedia and Lokendra Singh 25 Medicinal Flora of the Thar Desert of Rajasthan: Therapeutic and Antimicrobial Importances .................................................................... 399 P D Charan and K C Sharma

CHAPTER 1 Competent Soil Microorganisms for Agricultural Sustainability: New Dimension Ashok K Rathoure M/s Vardan EnviroNet, Sector 57, Gurgaon (Haryana) India Corresponding author: [emailprotected]

INTRODUCTION Microbes such as fungi, bacteria and viruses play a vital role in sustainability of agriculture. Habitually, farmers think of microbes as pests that are destructive to their crops or animals, but many microbes are beneficial. Soil microbes especially bacteria and fungi are essential for decomposing organic matter and recycling old plant material. Some soil bacteria and fungi form relationships with plant roots that provide important nutrients like nitrogen or phosphorus. Fungi can colonize upper parts of plants and provide many benefits, including drought tolerance, heat tolerance, resistance to insects and resistance to plant diseases. Some viruses that benefit to hosts and most probably do not harm their hosts. Microbes in terrestrial environments are important catalysts of global carbon and nitrogen cycles, including the production and consumption of greenhouse gases in soil. Some microbes produce the greenhouse gases carbon dioxide (CO2) and nitrous oxide (N2O) while decomposing organic matter in soil. Others consume methane (CH4) from the atmosphere, thus helping to mitigate climate change. The importance of each of these processes is influenced by human activities and impacts the warming potential of Earth's atmosphere. Using contemporary genomic techniques, scientists analyzed DNA extracted directly from soil to assess which microbes were present and their metabolic potential. Communities of microbes were compared from three very different land use types i.e. row-crop agriculture (corn, soybean and wheat rotations), old fields that had been abandoned from agriculture for decades and deciduous forests. Because these treatments had been in place for 20-50 years, scientists were able to measure the long-term impacts of land management. It is suggested that managing lands to conserve or restore the diversity of methane-consuming bacteria could help mitigate climate change. Likewise, land management also seems to greatly affect the diversity of microbes involved in nitrous oxide production; fertilized soils produce more nitrous oxide and have a very different genetic makeup. The agriculture distinctly influences the diversity of bacteria responsible for the production and consumption of two of the three major naturally-occurring greenhouse gases. The uniqueness of microorganisms and

Microbes: In Action

their unpredictable nature and biosynthetic capabilities, given a specific set of environmental and cultural conditions, has made them likely candidates for solving particularly difficult problems in the life sciences and other fields as well. The various ways in which microorganisms have been used over the past 50 years to advance medical technology, human and animal health, food processing, food safety and quality, genetic engineering, environmental protection, agricultural biotechnology and more effective treatment of agricultural and municipal wastes provide a most impressive record of achievement (Jangid et al., 2011). The soil quality is the key to a sustainable agriculture. Understanding has shown that the transition from conventional agriculture to nature farming or organic farming can involve certain risks, such as initially lower yields and increased pest problems. Once through the transition period, which might take several years, most farmers find their new farming systems to be stable, productive, manageable and profitable without pesticides. Microorganisms are effective only when they are presented with suitable and optimum conditions for metabolizing their substrates Including available water, oxygen, pH and temperature of their environment. Meanwhile, the various types of microbial cultures and inoculants available in the market today have rapidly increased because of these new technologies. Since microorganisms are useful in eliminating problems associated with the use of chemical fertilizers and pesticides, they are now widely applied in nature farming and organic agriculture (Higa, 1991; Parr et al., 1994). Environmental pollution, caused by soil erosion and the associated transport of sediment, chemical fertilizers and pesticides to surface and groundwater and improper treatment of human and animal wastes has caused serious environmental and social problems throughout the world. Often engineers have attempted to solve these problems using established chemical and physical methods. However, they have usually found that such problems cannot be solved without using microbial methods and technologies in coordination with agricultural production (Reganold et al., 1990). The beneficial microorganisms are those that can fix atmospheric nitrogen, decompose organic wastes and residues, detoxify pesticides, suppress plant diseases and soil-borne pathogens, enhance nutrient cycling and produce bioactive compounds such as vitamins, hormones and enzymes that stimulate plant growth. Harmful microorganisms are those that can induce plant diseases, stimulate soil borne pathogens, immobilize nutrients and produce toxic and putrescent substances that adversely affect plant growth and health. FUNCTIONS OF SOIL MICROORGANISMS The soil microorganisms (actinomycetes, fungi, bacteria and cyanobacteria) so called soil microbial biomass are the agents of transformation of soil organic matter, nutrients and of most key soil processes. Their activities are much influenced by soil physico-chemical and ecological interactions. Many actinomycetes produce antibiotic compounds that kill other microorganisms e.g. streptomycin is produced by growing soil actinomycetes in pure culture. Bacteria (kingdom Monera) can be either autotrophic or heterotrophic and can be both

Competent Soil Microorganisms for Agricultural Sustainability

aerobic and anaerobic. They have evolved mechanisms to adapt to life in the most extreme of environments. Due to their diversity they play many roles in the soil and are involved in all of the organic transactions. Cyanobacteria (formerly blue-green algae) belong to soil microflora and are either autotrophic or heterotrophic. They are also prokaryotic and among the most ancient of organisms. Many genera of cyanobacteria can fix atmospheric nitrogen e.g. Anabaena sp. and are especially plentiful in rice paddies and other wetland soils, where they fix large quantities of nitrogen. Soil bacteria are the primary digestive system of the soil. Their activity is responsible for almost 90% of all biological and chemical actions. The followings are the key function of beneficial soil microorganisms: 1. Transforming raw elements from one chemical form to another. Important nutrients in the soil are released by microbial activity are Nitrogen, Phosphorus, Sulphur, Iron and others, 2. Breaking down soil organic matter into a form useful to plants. This increases soil fertility by making nutrients available, 3. Degradation of pesticides and other chemicals found in the soil. 4. Suppression of soil born pathogen that causes diseases. The pathogens themselves are part of this group, but are highly outnumbered by beneficial microbes. 5. Fixation of atmospheric nitrogen, 6. Decomposition of organic wastes and residues, 7. Recycling and increased availability of plant nutrients, 8. Production of antibiotics and other bioactive compounds, 9. Production of simple organic molecules for plant uptake, 10. Complexation of heavy metals to limit plant uptake, 11. Solubilization of insoluble nutrient sources, 12. Production of polysaccharides to improve soil aggregation. ARBUSCULAR MYCORRHIZAL FUNGI (AMF) The symbiotic association of plants and mycorrhizal fungi i.e. arbuscular mycorrhizal fungi, (AMF) has long been recognized for the benefits it provides with nutrient transport and uptake. However, there is considerable uncertainty about the functional benefits in intensive agricultural systems (Gupta et al., 2011). Even though AM symbiosis is widespread, the symbiotic functions of AMF species differ according to specific AMF isolates, host plants and soil properties. AMF associations are generally considered diffuse and non-specific because multiple species colonization linking together two or more plants is not uncommon (Selosse Marc-Andre et al., 2006; Smith et al., 2008). Identification of specific phylotypes of AMF and their relationship with soil properties is a crucial step to fully exploit the benefits from AMF (Selosse Marc-Andre et al., 2006). New knowledge on the microbial interactions in the mycosphere has the potential to enhance our ability to manipulate plant-mycorrhizal associations. A diverse array of bacteria e.g. Pseudomonas, Bacillus, actinomycetes and fungi e.g. Aspergillus, Penicillium species are capable of solubilising and mineralising plant unavailable forms of phosphorus in soils and the benefits from their use as inoculants are increasingly being recognized (Gyaneshwar, et al., 2002;

Microbes: In Action

Richardson, et al., 2011). The key function of arbuscular mycorrhizal fungi includes: 1. Drought resistance: AMF have long been implicated in improved host water relations by influencing everything from stomatal conductance, hydraulic conductance, and leaf and root hydration (Auge, 2001). 2. Mineralization of organic nutrients: Recently, AMF have been shown to acquire N (Hodge et al., 2001) and P (Tarafdar and Marschener 1994) directly from decomposing sources, which was thought only to occur in saprobic fungi. 3. Seedling establishment: The role of mycelial networks is thought to equalize resource allocation among neighboring plants, and a potential benefit may be that AM seedlings have access to more resources through the common mycelial network than do non-AM plants during the crucial establishment phase (van der Heijden et al., 2004). 4. Nutrient uptake: AMF mycelia have been shown to increase uptake of many nutrients including P, N, S, B, Cu, K, Zn, Ca, Mg, Na, Mn, Fe, Al, and Si, along with trace elements (Clark and Zeto 2000). In some cases, AMF may be responsible for acquiring 100% of host nutrients e.g. P (Smith et al., 2004). 5. Increased soil stability: AMF greatly increases soil stability and weathering, possibly due to exudation of putative AMF protein glomalin, which is found in very high levels in AM soils (Rillig 2004). 6. Increased pollination: AMF plants may also be more attractive to pollinators, due to their altered architecture and improved nutrient status (Wolfe et al., 2005). 7. Increased herbivore tolerance: While AMF plants may be more appealing to herbivores, they have shown to increase tolerance to herbivory through increased compensatory response (Kula et al., 2005). 8. Pathogen resistance: While AMF have yet to be developed for biological control, they appear to reduce disease symptoms for some plant diseases such as root rot, wilt, yellowing disease, and damping off (Whipps 2004). 9. Heavy metal tolerance: AMF have shown to have differential sensitivities to soil metal toxicity, and may buffer hosts from toxic exposure, either through sequestration in the mycelium or by metabolizing it (Gaur and Adholyea 2004). N2 FIXING BACTERIA Symbiotic associations between legume plants and root-nodulating bacteria belong to the genera Rhizobium, Bradyrhizobium, Ensifer and Mesorhizobium. Nitrogen fixation is one of the essential beneficial biological processes for the economic and environmental sustainability of agriculture worldwide. Finding efficient rhizobia for the wide variety of legumes that are cultivated around the world and developing efficient management of symbioses in the field to realize approx 25 kg of N2 fixation for each tonne of legume dry matter are the major challenges for the future. Diazotrophy, the ability to fix atmospheric nitrogen catalyzed by the enzyme nitrogenase, is distributed among diverse groups of

Competent Soil Microorganisms for Agricultural Sustainability

bacteria and archaea (Reed et al., 2011). Free living N2 fixing bacteria e.g. Azospirillum sp., Azotobacter sp., Acetobacter diazotrophicus, Herbaspirillumspp., Bacillus sp., Azoarcus sp. are found in the rhizosphere and rhizoplane environments of cereal crops. Recent evidence not only identified new genera of N2 fixing bacteria and archaea in natural and managed ecosystems but also indicated significant edaphic and environmental groupings in genetic diversity and functionality (Buckley et al. (2007). Non-rhizobial N2 fixing bacteria can grow as endophytes in a number of grasses e.g. Pseudomonas species were the most dominant group of nifH carrying bacteria found in the rhizosphere of perennial native grasses (Gupta et al., 2011). The nifH gene is present in a number of non-Frankia actinobacteria like Agromyces, Microbacterium, Corynebacterium and Micromonospora. PLANT GROWTH-PROMOTING RHIZOBACTERIA (PGPR) The environmental benefits of using PGPR as microbial inoculants have been the reduction in the use of agricultural chemicals and its ecofriendly nature (Egamberdiyeva and Hoflich 2004). Free-living as well as symbiotic PGPR can improve plant nutrition and growth, plant competitiveness and responses to external stress factors (Mantelin and Touraine 2004). Mishra et al. (2010) reported that the PGPR were efficient for the seed germination and plant growth of Cicer arietinum under salinity and can be used as biofertilizer. Bacteria colonising roots that elicit shoot and root growth, referred generally as PGPR, are recommended (marketed) for improving plant growth and disease control both in agriculture and horticulture. PGPR can promote root and shoot growth either by producing plant hormones or secondary metabolites, controlling diseases, induction of systemic resistance or through changing physicochemical interactions with plants. Bacterial inoculants applied as biofertilisers are also being explored to alleviate stress from abiotic factors such as drought and salinity. PGPR can promote the growth of plants using direct and indirect mechanisms. Direct mechanisms include lowering the production levels of ethylene through synthesis of 1-aminocylopropane-1-carboxylate (ACC) deaminase in plants (Reed and Glick 2005; Safronova et al., 2006; Saleem et al., 2007); providing bioavailable phosphorus for plant uptake and atmospheric nitrogen fixation (Patten and Glick 1996) for plant use; sequestering trace elements like iron using siderophores (Glick 1995), e.g., Kluyvera ascorbata SUD 165 that has the ability to synthesize the enzyme ACC deaminase protected Brassica juncea and Brassica campestris against Ni, Pb and Zn toxicity (Burd et al., 1998) by reducing the stress caused by high ethylene level; and production of plant hormones like gibberellins, IAA, cytokinins and auxins (Glick et al., 1999). Root elongation of Brassica napus has also been shown to be stimulated by IAA synthesized by PGPR (Sheng and Xia 2006) as well as non-identified rhizobacteria on the B. juncea roots (Belimov et al., 2005). PGPR that indirectly enhance plant growth by suppressing phytopathogens do so by a variety of mechanisms. These include the ability to produce siderophores that chelate iron, making it unavailable to pathogens; synthesize antifungal metabolites such as antibiotics, fungal cell wall lysing enzymes, or hydrogen cyanide, which suppress

Microbes: In Action

the growth of fungal pathogens; successfully compete with pathogens for nutrients or specific niches on the root; and induce systemic resistance (Bloemberg and Lugtenberg 2001; Glick 1995; Persello-Cartieaux et al., 2003; Martınez-Viveros et al., 2010). ENDOPHYTIC MICROORGANISMS Colonization traits usually relates to the bacterial traits involved in the entire plant-colonization process. In the interactive colonization processes, communication between the plant and microbe has a key role. Bacterial root colonization often starts with the recognition of specific compounds in the root exudates by the bacteria. These compounds probably also have major roles in below-ground community interactions. The plants simultaneously communicate with communalistic, mutuality, symbiotic and pathogenic microorganisms via compounds exuded by their roots (Deweert et al., 2002; Bais et al., 2004; Bais et al., 2006). However, it has been suggested that plants can communicate to specifically attract microorganisms for their own ecological and evolutionary benefit (Compant et al., 2005) Owing to the complexity of the plant–microbe interactions in soil, it is extremely difficult to understand the detailed mechanisms involved in these putative selection processes. Rhizobium–plant interaction indicates the existence of highly evolved species specific communication systems (Bais et al., 2006) or from plant–Pseudomonas associations, in which two distinct plants have attracted specific minority strains of the Pseudomonas sp. involved, rather than the whole Pseudomonas community (Lemanceau et al., 1995). Much like the bacteria selected in the rhizosphere, particular endosphere bacteria might also be selected to establish residence inside plants. Bacterial traits required for effective root colonization are subject to phase variation, a regulatory process for DNA rearrangements orchestrated by site-specific recombinase. Endophytic population sizes are dependent on and positively correlated with, plant developmental stage, progressively increasing from the seedling stage onwards and reaching a maximum (Van Overbeek et al., 2008). The endophytic microorganisms can play a vital role in agricultural sustainability such as growth promoter, insect control, biopesticide, stress tolerance, etc. 1. Endophytes as growth promoter: There are numbers of mechanisms by which bacteria may promote plant growth and health which includes the production of plant growth phytohormones like auxins, cytokinins, gibberellins and ethylene, solubilised insoluble phosphate, produced HCN and siderophore and can fixed atmospheric N2. In symbiotic relationships, the microorganism helps the plant with nutrient assimilation or contributes biochemical activities that the plant lacks; microbes also confer a degree of protection against plant diseases. The plants supply competitive advantage to the corresponding microbes. Volatile substances such as 2-3 butanediol and aceotin produced by bacteria seem to be a newly discovered mechanism responsible for plant-growth promotion. Endophytes produce adenine ribosides that stimulate growth and mitigate browning of pine tissues (Smith and Read, 1996; Ryu et al., 2003; Pirttila et al., 2004). 2. Endophytes for insect control: The endophytic fungus Phom*opsis oblonga

Competent Soil Microorganisms for Agricultural Sustainability

was reported to protected elm trees against the beetle Physocnemum brevilineum. The capacity of endophytic fungus to repel insects, induce weight loss, growth and development reduction and even to increase pest death rate shown that the mode of action based on the capability to render the plant unpalatable to several types of pests like aphids, grasshoppers, beetles, etc. (Carroll et al., 1988). Alkaloids from N. lolii and L. perenne are capable of altering insect behaviour. Several of these alkaloids were added to the diet of adult individuals of Coleoptera Heteronychus aratur. Peramine, lolitrem B, lysergol-type alkaloids, festuclavine and lisergic acid showed no effects on the insect. Ergovine showed moderate effects whereas ergotamine, ergovaline from the ergot-type alkaloid family seem to be responsible for the plant resistance (Ball et al., 1997). Miles et al. (1998) showed that endophytic isolates of Neotyphodium sp. produce N-formilonine and a paxiline nalogous in the host Echinopogum ovatus. Dougherty et al. (1998) showed Haematobia irritans larvae of horn fly (cattle ectoparasite) killed when cattle manure was amended with seed extracts containing lolines from plants infected with N. coenophialum. 3. Endophyte as biopesticidal: Biopesticides, agent of biological origin, may be viruses, bacteria, pheromones, plant or animal compounds. The outstanding feature of biopesticides is environment friendly, easy biodegradability, faster rate of product development, low research expenditure, do not disturb natural biocenosises also application of biopreparation lowers the chemical loading to the environment, does not deteriorate the soil fertility, natural ways of decomposition in nature, non toxicity for warm-blooded organisms and overcoming the anti-environment chemical pesticide. Burkholderia brasilensis is an endophyte of roots, stems and leaves of sugarcane plant while Burkholderia tropicalis is confined to its roots and stems, with effective biopesticide properties. Many cultivated and wild type plants have been investigated for endophytic fungal metabolites which include guanidine and pyrrolizidine alkaloids, indole derivatives, sesquiterpenes, isocoumarin derivatives (Kumar et al., 2008). 4. Tolerance to Environmental stress: Endophytic microorganisms actively response to various biotic and abiotic stress factors that which hampers the overall agricultural scenario. Biotic stress tolerance mechanisms such as biocontrol of phytopathogens in the root zone through production of antifungal or antibacterial agents, pathogen antagonism, siderophore production aiding plant nutrition by iron chelation, phosphate solubilisation and induction of systematic acquired host resistance (Johansson et al., 2004). Endophytes from potato plants showed antagonistic activity against fungi and also inhibited bacterial pathogens belonging to the genera Erwinia and Xanthom*onas. Some of the endophytic isolates produced in particular, various bacteria and fungi especially of the genera peudomonas, Bacillus and Trichoderma produce a range of metabolites against other phytopathogenic fungi (Raaijmkers et al., 2002). Production of antibiotics sensitive to plant pathogens such as alkaloids, terpenoids, aromatic compounds, polypeptides and secretion of enzymes that has the capacity to hydrolyse compounds like cellulose, hemicellulose, chitin,

Microbes: In Action

proteins etc. CYANOBACTERIA The soils in desert and semi-arid regions have poor physical properties, low fertility and water deficiency. Cyanobacterial application to the organically poor semi-arid soil played a significant role in improving the status of carbon, nitrogen and other nutrients in the soil (Nisha et al., 2007). Organic matter content of dry land soils is chemically and biologically less stable and tends to decrease very rapidly in arid regions thus leading to poor organic matter contents. Poor soil structure usually associated with low organic carbon, compaction, salinity and sodicity results in reduced aeration and rates of water infiltration, hence more soil erodability and the reduced number and biodiversity of micro-flora ultimately has the adverse impact on plant growth and productivity. Flaibani et al. (1989) reported that exopolysaccharides from cyanobacteria also contribute to reclaimation and improvement of desert soils. It is reported that cyanobacteria, as carbon and nitrogen fixers, can contribute to the improvement of soil nutrient status in arid soils (Jeffries et al., 1992; Lange et al., 1994). Cyanobacterial sheaths and EPS also play a major role in water retention due to their hygroscopic nature (Decho, 1990). The soil microflora contributes to increased water holding capacity of soils (Verrecchia et al., 1995). Belnap and Gillette, (1997) and Campbell, 1979; Belnap and Harper, (1995) reported that formation of algal crust by Microcoleus vagin*tus and M. chthonoplastes in extremely dry climates, make significant contributions in stability of soils. It is reported that cyanobacteria produce extracellular polymeric substances (EPS) that help them to overcome conditions of water stress and also bind soil particles (Mazor et al., 1996). Marathe (1972) and Falchini et al. (1996) demonstrated that cyanobacteria play a very crucial role in bioamelioration of soils and enhancing crop yield not only aggregation initiation but also through protection of soil porosity due to reduction of the damaging effect of water addition. The diazotrophic cyanobacteria contribute substantially to the fertility of the soil especially under tropical paddy field conditions. Some native cyanobacterial strains have been reported to play an important role in improving soil aggregation, water holding capacity and soil aeration in paddy and several other agriculture fields (Rogers and Burns, 1994; DeCaire et al., 1997; Hegde et al., 1999). Better soil aggregation in cyanobacterial bio-fertilizer treated soils may be attributed to polysaccharides produced by the blue green algae (Ahmed et al., 2000). The native strains of cyanobacteria in semi-arid soils showed remarkable potential for improving structural stability, nutrient status and productivity of the soil due to their inherent tolerance capacity under limited soil moisture condition (Manchanda and Kaushik, 2000). Cyanobacteria produced organic matter, which increased soil organic C as well as water stable soil aggregates (MalamIssa et al., 2001). Cyanobacterial inoculations in disturbed soils have been reported to restore the population of carbon and nitrogen cycle microorganisms (Acea et al., 2003). Cyanobacteria seem to exert a mechanical effect on soil particles by the superficial network of the trichomes/filaments as well as enmeshing with soil particles at depth. Increase in total sugar content in

Competent Soil Microorganisms for Agricultural Sustainability

soils having a cyanobacterial mat has been found to correspond to the enhanced soil aggregation process. The cyanobacterial consortium used as biofertilizer also produces abundant EPS about 25% of their total biomass (Nisha et al., 2007). Algal biomass and activity in soil crust are concentrated in the upper soil layers and EPS have gluing effect on soil particles leading to accelerates soil aggregation. EPS produced by the cyanobacteria also seem to promote the activity of soil microflora as indicated by high soil enzymatic activities. Such microbial flora may produce more EPS, thus further amplifying the effect. Cyanobacteria play a very important role in fixing C and N in soil and have been considered very important for desert ecosystem. Removal of cyanobacteria from the arid sites reduces productivity and increases erosion by exposing unprotected subsurface soils to wind and water. MICROORGANISMS FOR BIOREMEDIATION Several chemicals are released into the soil ecosystem either as a method of disposal or as a consequence of the technology of their utilization. In particular, the application of pesticides, many of which are toxic or contain toxic contaminants, is central to the high yields in modern agriculture. With the advances in biotechnology, bioremediation has become one of the major developing research area of environmental restoration, utilizing microorganisms to reduce the concentration/toxicity of various chemical pollutants such as heavy metals, dyes pesticides, etc. Biological treatment especially using cyanobacteria, for treatment of water bodies has manifold advantages over conventional methods, as cyanobacteria are cosmopolitan in environment and known to accumulate high levels of metal/pollutant; therefore, the process involved is relatively cheap and environment friendly. Systems are Cu, Zn, Ni, Co, Pb, Cr, Cd, etc. (Kaushik et al., 1999). Among the photoautotrophs, cyanobacteria are relatively more tolerant to heavy metals (Fiore and Trevors, 1994). The uptake of metal ions such as Cu, Pb, Zn, Ni, Cd, Cr, etc. has been reported in some of the efficient cyanobacteria are Spirulina platensis, Oscillatoria anguistissima, Microcystis sp., Synechococcus sp. (Verma and Singh, 1995; Rai et al., 1998; Pradhan and Rai, 2000; Yee et al., 2004). The remediation of soils contaminated with heavy metals can be performed using chemical, physical and biological techniques. The metal and organic pollutants can be removed by the microbial flora. Bacillus sp. was very much efficient to remove the Au, Cd, Cr, Fe, Mn, Ni, Pb, U and Zn. It was recorded that Bacillus sp. can efficiently remove the metal pollutants from the waste or industrial effluents (Brierley and Brierley 1993; Philip et al., 2000; Gunasekaran et al., 2003). Pseudomonas sp. was also reported to Cu, Cr, Cd, Pb, Ni, U and Zn (Kapley et al., 1999; Sar and D'Souza 2001; Cybulski et al., 2003; Tarangini 2009). Ilhan et al. (2004) observed that Staphylococcus saprophyticus reduced Cr, Cu and Pb ions. The isolate was adsorbed 100% Pb ions at different pH range of 3-5 and at 270C temperature. Corynebacterium sp. and Flavobacterium sp. were reported for removal of organic contaminants and halogenated hydrocarbons, phenoxyacetaes and aromatic hydrocarbons (Jogdand, 1995). Corynebacterium glutamicum was able to reduce the thorium and uranium (Tarangini, 2009). The biosorption of heavy metal Cd and Cu by Flavobacterium sp. was reported by

Microbes: In Action

Rajbanshi, (2008) whereas, biosorption of Cu, Fe and Zn by Corynebacterium sp. was reported by Odokuma, (2009). Many investigators (Friis and Myers-Keith, 1986; Mattuschka et al., 1993; Jogdand, 1995; Tarangini 2009) reported that Streptomyces sp. can be used to remove the metal ions of Ag, Cd, Cu, Cr, Ni, Pb, U and Zn from the waste. Streptomyces noursei was able to reduce the metal ions in order Pb>Ag> Cu>Cr (Mattuschka et al., 1993). Aspergillus niger was reported to remove Ag, Au, Cd, Cu, Th, U and Zn (Townsley et al., 1986; Kuyucak and Volesky, 1988; Khalid et al., 1993; Guibal et al., 1995; Gunasekaran et al., 2003). PLANT MICROBE INTERACTION It is important to recognize that plants exist in intimate associations with microorganisms, some of which cause plant disease while others protect against disease. Identifying, understanding and utilizing microorganisms or microbial products to control plant disease and enhance crop production are integral parts of sustainable agriculture. Biological control has the potential to control crop diseases while causing no or minimal detrimental environmental impact. Some of the benefits of utilizing microorganisms include: 1. Reduced dependence on chemical pesticides, important because of the increasing restrictions on chemical usage due to environmental and public concerns, 2. Lack of development of pathogen resistance to biological control organisms, important due to the observed increase in resistance to many chemical controls, 3. Improvement of soil and enhancement of agricultural sustainability, 4. Selective action against specific groups of pathogens and not against beneficial organisms, 5. Biodegradability of microbial pesticides and the by-products of their manufacture. The soil borne plant pathogens result in economic losses for farmers. For root diseases of mature crops, there are few effective and economical post-plant strategies for control. The use of chemical pesticides to control soil borne pathogens has caused significant changes in air and water quality, altered natural ecosystems resulting in direct and indirect effects on wildlife and caused human health problems e.g. methyl bromide, a fumigant used to control soil borne diseases, has become notorious in recent years for depleting the ozone layer and changing the climate of our planet. The future of sustainable agriculture will increasingly rely on the integration of biotechnology with traditional agricultural practices. Although genetic engineering promises enhanced yields and disease resistance, it is also important to recognize that plants exist in intimate associations with microorganisms, some of which cause plant disease while others protect against disease. The probiotics, new concept of managing plant health through the manipulation of probiotic organisms associated with plants, has gained interest recently (Picard et al., 2008). Plant-specific stimulation of specific microbial groups in their rhizosphere suggests that plants may have evolved to strategically stimulate and support particular microbial groups capable of producing

Competent Soil Microorganisms for Agricultural Sustainability

antibiotics as a defense against diseases caused by soil-borne pathogens (Weller et al., 2002). Soil bacteria belonging to the genus Pseudomonas are ubiquitous in most soils and have been linked to wide-ranging processes including plant growth promotion and inhibition, disease control, nutrient cycling, nitrogen fixation and bioremediation. Their ability to respond quickly to changes in physical, chemical, carbon and nutritional conditions in soil has been linked to their functional significance in agricultural ecosystems (Hornick 1992). Antibiosis is the most commonly suggested trait responsible for their activity against plant pathogens and a number of antimicrobial compounds have been identified e.g. 2,4-diacetylphloroglucinol (2,4-DAPG), phenazines (PHZ), pyrrolnitrin (PRN), pyoluteorin (PLT), hydrogen cyanide (HCN) and biosurfactant antibiotics (Picard et al., 2008). Conventional biochemistry-based characterisation of the chemicals is now complemented with molecular techniques e.g. metabolomics and transcriptomics, to unravel the mechanisms of production, interactions with pathogens and plants, genotypic and phenotypic diversity of organisms capable of producing similar compounds and determine their activity in natural soil environments. BIOLOGICAL CONTROL ORGANISMS The bacteria, fungi and actinobacteria can act as biocontrol agents against root diseases (Whipps, 2001). A number of bacterial and fungal inoculant formulations are available commercially to control diseases in agricultural and horticultural crops (Westerdijk 2000). The success of biocontrol inoculants depends upon the ability to: 1. Lengthen the period, during which a threshold population density is sustained in the rhizosphere, 2. Maintain the adequate populations needed to provide effective biological control, 3. Increase the magnitude of disease control provided by introduced rhizobacteria. The cyanobacteria can also be used as biocontrol agents based on previous research. In modern agriculture practices, the conventional control methods of plant diseases have not been found quite efficient due to survival of the reproductive structures of pathogens in the soil. At the same time, fungicides and other artificial chemical agents inhibit the growth and development of crop plants (Nyporko et al., 2002). Various antagonistic microorganisms have been identified for almost every life cycle stage of several plant pathogenic microbes and cyanobacteria it is here that are as the efficient antagonistic agents against several pathogenic microbes (Yuen et al., 1994). Various investigators have proved that cyanobacteria can be efficiently used as biocontrol agent (DeCaire et al., 1990; DeMule et al., 1991; Teuscher et al., 1992; Zulpa et al., 2003; Tassara et al., 2008). Biological control is an attractive approach for the control of soil borne diseases (Cook, 1993). Actinobacterial endophytes can colonise plants without disrupting the normal endophytic populations, can produce antifungal antibiotics and plant growth hormones and can also induce systemic disease resistance in plants (Conn et al., 2008).

Microbes: In Action

Advantages of a biological approach to disease control include a lack of environmental damage, reduced human health risks, lack of resistance development in the pathogen, selectivity in mode of action, lack of activity against most beneficial microorganisms and improved soil conditions and agricultural sustainability. Biocontrol inoculants are generally tested for their antibiosis potential due to antagonism, hyper-parasitism, competition and predation by indigenous organisms; however, organisms that induce a systemic resistance to diseases and pests have the greatest potential to succeed under field conditions (Kloepper et al., 2004). Some soils can suppress the severity of disease even in the presence of a pathogen, host plant and favourable climatic conditions for the disease. There are a number of examples, both in Australia and worldwide, where agricultural soils have become suppressive to soil-borne pathogens (Weller et al., 2002; Cook, 2007; Gupta, et al., 2011). CONCLUSION Soil microbes especially bacteria and fungi are essential for decomposing organic matter and recycling old plant material. Microbes in terrestrial environments are important catalysts of global carbon and nitrogen cycles, including the production and consumption of greenhouse gases in soil. Some microbes produce the greenhouse gases carbon dioxide (CO2) and nitrous oxide (N2O) while decomposing organic matter in soil. Others consume methane (CH4) from the atmosphere, thus helping to mitigate climate change. The importance of each of these processes is influenced by human activities and impacts the warming potential of Earth's atmosphere. The soil quality is the key to a sustainable agriculture. The symbiotic association of plants and mycorrhizal fungi i.e. arbuscular mycorrhizal fungi, (AMF) has long been recognized for the benefits it provides with nutrient transport and uptake. Nitrogen fixation is one of the essential beneficial biological processes for the economic and environmental sustainability of agriculture worldwide. Free-living as well as symbiotic PGPR can improve plant nutrition and growth, plant competitiveness and responses to external stress factors. PGPR can promote the growth of plants using direct and indirect mechanisms. The endophytic microorganisms can play a vital role in agricultural sustainability such as growth promoter, insect control, biopesticide, stress tolerance, etc. Cyanobacteria seem to exert a mechanical effect on soil particles by the superficial network of the trichomes/filaments as well as enmeshing with soil particles at depth. The cyanobacterial consortium used as biofertilizer also produces abundant EPS. With the advances in biotechnology, bioremediation has become one of the major developing research area of environmental restoration, utilizing microorganisms to reduce the concentration/toxicity of various chemical pollutants such as heavy metals, dyes pesticides, etc. It is important to recognize that plants exist in intimate associations with microorganisms, some of which cause plant disease while others protect against disease. Identifying, understanding and utilizing microorganisms or microbial products to control plant disease and enhance crop production are integral parts of sustainable agriculture. Biological control has the potential to control crop diseases while causing no or minimal detrimental environmental impact. The competent soil microorganisms can be

Competent Soil Microorganisms for Agricultural Sustainability

used in various ways to sustain our agriculture practices. ACKNOWLEDGEMENTS Author is thankful to Kanchan Prabha Rathoure (Mrs.) for technical and for her valuable suggestions to make it more effective. REFERENCES Acea MJ, Prieto Fernandez A and Diz Cid N (2003). Cyanobacterial inoculation of heated soils: effect on microorganisms of C and N cycles and on chemical composition in soil surface. Soil Biol Biochem. 35: 513-524 Ahmed D, El Gamal MS, Ammar UM and Abd El Raouf TM (2000). Role of some cyanobacteria in enhancement of soil characteristics. Egypt J Plycol. 1: 99-106 Auge RM (2001). Water relations, drought and vesicular–arbuscularm mycorrhizal symbiosis. Mycorrhiza. 11: 3- 42 Bais HP, Park SW, Weir TL, Callaway RM and Vivanco JM (2004). How plants communicate using the underground information superhighway. Trends Plant Science. 9: 26-32 Bais HP, Weir TL, Perry LG, Gilroy S and Vivanco JM (2006). The role of root exudates in rhizosphere interactions with plants and other organisms. Annu. Rev. Plant Biol. 57: 233266 Ball OJP, Miles CO and Prestidge RA (1997). Ergopeptide alkaloids and Neotyphodium lollimediated resistance in perennial ryegrass agains adult Heteronynchus arator (Coleoptera: scarabaeidae). J Econ Entomol. 90:1382-1391 Belimov AA, Hontzeas N, Safronova VI, Demchinskaya SV, Piluzza G, Bullitta S and Glick BR (2005). Cadmium-tolerant plant growth-promoting bacteria associated with the roots of Indian mustard (Brassica juncea L Czern). Soil Biol Biochem. 37: 241-250 Belnap J and Gillette DA (1997). Disturbance of biological soil crust: impacts on potential wind erodability of sandy desert soils in Utah. USA Land Degrad Develop. 8: 355-362 Belnap J and Harper KT (1995). Influence of cryptobiotic soil crust on elemental content of tissue of two desert seed plants. Arid Soil Res Rehabilit. 9: 107-115 Bloemberg GV and Lugtenberg BJJ (2001). Molecular basis of plant growth promotion and biocontrol by rhizobacteria. Curr Opin Plant Biol. 4:343-350 Brierley CL and Brierley JA (1993). Immobilization of biomass for industrial application of biosorption In: Biohydrometallurgical Technologies; Torma AE, Apel ML, Brierley CL, (Eds); The Minerals, Metals and Materials Society: Warrendale, PA, 2:35-44 Buckley DH, Huangyutitham V, Hsu SF and Nelson TA (2007). Stable isotope probing with 15 N2 reveals novel non-cultivated diazotrophs in soil. Appl Environ Microbiol. 73: 31963204 Burd GI, Dixon DG and Glick BR (1998). A plant growth-promoting bacterium that decreases nickel toxicity in seedlings. Appl Environ Microbiol. 64: 3663-3668 Campbell SE (1979). Soil stabilization by a prokaryotic desert crust Implications for precambrian land biota. Orig life. 9:335-348 Carroll G (1988). Fungal endophytes in stems and leaves-from latent pathogen to mutualistic symbiont. Ecology. 69: 2-9 Clark RB and Zeto SK (2000). Mineral acquisition by arbuscular mycorrhizal plants. J Plant Nutr. 23: 867-902 Compant S, Duffy B, Nowak J, Clement C and Barka EA (2005). Use of plant growthpromoting bacteria for biocontrol of plant diseases: principles, mechanisms of action, and future prospects. Appl Environ Microb. 71: 4951-4959 Conn V, Walker A and Franco C (2008). Endophytic actinobacteria induce defense pathways in Arabidopsis thaliana. Mol Plant Microbe Interact. 21: 208-218 Cook RJ (2007). Toward cropping systems that enhance productivity and sustainability. Proc Natl Acad Sci. 103:18389-18394

Microbes: In Action

Cybulski Z, Dzuirla E, Kaczorek E and Olszanowski A (2003). The influence of emulsifiers on hydrocarbon biodegradation by Pseudomonadacea and Bacillacea strains. Spill Sci Technol B. 8:503-507 De Weert S, Hans V, Mulders HM, Irene K, Nico H, Guido VB, Jos V, Rene De M and Ben JJL (2002). Flagella-driven chemotaxis towards exudates components is an important trait for tomato root colonization by Pseudomonas fluorescens. Mol Plant Microbe. 15: 11731180 DeCaire GZ, De Cano MS, De Mule MC, Palma RM and Colombo K (1997). Exopolysaccharide of Nostoc muscorum (cyanobacteria) in the aggregation of soil particles. J Appl Phycol. 4: 249-253 DeCaire GZ, De Cano MS, De Mule MCZ and De Halperin DR (1990). Antimycotic products from the cyanobacterium Nostoc muscorum against Rhizoctonia solani. Phyton. 51: 1-4 Decho AW (1990). Microbial exopolymer secretions in ocean environments: their role(s) in food webs and marine processes. Oceanogr Mar Biol Ann Rev. 28: 73-153 DeMule MCZ, De Caire GZ, De Cano MS and De Halperin DR (1991). Bioactive compounds from Nostoc muscorum (Cianobacterias). Cytobios. 66: 169-172 Dougherty CT, Knapp FW, Bush LP, Maul JE and Van Willigen J (1998). Mortality of horn fly (Diptera: Muscidae) larvae in bovine dung supplemented with loline alkaloids from tall fescue. J Med Entomol. 35:798-803 Egamberdiyeva D and Hoflich G (2004). Effect of plant growth-promoting bacteria on growth and nutrient uptake of cotton and pea in a semi-arid region of Uzbekistan. J Arid Environ. 56:293-301 Falchini L, Sparvoli E and Tomaselli L (1996). Effect of Nostoc (cyanobacteria) inoculation on the structure and stability of clay soils. Biol Fertil Soils. 23:246-252 Fiore MF and Trevors JT (1994). Cell composition and metal tolerance in cyanobacteria. Biometals. 7:83-103 Flaibani A, Olsen Y and Painter TJ (1989). Polysaccharides in desert reclamation: composition of exocellular proteoglycan complexes produced by filamentous blue-green and unicellular green edaphic algae. Carbohydrate Res. 190: 235-248 Friis N and Myers-Keith P (1986). Biosorption of uranium and lead by Streptomyces longwoodensis. Biotechnol Bioeng. 28:21-28 Gaur A and Adholeya A (2004). Prospects of arbuscular mycorrhizal fungi in phytoremediation of heavy metal contaminated soils. Curr Sci. 86: 528-34 Glick BR (1995). The enhancement of plant growth by free-living bacteria. Can J Microbiol. 41:109-117 Glick BR, Patten CL, Holguin G and Penrose DM (1999). Biochemical and Genetic Mechanisms Used by Plant Growth Promoting Bacteria Imperial College Press, London, UK, pp 86-179 Guibal E, Roulph C and Le Cloirce P (1995). Infrared spectroscopic study of uranyl biosorption by fungal biomass and materials of biological origin. Environ Sci Technol. 29: 2496-2503 Gunasekaran P, Muthukrishnan J and Rajendran P (2003). Microbes in Heavy Metal Remediation. Indian J Exp Biol. 41:935-944 Gupta VVSR, Rovira AD and Roget DK (2011). Principles and management of soil biological factors for sustainable rainfed farming systems In: P Tow (ed), Rainfed farming systems' Springer Science and Business Media. pp 149-184 Gyaneshwar P, Kumar GN, Parekh LJ and Poole PS (2002). Role of soil microorganisms in improving P nutrition of plants. Plant and Soil. 245: 83-93 Hegde DM, Dwivedi BS and Babu SNS (1999). Biofertilizers for cereal production in India-a review. Indian J Agric Sci. 69: 73-83 Higa T (1991). Effective microorganisms: A biotechnology for mankind In: JF Parr, SB Hornick and CE Whitman (ed) Proceedings of the First International Conference on Kyusei Nature Farming US Department of Agriculture, Washington, DC, USA p8-14

Competent Soil Microorganisms for Agricultural Sustainability

Higa T (1994). Effective Microorganisms: A New Dimension for Nature Farming In: JF Parr, SB Hornick and ME Simpson (ed) Proceedings of the Second International Conference on Kyusei Nature Farming US Department of Agriculture, Washington, DC, USA pp. 20-22 Hodge A, Campbell CD and Fitter AH (2001). An Arbuscular Mycorrhizal fungus accelerates decomposition and acquires nitrogen directly from an organic source. Nature. 413: 29799 Hornick SB (1992). Factors affecting the nutritional quality of crops. Amer J Alternative Agric. 7:63-68 Ilhan S, Nourbakhsh MN, Kilicarslan S and Ozdag H (2004). Removal of chromium, lead and copper ions from industrial wastewaters by Staphylococcus saprophyticus. Turk Electronic J Biotech. 2:50-57 Jangid K, Williams MA, Franzluebbers AJ, Schmidt TM, Coleman DC and Whitman WB (2011). Land-use history has a stronger impact on soil microbial community composition than above ground vegetation and soil properties. Soil Biol Biochem. 43:2184-2193 Jeffries DL, Klopatek JM, Link SO and Bolton Jr H, (1992). Acetylene reduction by cryptogamic crusts from a blackbrush community as related to resaturation and dehydration. Soil Biol Biochem., 24: 1101-1105 Jogdand SN (1995). Environmental Biotechnology, 1st Ed., Himalaya Publishing House, Bombay India, pp 104-120 Johansson JF, Paul LR and Finlay RD (2004). Microbial interactions in the mycorrhizosphere and their significance for sustainable agriculture. FEMS Microbiol Ecol. 48(1):1-13 Kapley A, Purohit HJ, Chhatre S, Shanker R and Chakrabarti T (1999). Osmotolerance and hydrocarbon degradation by a genetically engineered microbial consortium. Bior Tech. 67:241-245 Kaushik S, Sahu BK, Lawania RK and Tiwari RK (1999). Occurrence of heavy metals in lentic water of Gwalior region. Pollut Res. 18: 137-140 Khalid AM, Ashfaq SR, Bhatti TM, Anwar MA, Shemsi AM and Akhtar K (1993). The uptake of microbially leached uranium by immobilized microbial biomass, In: Biohydrometallurgical Technologies Torma AE, Apel ML, Brier-ley CL, (Eds) The Minerals, Metals and Materials Society: Warrendale PA, 2:299-308 Kloepper JW, Ryu CM and Zhang S (2004). Induced systemic resistance and production of plant growth by Bacillus spp. Phytopathology. 94: 1259-1266 Kula AR, Harnett DC and Wilson GWT (2005). Effects of mycorrhizal symbiosis on tallgrass prairie plant–herbivore interactions. Ecol Lett. 8: 61-69 Kumar MS, Kirubanandan S, Sripriya R and Sehgal PK (2008). Triphala promotes healing of infected full-thickness dermal wound. J Surg Res. 144: 94-101 Kuyucak N and Volesky B (1988). Biosorbents for recovery of metals from industrial solutions. Biotechnol Left. 10(2):137-142 Lange OL, Meyer A, Zellner H and Heber U (1994). Photosynthesis and water relations of lichen soil crusts: field measurements in the coastal fog zone of the Namib Desert. Funct Ecol. 8: 253-264 Lemanceau P, Corberand T, Gardan L, Latour X, Laguerre G, Boeufgras J and Alabouvette C (1995). Effect of two Plant Species, Flax (Linum usitatissinum L) and Tomato (Lycopersicon esculentum Mill), on the diversity of soilborne populations of Fluorescent Pseudomonads. Appl Environ Microb. 61:1004-1012 MalamIssa O, LeBissonnais Y, Defarge C and Trichet J (2001). Role of a cyanobacterial cover on structural stability of sandy soils in the sahelian part of western Niger. Geoderma. 101: 15-30 Manchanda H and Kaushik A (2000). Algal flora of aridisols of Rohtak and salt tolerance of the indigenous cyanobacteri. Trop Ecol. 41: 217-223 Mantelin S and Touraine B (2004). Plant growth-promoting bacteria and nitrate availability: Impacts on root development and nitrate uptake. J Exp Bot. 55:27-34 Marathe KV (1972). Role of some blue-green algae in soil aggregation In: Ist International Symposium on Taxonomy and Biology of Blue-Green Algae, Madras, India, pp 328-331

Microbes: In Action

Martinez-Viveros O, Jorquera MA, Crowley DE, Gajardo G and Mora ML (2010). Mechanisms and Practical Considerations involved in Plant Growth Promotion by Rhizobacteria. J Soil Sci Plant Nutr. 10(3): 293-319 Mattuschka B, Junghaus K and Straube G (1993). Biosorption of metals by waste biomass In: Biohydrometallurgical Technologies Torma AE, Apel ML, Brierley CL (Eds); The Minerals, Metals and Materials Society: Warrendale, PA, 2:125-132 Mazor G, Kidron GJ, Vonshak A and Abeliovich A (1996). The role of cyanobacterial exopolysaccharides in structuring microbial crusts. FEMS Microbiol Ecol. 21:121-130 Miles CO, diMena ME, Jacobs SWL, Garthwaite I, Lane GA, Prestidge RA, Marshal SL, Wilkinson HH, Schardl CL, Ball OJP and Latch CM (1998). Endophytic fungi in indigenous australasian grasses associated with toxicity to livestock. Appl Environ Microb. 64: 601-606 Mishra M, Kumar U, Mishra PK and Prakash V (2010). Efficiency of Plant Growth Promoting Rhizobacteria for the Enhancement of Cicer arietinum L Growth and Germination under Salinity. Adv Biol Res. 4(2): 92-96 Nisha R, Kaushik A and Kaushik CP (2007). Effect of indigenous cyanobacterial application on structural stability and productivity of an organically poor semi-arid soil. Geoderma. 138: 49-56 Nyporko AY, Yemets AI, Klimkina LA and Blume YB (2002). Sensitivity of Eleusine indica callus to Trifluralin and Amiprophosmethyl in correlation to the binding of these compounds to tubulin. Russ J Plant Physiol. 49: 413-418 Odokuma LO (2009). Effect of Culture Age and Biomass Concentration on Heavy Metal Uptake by Three Axenic Bacterial Cultures, Advances in Natural and Applied Sciences. 3(3):339-349 Parr JF, Hornick SB and Kaufman DD (1994). Use of microbial Inoculants and organic fertilizers in agricultural production In: Proceedings of the International Seminar on the Use of Microbial and Organic Fertilizers in Agricultural Production Published by the Food and Fertilizer Technology Center, Taipei, Taiwan Parr JF, Papendick RI, Hornick SB and Meyer RE (1992). Soil quality: Attributes and relationship to alternative and sustainable agriculture. Amer J Alternative Agric. 7: 5-11 Patten CL and Glick BR (1996). Bacterial biosynthesis of Indole-3-acetic acid. Can J Microbiol. 68: 3795-3801 Persello-Cartieaux F, Nussaume L and Robaglia C (2003). Tales from the underground: molecular plant-rhizobacteria interactions. Plant Cell and Environ. 26:189-199 Philip L, Iyengar L and Venkobacher L (2000). Site of interaction of copper on Bacillus polymyxa, Water Air Soil Pollution. 119: 11-21 Picard C and Bosco M (2008). Genotypic and phenotypic diversity in populations of plantprobiotic Pseudomonas spp colonizing roots. Naturwissenschaften. 95: 1-16 Pirttila AM, Joensuu P, Pospiech H, Jalonen J and Hohtola A (2004). Bud endophytes of Scots pine produce adenine derivatives and other compounds that affect morphology and mitigate browning of callus cultures. Physiol Physiologia Plantarum. 121: 305-312 Pradhan S and Rai LC (2000). Optimization of flowrate, initial metal ion concentration and biomass density for maximum removal of Cu2+ by immobilized Microcystis. World J Microbiol Biotechnol. 16: 579-584 Raaijmakers JM, Vlami M and de Souza JT (2002). Antibiotic production by bacterial biocontrol agents. Antonie van Leeuwenhoek. 81: 537-547 Rai LC, Singh S and Pradhan S (1998). Biotechnological potential of naturally occurring and laboratory grown Microcystis in biosorption of Ni2+ and Cd2+. Current Science. 74: 461463 Rajbanshi A (2008). Study on Heavy Metal Resistant Bacteria in Guheswori Sewage Treatment Plant. Our Nature. 6:52-57 Reed M and Glick B (2005). Growth of canola (Brassica napus) in the presence of plant growth-promoting bacteria and either copper or polycyclic aromatic hydrocarbons. Can J Microbiol. 51:1061-1069

Competent Soil Microorganisms for Agricultural Sustainability

Reed SC, Cleveland CC and Townsend AR (2011). Functional ecology of free-living nitrogen fixation: A contemporary perspective. Annu Rev Ecol Evol Syst. 42: 489-512 Reganold JP, Papendick RI and Parr JF (1990). Sustainable Agriculture. Sci Am. 262(6): 112120 Richardson A and Simpson RJ (2011). Soil microorganisms mediating phosphorus availability. Plant Physiol. 156: 989-996 Rillig MC (2004). Arbuscular mycorrhizae terrestrial ecosystem processes. Ecol Lett. 7: 740-54 Rogers SL and Burns RG (1994). Changes in aggregate stability, nutrient status, indigenous microbial populations, and seedling emergence, following inoculation of soil with Nostoc muscorum. Biol Fertil Soils. 18: 209-215 Ryu CM, Farag MA, Hu CH, Reddy MS, Wei H-X, Pare PW and Kloepper JW (2003). Bacterial volatiles promote growth in Arabidopsis. Proceedings of the National Academy of Sciences 100:4927-4932 Safronova V, Stepanok V, Engqvist G, Alekseyev Y and Belimov A (2006). Root associated bacteria containing 1-aminocyclopropane-1- carboxylate deaminase improve growth and nutrient uptake by pea genotypes cultivated in cadmium supplemented soil. Biol Fertil Soils. 42: 267-272 Saleem M, Arshad M, Hussain S and Bhatti AS (2007). Perspective of plant growth promoting rhizobacteria (PGPR) containing ACC deaminase in stress agriculture. J Ind Microbiol Biotechnol. 34:635-648 Sar P and D'Souza SF (2001). Biosorptive uranium uptake by Pseudomonas strain: Characterization and equilibrium studies. J Chem Tech Biot. 76:1286-1294 Selosse Marc-Andre Richard F, He X and Simard S (2006). Mycorrhizal networks: des liaisons dangereuses? Trends Ecol Evol. 21:621-628 Sheng XF and Xia JJ (2006). Improvement of rape (Brassica napus) plant growth and cadmium uptake by cadmium-resistant bacteria. Chemosphere. 64:1036-1042 Smith S, Smith F and Jakobsen I (2004). Functional diversity in arbuscular mycorrhizal (AM) symbiosis: the contribution of the mycorrhizal P uptake pathway is not correlated with mycorrhizal responses growth or total uptake. New Phytol. 162: 511-24 Smith SE and Read DJ (2008). Mycorrhizal symbiosis 3rd Edn. Academic Press London, UK Tarafdar JC and Marschner H (1994). Efficiency of VAM hyphae in utilization of organic phosphorus by wheat plants. Soil Sci Plant Nutr. 40: 593-600 Tarangini K (2009). Biosorption of Heavy Metals using Individual and Mixed cultures of Pseudomonas aeruginosa and Bacillus subtilis M Tech Thesis, Department of Chemical Engineering, National Institute of Technology, Rourkela India. Tassara C, Zaccaro MC, Storni MM, Palma M and Zulpa G, (2008). Biological control of lettuce white mold with cyanobacteria. Int J Agric Biol. 10: 487-492 Teuscher E, Lindequist U and Mundt S (1992). Cyanobakterien, Quellen biogener Wirkstoffe. Pharm Ztg Wiss. 137: 57-69 Tilman D (1999). Global environmental impacts of agricultural expansion: the need for sustainable and efficient practices. P Natl Acad Sci. 96: 5995-6000 Townsley CC, Ross IS and Atkins AS (1986). Biorecovery of metallic residues from various industrial effluents using filamentous fungi. In: Fundamental and Applied Biohydrometallurgy; Lawrence RW, Branion RMR, Ebner HG, (Eds); Elsevier: Amsterdam, pp. 279-289 van der Heijden MGA, Wiemken A and Sanders IR (2003). Different arbuscular mycorrhizal fungi alter coexistence resource distribution between co-occurring plant. New Phytol. 157: 569-78 van der Heijden MGA, Wiemken A and Sanders IR (2004). Arbuscular mycorrhizal fungi as support systems for seedling establishment in grassland. Ecol Lett. 7: 293-303 Van Overbeek L and van Elsas JD (2008). Effects of plant genotype and growth stage on the structure of bacterial communities associated with potato (Solanum tuberosum L). FEMS Microbiol Ecol. 64: 283-296 Verma SK and Singh SP (1995). Multiple metal resistance in the cyanobacterium Nostoc muscorum. Bull Environ Contam. 54:614-619

Microbes: In Action

Verrecchia E, Yair A, Kidron GJ, Verrecchia K, (1995). Physical properties of the psammophile cryptogamic crust and their consequences to the water regime of sandy soils, northwestern Negev desert. Israel J Arid Environ. 29: 427-437 Weber OB, Baldani VLD, Teixeira KRS, Kirchhof G, Baldani JI and Dobereiner J (1999). Isolation and characterization of diazotrophic bacteria from banana and pineapple plants. Plant Soil. 210: 103-113 Weller D, Raaijmakers JM, Mcspadden Gardener BB and Thomashow LS (2002). Microbial populations responsible for specific soil suppressiveness to plant pathogens. Annu Rev Phytopathol. 40: 309-348 Westerdijk CE (2000). Biological Control of Leaf Rot in Lettuce Volleglonds, Bull, pp 6-8 Whipps JM (2001). Microbial interactions and biocontrol in the rhizosphere. J Exp Bot. 52:487-511 Whipps JM (2004). Prospects and limitations for mycorrhizas in biocontrol of root pathogens. Can J Bot. 82: 1198-227 Wolfe B, Husband B and Klironomos JN (2005). Effects of a belowground mutualism on an aboveground mutualism. Ecol Lett. 8: 218-23 Yee N, Benning LG, Phoenix VR and Ferris FG (2004). Characterization of metalcyanobacteria sorption reactions: a combined macroscopic and infrared spectroscopic investigation. Environ Sci Technol. 38: 775-782 Yuen GY, Craig LM, Kerr ED and Steadman JR (1994). Influences of antagonist population levels, blossom development stage and canopy temperature on the inhibition of the Sclerotinia sclerotiorum on dry edible bean by Erwinia herbicola. Phytopathology. 84: 495501 Zulpa G, Zaccaro MC, Boccazzi F, Parada JL and Storni M (2003). Bioactivity of intra and extracellular substances from cyanobacteria and lactic acid bacteria on wood blue stain fungi. Biol Contr. 27: 345-348

CHAPTER 2 Role of Microbes in Agriculture Leela Wati1, Kushal Raj2 and Annu Goel1 1

Department of Microbiology, 2Department of Plant Pathology CCS Haryana Agricultural University, Hisar -125004, Haryana (India) Corresponding author: [emailprotected]

INTRODUCTION The beginning of 'agro' or 'agriculture' marks the beginning of 'civilized' or 'sedentary' society. Climate change and increase in population during the Holocene Era (10,000 BC onwards) led to the evolution of agriculture. During the Bronze Age (9000 BC onwards), domestication of plants and animals transformed the profession of the early hom*osapiens from hunting and gathering to selective hunting, herding and finally to settled agriculture. Eventually the agricultural practices enabled human beings to establish permanent settlements and expand urban based societies. Until the Industrial Revolution, the vast majority of the human population laboured in agriculture. Pre-industrial agriculture was typically subsistence agriculture/self-sufficiency in which farmers raised most of their crops for their own consumption instead of cash crops for trade. A remarkable shift in agricultural practices has occurred over the past century in response to new technologies, and the development of world markets. CONCEPT OF SUSTAINABLE AGRICULTURE Green revolution renovated the agricultural practices, begun in Mexico in 1940s and spread worldwide during 1950s and 1960s, and significantly increased the production of calories per acre of agriculture. The initiatives, led by Norman Borlaug, the "Father of the Green Revolution", changed the status of many developing countries including Mexico, India and Pakistan from a food-deficient country to the food exporter and food-sufficient country and credited with saving hundreds of millions of people from starvation. Though conventional agriculture has largely increased the crop yields but the depletion of top soil and soil vitality due to monocultures, reduction in farm land due to expansion in urban population and business, increasing demand of fertilizers and pesticides to raise per capita food production, increasing energy requirements for tilling to aerate soil and increasing irrigation costs, groundwater purity are of prime concern of agricultural society now-a-days (Reganold et al., 1990). A fundamental shift is taking place worldwide in agricultural practices and food production. In the past, the principal driving force was to increase the yield

Microbes: In Action

potential of food crops and their productivity. Until 1967 the government largely concentrated on expanding the farming area but the population was growing at a much faster rate than food production. This called for an immediate and drastic action to increase yield. Today, the drive for productivity is increasingly combined with the desire and even the demand for sustainability. Many agriculture-dependent developing countries adopt more efficient and sustainable production methods and adapt to climate change. Sustainable development is one of the most challenging goals for mankind, and a vital challenge for agricultural production around the world in which the high productivities of plants should be ensured using their natural adaptive potentials, with a minimal disturbance of the environment (Noble and Ruaysoongnern, 2010). Sustainable agriculture uses a special farming technique wherein the environmental resources can be fully utilized and at the same time ensuring that no harm is done to it. Thus the technique is environment friendly and ensures safe and healthy agricultural products. This relies on soil biological process and soil biodiversity (Mosttafiz et al., 2012). SOIL AND AGRICULTURE Soil being a critical component on earth not only for sufficient food production but also for maintaining the sustainable global environmental conditions; attract many researchers to evaluate its role in various direct and indirect physico-chemical and biological processes. The soil quality has been defined by many researchers as 'the capacity of a specific kind of soil to function, within natural or managed ecosystem boundaries, to sustain biological productivity, promote environmental quality, and maintain plant and animal health. A unique balance of chemical, physical and biological components contribute towards maintaining soil quality. Agri-ecosystem functioning is governed largely by soil microbial dynamics (Marcel et al., 2008). Sustainable productive agriculture depends on a healthy community of soil microbes that decompose organic matter and contribute to the biological recycling of chemical nutrients that affect soil fertility. Thus interactions between the diversity of primary producers (plants) and decomposers (microbes) are the two key functional groups that form the basis of all ecosystems and have major consequences on the functioning of agricultural ecosystems. Soil microorganisms are highly diverse and abundant organisms on earth. Several biotic or abiotic factors lead to the alteration of microbial community structure and composition which may directly or indirectly influence the soil ecosystem, nutrient cycle activity and crop production. Microbes are instrumental to fundamental processes that drive stability and productivity of agro-ecosystems (Singh et al., 2011). Microbial populations and processes influence soil fertility and structure in a variety of ways, each of which has an ameliorating effect on the main soil-based constraints to productivity. For many years, soil microbiologists and microbial ecologists have tended to differentiate soil microorganisms as beneficial or harmful according to their functions and how they affect soil quality, plant growth and yield, and plant health.

Role of Microbes in Agriculture

SOIL MICROBES Microbes are the tiny creatures that individually are too small to be seen clearly with the naked eyes. Microbes make up a large part of the planet's living material. They are the oldest form of life on earth. Microbe fossils date back more than 3.5 billion years to a time when the Earth was covered with oceans that regularly reached the boiling point. Soil microbes play key roles in ecosystems and influence a large number of important ecosystem processes, including nutrient acquisition (Smith and Read 1997), nitrogen cycling (Tiedje 1988; Kowalchuk and Stephen 2001), carbon cycling and soil formation (Rillig and Mummey 2006). Moreover, soil microbes represent the unseen majority in soil and comprise a large portion of the genetic diversity on Earth (Whitman et al., 1998). It has been estimated that one gram of soil contains as many as 1010– 1011 bacteria (Horner-Devine et al., 2003), 6000–50 000 bacterial species (Curtis et al., 2002), and up to 200 m fungal hyphae (Leake et al., 2004). Efficient and potential soil microbiota including all five major groups of microorganisms i.e. bacteria, viruses, fungi, algae and protozoa can significantly benefit the Agricultural practices (Rangaswami, 2004) Bacteria: They are more dominant group of microorganisms in the soil and equal to one half of the microbial biomass in soil. Their population ranges between 100,000 to several hundred millions for gram of soil. They belong to Autochthnous and Zymogenous groups and majority are heterotrophs. Common soil bacteria are Arthrobacter, Bacillus, Pseudomanas, Clostridium, Micrococcus. Actinomycetes: They are intermediate group between bacteria and fungi and are numerous and widely distributed in soil. Their abundance is next to bacteria ranging between 104 - 108/g soil and their population increases with depth of soil. About 70% of soil actinomycetes are Streptomyce. Many of them are known to produce antibiotics and maintain biological equilibrium in soil. Fungi: They are more numerous in surface layers of well-aerated and cultivated soils and are dominant in acidic soils. Physical structure of soil is improved by accumulation of mold mycelium within it. Common genera in soil are Aspergillus, Mucor, Penicillium Trichoderma, Alternaria, Fusarium and Rhizopus. Algae: Their population is smaller than bacteria and fungi. They are found in most of the soils in number ranges from 100 to 10,000 per g. They are present on surface or subsurface of the soil. The major types present are green algae and diatoms. Protozoa: They are unicellular and their population ranges from 10,000 to 100,000 per g of soil. Most of the soil forms are flagellates, amoebae or ciliates. They derive their nutrition by devouring soil bacteria and are abundant in upper layer of the soil. They are regulating the biological equilibrium in soil. Viruses: Bacterial, plant and animal viruses find their way in soil, through addition of plant and animal wastes. Farmers and ranchers often think of microbes as pests that are destructive to their crops or animals (as well as themselves), but many microbes are beneficial. About fifty percent of a plant's primary production disappears underground to establish the root network and feed the microorganisms. That is what happens in a healthy natural system. It is a mutually beneficial relationship that has

Microbes: In Action

evolved over eons and led to the formation of our most fertile and wellstructured soils. Even the timing is perfect. In most natural systems, the greatest microbial turnover and release of nutrients, coincides with the plant's growth and its seasonal needs. Soil microbes (bacteria and fungi) are essential for decomposing organic matter and recycling old plant material. Some soil bacteria and fungi form relationships with plant roots that provide important nutrients like nitrogen or phosphorus. Fungi can colonize upper parts of plants and provide many benefits, including drought tolerance, heat tolerance, resistance to insects and resistance to plant diseases. Viruses are almost always thought of as agents of disease. This is because the ones that cause disease are the ones that have been studied. About half the wild plants have viruses, but most don't seem to be sick at all. The viruses seem to be living in the plants without doing any harm. The uniqueness of microorganisms and their often unpredictable nature and biosynthetic capabilities, given a specific set of environmental and cultural conditions, has made them likely candidates for solving particularly difficult problems in the life sciences and other fields as well. The various ways in which microorganisms have been used over the past 50 years to advance medical technology, human and animal health, food processing, food safety and quality, genetic engineering, environmental protection, agricultural biotechnology, and more effective treatment of agricultural and municipal wastes provide a most impressive record of achievement. Since microorganisms are useful in eliminating problems associated with the use of chemical fertilizers and pesticides, they are now widely applied in nature farming and organic agriculture (Higa, 1991; Parr et al., 1994) MICROBES AND AGRICULTURE Microbes have been shown to have a reviving action on growing systems. They can improve soil quality, soil health and the growth, yield and quality of crops. Many fertilizer companies are now offering microbes as part of their bio product range, ensuring that the soil is inoculated to perform at its absolute peak. Agricultural production begins with photosynthesis - the conversion of solar energy into chemical form that is an amazing process, but not much efficient one. Even rapid growing plants like corn and sugar cane only fix a maximum of six to seven percent of the sun's energy. The photosynthetic bacteria and algae can increase the amount of energy fixed, because these utilize wavelengths that green plants do not. Photosynthetic or phototropic bacteria are independent self-supporting microbes. They use the energy of sunlight and soil heat to convert secretions from plant roots, organic matter and harmful gases into plant useful substances like amino acids, nucleic acids, sugars and other metabolites. These can all be absorbed directly into plants to promote plant growth and also increase other beneficial microorganisms. Other important species are lactic acid bacteria and yeast. These produce lactic acid from the sugars and carbohydrates the photosynthetic bacteria and yeasts produce. This is a strong sterilizing compound and can suppress some disease inducing microorganisms and nematode populations. It also contributes to the fermentation and breakdown

Role of Microbes in Agriculture

of the tough cellulose and lignin. Yeasts on the other hand have other uses. They produce hormones and enzymes that promote plant cell and root division. They use the amino acids and sugars secreted by the photosynthetic bacteria and plant roots and in turn give off substances which are good growing compounds for the Lactic acid bacteria. So all three species have a separate role to play, and help each other. They also have a symbiotic or mutually beneficial relationship with the roots of plants. So plants grow exceptionally well in soils dominated by these Microbes. Microbes live reproduce and die, at enormous rates and in doing so release a constant stream of nutrients in plant available form. They collect nitrogen and other nutrients from the soil organic matter and mineral particles. They reproduce, so more microbes are collecting and converting nutrients. They die and release what they have collected in a form the plants can use. The plants grow better, assimilate more energy and provide more food for more microbes and so it goes on thus It is a two way process. Living plants absorb energy from the sun, incorporate it with carbon dioxide from the atmosphere, water and nutrients they require from the soil. Then they release oxygen back to the atmosphere and carbon to the soil as carbohydrates, glucose and other carbon forms for the microbes to feed on. The size of this microbial population is governed by the inputs from the plants, the primary producers. MICROBES AS FERTILIZERS There are two types of supplies for agriculture, specifically fertilizer and pesticide. It can be said that the fertilizer is food and pesticide is medicine for plants in conventional agriculture. On the other hand, biofertilizer and biopesticide are referred to each of them, respectively, in sustainable agriculture (Muraleedharan et al., 2010). Micro-organisms found in the soil improve agricultural productivity. Men use naturally occurring organisms to develop biofertilizers and bio-pesticides to assist plant growth and control weeds, pests, and diseases. Micro-organisms that live in the soil actually help plants to absorb more nutrients. Plants and these friendly microbes are involved in "nutrient recycling". The microbes help the plant to "take up" essential energy sources. In return, plants donate their waste by-products for the microbes to use for food. BIOFERTILIZERS Biofertilizers are defined as preparations containing living cells or latent cells of efficient strains of microorganisms that help crop plants' uptake of nutrients by their interactions in the rhizosphere when applied through seed or soil. They accelerate certain microbial processes in the soil which augment the extent of availability of nutrients in a form easily assimilated by plants. Use of biofertilizers is one of the important components of integrated nutrient management, as they are cost effective and renewable source of plant nutrients to supplement the chemical fertilizers for sustainable agriculture. Several microorganisms and their association with crop plants are being exploited in the production of biofertilizers. They can be grouped in different ways based on their nature and function.

Microbes: In Action

Table 1: List of biofertilizers

1. Nitrogen fixing biofertilizers a) Symbiotic b) Free living c) Associative symbiotic 2. Phosphorous biofertilizers a) P solubilizing biofertilizers b) P mobilizing biofertilizers 3. K solubilizing biofertilizers 4. Biofertilizers for micro nutrients a) Silicate and zinc solubilizers 5. Plant growth promoting rhizobacteria a) Production of growth promoting substances b) Biocontrol agents NITROGEN FIXING BIOFERTILIZERS Nitrogen is an element essential for the support of all forms of life. It is found in amino acids and proteins and many other organic compounds. Nitrogen is an element whose content is minimal as compared to that of other mineral nutrients; it determines the intensity of the organic matter accumulation. The source of soil nitrogen is the atmosphere where nitrogen gas occupies about 79% of the total atmospheric gases. Although nitrogen is very abundant in nature, it often limits plant productivity because atmospheric nitrogen is only available to a lesser range of organisms symbiotically associate with higher plants and non-symbiotically (Franche et al., 2009). The global nitrogen is nearly 2.6x1011 kg per year with biological nitrogen fixation contributing for nearly 70%. "Diazotrophy", the ability to fix atmospheric nitrogen catalysed by the enzyme nitrogenase, is distributed among diverse groups of bacteria and archaea. Some of the N2 fixing bacteria (for example, Azospirillum spp., Azotobacter spp., Acetobacter diazotrophicus, Herbaspirillum spp., Bacillus spp., Azoarcus sp.) are found in the rhizosphere and rhizoplane environments of cereal crops. Other N2 fixing bacteria can grow as endophytes in a number of grasses, for example, in a recent study in South Australia Pseudomonas species were the most dominant group of nifH carrying bacteria found in the rhizosphere of perennial native grasses. Evidence suggests the nifH gene is present in a number of non-Frankia actinobacteria (for example, Agromyces, Microbacterium, Corynebacterium and Micromonospora). Diverse group of nitrogen fixing microbes can be classified as free living, Symbiotic and Associative nitrogen fixers. (Table1). FREE LIVING NITROGEN FIXERS Of the various free living nitrogen fixers (bacterial genera- Azotobacter, Beijerinkia, Clostridium, Klebsiella, Anabaena and Nostoc), Azotobacter is of particular importance in agriculture as biofertilizer. They are abundant in welldrained, neutral soil and can fix 15- 20 kg/ha N per year in cereal crops without

Role of Microbes in Agriculture

any symbiosis and do not need a specific host plant. Azotobacter sp. can also produce antifungal compounds to fight against many plant pathogens. They also increase germination and vigour in young plants leading to improved crop stands. SYMBIOTIC NITROGEN FIXERS Symbiotic associations between plants and nitrogen (N)-fixing bacteria that convert atmospheric N into ammonium-N are perhaps best studied (Sprent 2001). Nitrogen-fixing bacteria are important regulators of plant productivity because plants cannot fix atmospheric N and because N is, together with phosphorus (P) and potassium, the main element that limits plant productivity (Chapin 1980). The contribution of N-fixing bacteria to plant productivity is thought to be biggest in tropical savannah, and some grasslands and tropical forests that are dominated by legumes; in these situations, N-fixing bacterial symbionts of the legumes can increase plant productivity by supplying limiting nutrients Several other plants form associations with N-fixing bacteria, include shrubs that associate with actinomycetes (Bond 1983), approximately 150 cycad and 65 Gunnera species that associate with cyanobacteria (Rai et al., 2000), and an unknown number of plant species that harbour endophytes and can fix N. Numerically most abundant are actino-rhizal plants, such as Casuarina, Myrica, Hippophae and Alnus (Bond 1983). Their invasion into new areas has been attributed to their ability to associate with N-fixing actinomycetes, with far reaching consequences for ecosystem properties. The invasion of N-fixing actinorhizal shrubs into N limited forests in Hawaii dramatically enhanced soil N availability and plant productivity in these ecosystems (Vitousek and Walker 1989). Rhizobia (species of Rhizobium, Mesorhizobium, Bradyrhizobium, Azorhizobium, Allorhizobium and Sinorhizobium) as a natural endophyte in leguminous plants have been widely documented (Bhattacharjee et al., 2008). They are symbiotic bacteria that fix atmospheric nitrogen gas in plant root nodules and have a mutually helpful relationship with their host plants. The plant roots supply essential minerals and newly synthesized substances to the bacteria. Because of their N-fixing ability, legumes are less reliant on inorganic N fertilizer than many other non-legume crops such as cereals and pasture grasses. Rhizobium inoculation is a well-known agronomic practice to ensure adequate N supply for legumes in place of N fertilizer. It is reported that Rhizobium can fix 50-300 kg N/h. Globally, annual inputs of fixed nitrogen from crop legume–rhizobia symbioses are estimated as 2.95 million tonnes for pulses and 18.5 million tonnes for oilseed legumes. Bradyrhizobium, Ensifer and Mesorhizobium produce around 80% of the nitrogen in Australian grains, with a value estimated at A$3 billion each year (Gupta, 2012). ASSOCIATIVE NITROGEN FIXERS The concept of biofertilizers was developed with the discovery of nitrogen fixing Azospirillum. Azospirillum was first reported by Beijerinck (Beijerinck, 1925) and it was named as Spirillum lipoferum by Schroeder (Schroeder, 1932). It is an associative nitrogen fixing bacteria. It is used extensively in rice and other cereal

Microbes: In Action

crops as biofertilizers. Commercially important rice Basmati and Super Basmati are also known to benefit from inoculation with Herbaspirillum and Azospirillum (Mirza et al., 2000). Azospirillum inoculation of cereal crops result in an average increased yield of 10-15% in fertilized areas and up to 20% under less developed agricultural practices (Bashan, 1993). Phosphorous Biofertilizers Phosphate plays an important role in crop stress tolerance, maturity, quality and directly or indirectly, in nitrogen fixation. Phosphorus is the second most important macronutrient, second to nitrogen, that is crucial for the stability and continued existence of life. It contributes up to about 0.2% dry mass (Rai et al., 2013). Phosphorous is an integral component of ATP and ADP molecules, phospholipids and nucleic acid, which are important in cellular membranes, and provides compounds for photosynthesis in plants and respiration in animals. There are many elementary and principal roles of P in many plant physiological processes, such as photosynthesis, utilization of sugar and starch, and energy transfer. Aside from this vital metabolic role, P is an indispensable structural component of numerous molecules, including nucleic acids, which are the building blocks of genes and chromosomes in the cell nucleus and are obligatory for cell division and formation of meristematic tissues (Tisdale et al., 1985). For maximum yield, plants are in need for an ample amount of P from the very early stages of growth (Grant et al., 2005). Therefore, direct availability of P determines plant growth, and limited supply of P results in crop yield loss (Hinsinger 2001). In soil, phosphorus may be present in relatively large amounts, but it is one of the most difficult nutrients for plants to acquire. Much of it is poorly available because of the very low solubility of phosphates of iron, aluminium, and calcium, leading to soil solution concentrations of 10 μM or less and very low mobility (Rai et al., 2013). The microbiological processes in the rhizosphere bring about the solubilisation and mobilization of phosphorus in soil and making it available to the plants. P solubilising Biofertilizers (PSB) The phosphate available for plant growth depends not only on the total amount of phosphorus in soil but also on its solubility. The make-up of soil (soil texture) and its acidity (pH) determine the extent to which P is available to the plants (Muraleedharan et al., 2010). Several bacterial and fungal genera have the ability to solubilise insoluble inorganic phosphate compounds, such as tricalcium phosphate, dicalcium phosphate, hydroxyapatite, and rock phosphate. Among the bacterial genera with this capacity are Pseudomonas, Bacillus, Rhizobium, Burkholderia, Achromobacter, Agrobacterium, Microccocus, Aereobacter, Flavobacterium and Erwinia. There are considerable populations of phosphate solubilizing bacteria in soil and in plant rhizospheres. These include both aerobic and anaerobic strains, with a prevalence of aerobic strains in submerged soils. A considerably higher concentration of phosphate solubilizing bacteria is commonly found in the rhizosphere in comparison with non rhizosphere soil (Raghu and Macrae, 2000). The soil bacteria belonging to the genera Pseudomonas and Bacillus and

Role of Microbes in Agriculture

fungal genera Penicillium and Aspergillus are more common. The major microbiological means by which insoluble-P compounds are mobilized is by the production of organic acids, accompanied by acidification of the medium. The organic and inorganic acids convert tricalcium phosphate to di- and- monobasic phosphates with the net result of an enhanced availability of the element to the plant. The type of organic acid produced and their amounts differ with different organisms. Tri- and di-carboxylic acids are more effective as compared to mono basic and aromatic acids. Aliphatic acids are also found to be more effective in P solubilization compared to phenolic, citric and fumaric acids (Mahdi et al., 2010). About 15-25% of insoluble phosphate can be solubilized with this Phosphorus Solubilizing Biofertilizer, saving chemical fertilizers significantly. Phosphorus solubilizing Biofertilizer can solubilize about 30 kg of insoluble source of phosphorus and making it available to plants. Application of PSB, along with nitrogen fixing bacteria, promotes growth and yield of the crops by 30%. P Mobilizing Biofertilizers To overcome the phosphorous limitation in the rhizosphere, the formation of symbiotic structures with mycorrhizal fungi is considered as the most widespread response to increase P acquisition by plants (Smith et al., 2000, Burleigh et al., 2002, Tibbett and Sanders 2002), as illustrated by the observation that mycorrhizal plants accumulate more P than non-mycorrhizal plants (Smith and Read 1997, 2008, Chalot et al., 2002). MYCORRHIZAE The term Mycorrhiza denotes "fungus roots". It is a symbiotic association between host plants and certain group of fungi at the root system, in which the fungal partner is benefited by obtaining its carbon requirements from the photosynthates of the host and the host in turn is benefited by obtaining the much needed nutrients especially phosphorus, calcium, copper, zinc etc., which are otherwise inaccessible to it, with the help of the fine absorbing hyphae of the fungus. These fungi are associated with majority of agricultural crops, except with those crops/plants belonging to families of Chenopodiaceae, Amaranthaceae, Caryophyllaceae, Polygonaceae, Brassicaceae, Commelinaceae, Juncaceae and Cyperaceae. They are ubiquitous in geographic distribution occurring with plants growing in arctic, temperate and tropical regions alike. Mycorrhizal fungi are widespread and form symbiotic associations with the roots of 80% of all terrestrial plant species (Smith and Read 1997). Mycorrhizal fungi often enhance resource complementarity by providing nutrients that are otherwise inaccessible to plant roots. The most abundant and important groups of mycorrhizal fungi are the arbuscular mycorrhizal (AM) fungi, the ecto-mycorrhizal (EM) fungi and the ericoid mycorrhizal (ERM) fungi. Arbuscular Mycorrhizal Fungi Arbuscular mycorrhizal (AM) symbioses that first evolved 400 million years ago, coinciding with the appearance of the first land plants. Crop domestication, in comparison, is a relatively recent event, beginning 10, 000 years ago (Sawers et

Microbes: In Action

al., 2007). Arbuscular Mycorrhiza occur over a broad ecological range from aquatic to desert environments (Mosse et al., 1981). There are six genera of fungi that contain species, which are known to produce Arbuscular mycorrhizal fungi (AMF) with plants. Two of these genera, Glomus and Sclerocytis, produce chlamydospores only. Four genera form spores that are similar to azygospores: Gigaspora, Scutellospora, Acaulospora and Entrophospora. AM fungi are abundant in grassland, savannah and tropical forests and associate with many grasses, herbs, tropical trees and shrubs (Read and Perez-Moreno 2003). In contrast, others have found that AM fungi alter the distribution of nutrients amongst co-existing grassland species without altering total plant productivity (Grime et al., 1987). Enhanced P uptake is one of the mechanism by which AM fungi can enhance plant productivity and experiments with single plants or experimental plant communities have shown that AM fungi contribute to upto 90% of plant P uptake (Jakobsen et al., 1992). Enhanced P uptake is especially important for plant species with high P-requirement such as legumes, or under conditions when plant productivity is strongly determined by P availability such as in the tropics. Some recent studies have also shown that AM fungi can contribute to enhanced N-acquisition under some conditions (Hodge et al., 2001). AM fungi not only exist for long periods in soil, but they are now known to produce a glycoprotein called glomalin, especially in soils of fine texture. Glomalin may exist for long periods in the absence of the fungus (Steinberg and Rillig 2002). Glomalin is important because it contains carbon and thus may be a carbon store. Glomalin also attaches to the surface of and binds microaggregates thus it also plays a secondary role in soil structure. Ecto-Mycorrhizal Fungi EM fungi associate with tree species and are abundant in temperate and boreal forests and in some tropical forests (Alexander and Lee 2005). Ectomycorrhizal fungi release organic compounds as low-molecular weight organic anions (LMWOAs) and phosphatases. LMWOAs bring about mineral P mobilisation while phosphatases play role in organic P mobilisation ((Plassard and Fransson 2009). Approximately 30 species of Ectomycorrhizal fungi belonging to the genera Cortinarius, Lactarius, Paxillus, Piloderma, Pisolithus and Suillus were found to be able to release substantial amounts of LMWOAs, with oxalate being the predominant form Ectomycorrhizal fungi can acquire N from litter through extensive hyphal networks that forage for nutrients and by excreting a wide range of extracellular enzymes that can degrade organic matter (Leake and Read 1997). Pot experiments (Simard et al., 2002) and field studies (Hobbie and Hobbie 2006) have shown that up to 80% of all plant N in boreal forests is derived from EM fungi. Ericoid Mycorrhizal Fungi Ericoid mycorrhizal fungi are most abundant in heath landwhere they associate with members of the Ericaceae (Smith and Read 1997). The ericoid mycorrhiza is of particular importance to the host plants because of its capacity to acquire nitrogen and phosphorus from organic P sources in extremely acidic conditions. The presence of ecto-mycorrhizal fungi is of pivotal importance for plant

Role of Microbes in Agriculture

productivity in most boreal and temperate forests. Nutrient availability in these ecosystems is usually low and most nutrients are present in organic form in litter and humus (Read and Perez-Moreno 2003). The fungi access protein held on protein-phenol complexes. In these acidic soils, the most important source of phosphate is in organic form, probably as phytates complexed with iron and aluminium. The products of digestion are transported to the host plant. In acidic soils, iron, manganese and aluminium are present in highly available forms. The fungus appears to regulate plant access to these ions, either through siderophores (Fe), or tolerance of high concentrations (Al, Mn) (Smith and Read, 2008). Several experimental studies reported that AM fungi enhance plant productivity in grassland, and up to two-fold increases have been found (Vogelsang et al., 2006). Potassium Solubilising Biofertilizers Potassium is one of the essential micronutrient and the most abundantly absorbed cation in higher plants required for enzyme activation, regulation of osmotic pressure, ATP production and protein synthesis. It plays an important role in growth and development of plants. In addition to plant metabolism, potassium improves crop quality because it extends grain filling period, helps in grain filling, strengths straw, increases disease resistance and helps the plant to withstand stress. Potassium is present in relatively large quantity in soil ranging between 0.5 and 2.5%. In most cases only a small amount of it is available to plants. Application of chemical fertilizers have side effects such as leaching out, polluting water basins, destroying microorganisms and friendly insects thus making crops more sensitive to friendly insects. Potassium solubilizing microorganisms such as Aspergillus niger, Frateuria aurantia, Entereobacter harmaechei, Bacillus mucilaginous and Bacillus edaphicus are able to solubilize potassium rocks such as mica, illite and orthoclases and make it available to plants (Sugumaran and Janarthanam,2007) Zinc Solubilizing Biofertilizers Zinc is one of the eight essential trace elements or micronutrients required for the normal healthy growth and reproduction of crop plants and is required in relatively small concentrations in plant tissues (5–100 mg/kg. It is found in the earth's crust to the tune of 0.008 per cent but more than 50 per cent of Indian soils exhibit deficiency of zinc with content must below the critical level of 1.5 ppm of available zinc (Katyal and Rattan, 1993). The role of zinc in the nutrition and physiology of both eukaryotic and prokaryotic organisms, especially its importance for activity of many enzymes is widely studied (Hughes and Poole, 1989). Many bacterial enzymes contain zinc in the active center or in a structurally important site (Clarke and Berg, 1998). Root cell membrane permeability is increased under Zn deficiency, which might be related to the function of Zn in cell membranes (Parker et al., 1992). Since zinc is a limiting factor in crop production in many soils of the world, the exogenous application of soluble zinc sources, similar to fertilizer application, has been advocated to various crops. This causes transformation of about 96-99 percent of applied available zinc to various unavailable forms. This zinc thus made unavailable can

Microbes: In Action

be reverted back to available form by inoculating a microbial strain capable of solubilizing it (Saravanan et al., 2003). Zinc solubilizing potential of few bacterial genera has been studied. These microorganisms can be used as biofertilizers for Zn solubilisation. Bacillus sp. (Zn solubilizing bacteria) can be used as bio-fertilizer for zinc or in soils where native zinc is higher or in conjunction with insoluble cheaper zinc compounds like zinc oxide (ZnO), zinc carbonate (ZnCO3) and zinc sulphide (ZnS) instead of costly zinc sulphate (Mahdi et al., 2010). Thiobacillus thioxidans, Thiobacillus ferroxidans and facultative thermophilic iron oxidizers solubilize zinc from sulphide ore (sphalerite). A few fungal genera possess immense potential of solubilizing zinc tolerating a high zinc level. Aspergillus niger was found to grow under 1000 mg Zn and this fungi is used to quantify zinc in soils containing low zinc (2 mg kg-1 available zinc) (Bullen and Kemila, 1997). Recently Zinc solubilising ability of Pseudomonas fluorescens has also been reported using Zinc oxide, Zinc carbonate and Zinc sulphide (Bapiri et al., 2012) Plant Growth-Promoting Rhizobacterial (PGPR) Biofertilizers Plant growth-promoting rhizobacteria are a heterogeneous group of bacteria that can be found in the rhizosphere, at root surface and in association with roots which can improve the extent or quality of plant growth. These include: Bacillus, Actinomycetes, Azotobacter, Azospirillum, Pseudomonas, Acetobacter, Burkholderia, Enterobacter, Serratia, Paenibacillus etc. PGPR may have direct or indirect effects on health, growth and development of plants. Probiotics for Plants Probiotics for human health are not new but the concept of managing plant health through the manipulation of probiotic organisms associated with plants has gained interest only recently. Plant-specific stimulation of specific microbial groups in their rhizosphere suggests that plants may have evolved to strategically stimulate and support particular microbial groups capable of producing antibiotics as a defense against diseases caused by soil-borne pathogens. The direct effects refers to the production of plant growth regulators like indoleacetic acid (IAA), gibberellic acid, cytokinins and ethylene providing the host plant with fixed nitrogen or to the solubilization of soil phosphorus. The indirect effects occurs when rhizobacteria lessen or prevent the deleterious effect of one or more phytopathogenic microorganisms through competition for nutrients, siderophore-mediated competition for iron, antibiosis or the induction of systemic resistance in the plant host, reduce the concentration of heavy metals available to plants, contributing to the ecological restoration of polluted sites (Beneduzi et al.,2012). A group of PGPR also help the plants to survive In drought and saline conditions (Yang et al., 2009). These bacteria contain ACC-deaminase that facilitates longer root and shoot formation and are also more efficient in nodulating their legume hosts these include Genera: Rhizobium, Pseudomonas, Bacillus, Azospirillum, Achromobacter. A group of microorganisms degrade soil contaminants in the rhizosphere (rhizoremediation). During rhizoremediation, exudates derived from the plant can help to stimulate the survival and action of

Role of Microbes in Agriculture

bacteria, which subsequently results in a more efficient degradation of pollutants. These bacteria colonising roots that elicit shoot and root growth and alleviate stress from abiotic factors, for example, drought and salinity are recommended (marketed) for improving plant growth (Vessey, 2003) Antagonists to Pathogens Microorganisms found in the soil are all not so friendly to plants. These pathogens can cause disease or damage the plant. As scientists developed biological "tools," which use these disease-causing microbes to control weeds and pests naturally. Bacteria, fungi and actinobacteria can act as biocontrol agents against root diseases. Pseudomonads have been studied for their biocontrol potential against fungi and oomycete pathogens for more than two decades and a number of promising candidates have been identified. A group of rhizosphere colonizing bacteria are known to produce substances that protect them against diseases thereby promote the plant growth indirectly (Harish et al., 2009). These bacteria may protect plants against pathogens by direct antagonistic interactions with the pathogen, as well as through induction of host resistance (van Loon et al., 2011). Bacteria that reduce the incidence or severity of plant diseases are often referred to as biocontrol agents whereas those that exhibit antagonistic activity toward a pathogen are defined as antagonists (Beattie, 2006). The bacterial antagonistic activities can be:   

Synthesis of hydrolytic enzymes, such as chitinases, glucanases, proteases, and lipases Production of siderophores and antibiotics Regulation of plant ethylene levels through the ACC-deaminase enzyme

Enzyme Production The biocontrol depends on a wide variety of exoenzymes such as proteases, lipases, chitinases, and glucanases by the organisms (Singh et al., 2011). Chitinases induced by bacteria play an important role in bacteria-mediated insect management by hydrolyzing chitin as this constitutes a structural component of the gut linings of insects (Harish et al., 2009). Chitinases also degrade fungal cell walls and cause cell lysis (Radjacommare et al., 2004). Among the various biocontrol agents identified, Pseudomonas fluorescens is one of the most extensively studied rhizobacteria, because of its antagonistic actions against several plant pathogens. Pseudomonas fluorescens MSP-393 has been proved as biocontrol agent for many of the crops grown in saline agricultural soils (Paul and Nair, 2008). Banana bunchy top virus (BBTV) is one of the deadly viruses that severely affect the yield of banana (Musa spp.) crop in Western Ghats, Tamil Nadu, India (Kavino et al., 2010). Kavino et al. (2008) demonstrated that application of P. fluorescens strain CHA0+ chitin bioformulations, significantly reduced the BBTV incidence in hill banana variety under greenhouse and field conditions. Mathiyazhagan et al. (2004) reported that Bacillus subtilis (BSCBE4), Pseudomonas chlororaphis (PA23), endophytic P. fluorescens (ENPF1) inhibited the growth of stem blight pathogen Corynespora casiicola. According to them, the combined application of BSCBE4 and ENPF1 through seedling dip and foliar

Microbes: In Action

spray offered maximum control of stem blight both in vitro and in vivo. Similarly, seed treatment and soil application of P. fluorescens reduced root rot of black gram by Macrophomina phaseolina (Jayashree et al., 2000; Shanmugam et al., 2001) and panama wilt of banana (Raguchander et al., 1997). Seed and foliar application of P. fluorescens reduced sheath blight of rice (Nandakumar et al., 2001). Manjula and Podile (2001) demonstrated that the formulations of plant growth promoting B. subtilis AF 1 in peat supplemented with chitin or chitincontaining materials had better control of Aspergillus niger and Fusarium udum than AF 1 alone in groundnut and pigeon pea, respectively. Strains of Burkholderia cepacia have been shown to have biocontrol characteristics against Fusarium spp. (Bevivino et al., 1998). Siderophore Production Some rhizobacteria secrete some extracellular metabolites called siderophores. For the first time (Kloepper et al., 1980a) reported the significance of siderophores produced by certain bacterial genera in plant growth promotion. Siderophores are commonly referred to as microbial Fe-chelating low molecular weight compounds. The presence of siderophore-producing bacteria in rhizosphere increases the rate of Fe3+ supply to plants and therefore enhance the plant growth and productivity of crop (Singh, 2013). Siderophore production confers competitive advantages to plant growth promoting rhizobacteria (PGPR) that can colonize roots and exclude other microorganisms from this ecological niche (Haas and Défa*go, 2005). Under highly competitive conditions, the ability to acquire iron via siderophores may determine the outcome of competition for different carbon sources that are available as a result of root exudation or rhizodeposition (Crowley, 2006). Among most of the bacterial siderophores studied, those produced by pseudomonads are known for their high affinity to the ferric ion. The potent siderophore, pyoverdin, can inhibit the growth of bacteria and fungi that present less potent siderophores in irondepleted media in vitro (Kloepper et al., 1980a). A pseudobactin siderophore produced by P. putida B10 strain was also able to suppress Fusarium oxysporum in soil deficient in iron; this suppression was lost when the soil was replenished with iron, a condition that represses the production of iron chelators by microorganisms (Kloepper et al., 1980b). The suppression of soil-borne fungal pathogens through the release of iron chelating siderophores by fluorescent pseudomonads, rendering it unavailable to other organisms has also been reported by various researchers (Loper, 1988; Paulitz and Loper, 1991; Dwivedi and Johri, 2003). Antibiotics Production Antibiosis is the most commonly suggested trait responsible for their activity against plant pathogens. The production of one or more antibiotics is the mechanism most commonly associated with the ability of plant growthpromoting bacteria to act as antagonistic agents against phytopathogens (Glick et al., 2007) and a number of antimicrobial compounds have been identified, for example, 2,4-acetylphloroglucinol (2,4-DAPG), phenazines (PHZ), pyrrolnitrin (PRN), pyoluteorin (PLT), hydrogen cyanide (HCN) and

Role of Microbes in Agriculture

biosurfactant antibiotics. According to Haas and Défa*go (2005), six classes of antibiotic compounds are better related to the biocontrol of root diseases: phenazines, phloroglucinols, pyoluteorin, pyrrolnitrin, cyclic lipopeptides (all of which are diffusible) and hydrogen cyanide (HCN; which is volatile). Pyrrolnitrin, the antibiotic produced by the P. fluorescens BL915 strain, is able to prevent the damage of Rhizoctonia solani during damping-off of cotton plants (Hill et al., 1994). The 2,4diacetylphloroglucinol (DAPG) produced by pseudomonads, an effective and extensively studied antibiotic, causes membrane damage to Pythium spp. and is particularly inhibitory to zoospores of this oomycete (de Souza et al., 2003). Phenazine, also produced by pseudomonads, possesses redox activity and can suppress pathogens of plants such as F. oxysporum and Gaeumannomyces graminis (Ching et al., 2003). The P. chlororaphis PCL1391 strain, isolated from roots of tomato plants, synthesizes phenazine- 1-carboxamide, which is able to release soluble iron from insoluble ferric oxides at neutral pH, raising the possibility that phenazines might contribute to iron mobilization in soils (Hernandez et al., 2004; Haas and Défa*go, 2005). Antibiotics, such as polymyxin, circulin and colistin, produced by the majority of Bacillus ssp. are active against Grampositive and Gram-negative bacteria, as well as many pathogenic fungi (Maksimov et al., 2011). More recently, lipopeptide biosurfactants produced by Pseudomonas and Bacillus species have been implied in biocontrol due to their potential positive effect on competitive interactions with organisms including bacteria, fungi, oomycetes, protozoa, nematodes and plants (de Bruijn et al., 2007; Raaijmakers et al., 2010). ACC Deaminase Production Many plant growth promoting bacteria (PGPB) contain the enzyme 1Aminocyclopropane-1-carboxylic acid (ACC) deaminase that cleave the ethylene precursor ACC to _-ketobutyrate and ammonia and thereby lower the ethylene levels in developing or stressed plants (Saleem et al., 2007). Bacterial strains containing ACC deaminase can, in part, at least alleviate the stress induced ethylene mediated negative impact on plants. Such an aspect is extensively studied in numerous PGPBs like Agrobacterium genomovars, Azospirillum lipoferum, Alcaligenes, Bacillus, Burkholderia, Enterobacter, Methylobacterium fujisawaense, Pseudomonas Ralstonia solanacearum, Rhizobium, Rhodococcus, Sinorhizobium meliloti and Variovorax paradoxus (Singh et al., 2011). The ACC deaminase metabolizes the root's ACC into_-ketobutyrate and ammonia and checks the production of ethylene which otherwise inhibits plant growth through several mechanisms. The plants treated with bacteria containing ACC-deaminase may have relatively extensive root growth due to lowered ethylene levels thus leading to resistance aginst various stresses (Shaharoona et al., 2006). ACC deaminase containing PGPBs when bound to the seed coat or root of a developing seedlings, act as a sink for ACC, ensuring that plant ethylene levels do not get elevated to a point that impairs root growth. Bio-control Agents as Biofertilizers Microorganisms can also help in developing alternative controls to synthetic

Microbes: In Action

insecticides to fight against insect pests. Formulas for coatings on the seed (inoculants) which carry these beneficial organisms can be developed to protect the plant during the critical seedling stage. Bioinsecticides do not persist long in the environment and have shorter shelf lives; they are effective in small quantities, safer to humans and animals compared to synthetic insecticides; they are very specific, often affecting only a single species of insect and have a very specific mode of action; slow in action and the timing of their application is relatively critical (Mosttafiz, et al.,2012). Bacterial Insecticides Different bacterial species of genus Bacillus are pathogenic to insects. Most commonle employed Bacillus thuringenesis produces a crystalline protein called BT-toxin that is toxic to moth and butterfly larvae and certain strains of Bacillus thuringenesis produce additional proteins toxic to beetle and mosquitoes. These bacteria are mass multiplied and can be used as bioinsecticides as dsts, wettable powders or water dispersible emulsions. Fungal- Bioinsecticides Fungi cause diseases in some 200 different insects and this disease producing traits of fungi is being used as bioinsecticides. Fermentation technology is used to mass production of fungi. Spores are harvested and packaged so these are applied to insect-ridden fields. When the spores are applied, they use enzymes to break through the outer surface of the insects' bodies. Once inside, they begin to grow and eventually cause death. Fungal agents are recommended by some researchers as having the best potential for long-term insect control. This is because these bioinsecticides attack in a variety of ways at once, making it very difficult for insects to develop resistance. Certain fungal species may be used to eliminate or suppress the growth of harmful plant pathogens, such as insects, mites, weeds, nematodes, and other fungi that cause diseases of important crop plants. This has generated strong interest in practical applications that use these fungi in the biological control of these agricultural pests. Entomopathogenic fungi can be used as biopesticides, as they actively kill insects. Fungi that have been used as biological insecticides are Beauveria bassiana, Metarhizium spp, Hirsutella spp, Paecilomyces (Isaria) spp, and Lecanicillium lecanii Virus-based Bioinsecticides Baculoviruses affect insect pests like corn borers, potato beetles, flea beetles and aphids. One particular strain is being used as a control agent for bertha army worms, which attack canola, flax, and vegetable crops. Traditional insecticides do not affect the worm until after it has reached this stage and by then much of the damage has been done. Bio-Herbicides Weeds are the problem for farmers. They not only compete with crops for water, nutrients, sunlight, and space but also harbor insect and disease pests; clog irrigation and drainage systems; undermine crop quality; and deposit weed seeds into crop harvests. Bio-herbicides are another way of controlling weeds without

Role of Microbes in Agriculture

environmental hazards posed by synthetic herbicides. The microbes possess invasive genes that can attack the defence genes of the weeds, thereby killing it. The benefit of using bioherbicides is that it can survive in the environment long enough for the next growing season where there will be more weeds to infect. It is cheaper than synthetic pesticides thus could essentially reduce farming expenses if managed properly. Further, it is not harmful to the environment compared to conventional herbicides and will not affect non-target organisms. Limitations of Biocontrol Agents Challenges associated with the introduction of biocontrol organisms against soil-borne plant pathogens include their poor survival, variable root colonisation and lack of adaptability to the natural environment. The success of biocontrol inoculants depends upon the ability to: (1) maintain the adequate populations needed to provide effective biological control; (2) lengthen the period during which a threshold population density is sustained in the rhizosphere; and (3) increase the magnitude of disease control provided by introduced rhizobacteria. Actinobacterial endophytes can colonise plants without disrupting the "normal" endophytic populations, can produce antifungal antibiotics and plant growth hormones, and can also induce systemic disease resistance in plants. Biocontrol inoculants are generally tested for their antibiosis potential due to antagonism, hyper-parasitism, competition and predation by indigenous organisms; however, organisms that induce a systemic resistance to diseases and pests have the greatest potential to succeed under field conditions. Some soils can suppress the severity of disease even in the presence of a pathogen, host plant and favourable climatic conditions for the disease. There are a number of examples, worldwide, where agricultural soils have become suppressive to soil-borne pathogens. Culture-based and cultureindependent analyses have indicated the involvement of a diverse range of microorganisms involved in reducing pathogen inoculum and infection, plant growth promotion and induction systemic resistance). Due to the difficulties associated with introducing inoculants, in situ enhancement of beneficial microorganisms involved in natural disease suppression could be the more effective and reliable control measure. It can also provide environmental benefits by reducing agrochemical dependency for disease control. CONCLUSION Global agriculture has to double food production by 2050 in order to feed the world's growing population and at the same time reduce its reliance on inorganic fertilisers and pesticides. To achieve this goal, there is an urgent need to harness the multiple beneficial interactions that occur between plants and microorganisms. The beneficial influences of microorganisms on plant growth include nitrogen fixation, acquisition and uptake of major nutrients, promotion of shoot and root growth, disease control or suppression and improved soil structure. Microbes can playr an important part to ensuring the fertility of our soils for generations to come. Microbes benefit plant nutrition, control diseases and assist plants to cope with a variety of abiotic stresses to sustain and improve global food production in future climate scenarios while maintaining

Microbes: In Action

environmental health. A diverse range of beneficial microorganisms have been found but their reliable use in field environments is yet to be fully realised. New knowledge on soil microbial diversity can lead to the discovery of new generation inoculants as well as improve survival and performance of beneficial microbes in situ following their introduction into foreign environments. REFERENCES Alexander IJ and Lee SS (2005). Mycorrhizas and ecosystem processes in tropical rain forest: implications for diversity. In: Biotic Interactions in the Tropics: Their Role in the Maintenance of Species Diversity (Burslem DFRP, Pinard, MA and Hartley, SE eds). Cambridge University Press, Cambridge, pp. 165-203 Bapiri A, Asgharzadeh A, Mujallali H, Khavazi K and Pazira E (2012). Evaluation of Zinc solubilization potential by different strains of Fluorescent Pseudomonas. J. Appl. Sci. Environ. Manage. 16(3): 295-298 Bashan Y (1993). Potential use of Azospirillum as biofertilizer. Turrialba. 43(4): 286-291 Beattie GA (2006). Plant-associated bacteria: Survey, molecular phylogeny, genomics and recent advances. In: Plant-Associated Bacteria. (Gnanamanickam, SS ed.) Springer, Dordrecht, pp. 1-56 Beijerinck MW (1925). Parasitenkd. Infektionskr Hyg Abt. 2: 353-359 Beneduzi A, Ambrosini A and Passaglia LMP (2012). Plant growth-promoting rhizobacteria (PGPR): Their potential as antagonists and biocontrol agents. Genet Mole Biol. 35(4): 1044-1051 Bevivino A, Sarrocco S, Dalmastri C, Tabacchioni S, Cantale C and Chiarini L (1998). Characterization of a free-living maize-rhizosphere population of Burkholderia cepacia: effect of seed treatment on disease suppression and growth promotion of maize. FEMS Microbiol. Ecol. 27: 225-237 Bhattacharjee RB, Singh A and Mukhopadhyay SN (2008). Use of nitrogen-fixing bacteria as biofertiliser for non-legumes: prospects and challenges. Appl Microbiol Biotechnol. 80: 199209 Bond G (1983). Taxonomy and distribution of non-legume nitrogen-fixing systems. In: Biological Nitrogen Fixation in Forests: Foundations and Applications (Gordon, JC and Wheeler, CT eds.). Martinus Nijhoff/Dr W Junk Publ, The Hague, pp. 7-53 Bullen P and Kemila APF (1997). Influence of pH on the toxic effect of zinc, cadmium and pentachlorophenol on pure cultures of soil microorganisms. Entl Toxi Chemi. 16: 146-153 Burleigh SH, Cavagnaro T and Jakobsen I (2002). Functional diversity of arbuscular mycorrhizas extends to the expression of plant genes involved in P nutrition. J. Exp. Bot. 53: 1593-1601 Chalot M, Javelle A, Blaudez D, Lambilliote R, Cooke R, Sentenac H, Wipf D and Botton B (2002). An update on nutrient transport processes in ectomycorrhizas. Plant Soil. 244: 165-175 Chapin FS (1980). The mineral nutrition of wild plants. Annu Rev Ecol Syst 11: 233-260 Chin A, Woeng TF, Bloemberg GV and Lugtenberg BJ (2003). Phenazines and their role in biocontrol by Pseudomonas bacteria. New Phytol. 157: 503-523 Clarke ND and Berg JM (1998). Zinc fingers in Caenorhabditis elegans: finding families and probing pathways. Science. 282: 2018-2022 Crowley DE (2006). Microbial siderophores in the plant rhizospheric. In: Iron Nutrition in Plants and Rhizospheric Microorganisms (Barton LL and Abadia J eds). Springer, Dordrecht, pp. 169-198 Curtis TP, Sloan WT and Scannell JW (2002). Estimating prokaryotic diversity and its limits. Proc. Natl Acad. Sci. USA. 99:10494-10499 de Bruijn I, de Kock MJD, Yang M, de Waard P, van Beek TA and Raaijmakers JM (2007). Genome-based discovery, structure prediction and functional analysis of cyclic lipopeptide antibiotics in Pseudomonas species. Mol Microbiol. 63: 417- 428

Role of Microbes in Agriculture

de Souza JT, Arnould C, Deulvot C, Lemanceau P, Gianinazzi- Pearson V and Raaijmakers JM (2003). Effect of 2,4-diacetylphloroglucinol on Pythium: Cellular responses and variation in sensitivity among propagules and species. Phytopathol. 93: 966-975 Dwivedi D and Johri BN (2003). Antifungals from fluorescent pseudomonads: Biosynthesis and regulation. Current Science 12:1693-1703 Franche C, Lindstrom K and Elmerich C (2009). Nitrogen-fixing bacteria associated with leguminous and non-leguminous plants. Plant and Soil. 321: 35-59 Gaur AC (1990). Potassium solubilising microorganisms as biofertilizers. Omega Scientific Publishers, New Delhi pp. 176 Glick BR, Todorovic B, Czarny J, Cheng Z, Duan J and McConkey B (2007). Promotion of plant growth by bacterial ACC deaminase. Crit Rev Plant Sci. 26: 227-242 Grant C, Bittman S, Montrea M, Plenchette C and Morel C (2005). Soil and fertilizer phosphorus: Effects on plant P supply and mycorrhizal development. Can J Plant Sci. 85: 3-14 Grime JP, Mackey JML, Hillier SH and Read DJ (1987). Floristic diversity in a model system using experimental microcosms. Nature. 328: 420-422 Gupta Vadakattu VSR (2012). Beneficial microorganisms for sustainable Agriculture. Microbiology Australia. 9: 113-115 Haas D and Defa*go G (2005). Biological control of soil-borne pathogens by fluorescent pseudomonads. Nat Rev Microbiol. 3: 307-319 Harish S, Kavino M, Kumar N, Balasubramanian P and Samiyappan R (2009). Induction of defense-related proteins by mixtures of plant growth promoting endophytic bacteria against Banana bunchy top virus. Biol. Control. 51: 16-25 Hernandez ME, Kappler A and Newman DK (2004). Phenazines and other redox-active antibiotics promote microbial mineral reduction. Appl Environ Microbiol. 70:921-928 Higa T (1991). Effective microorganisms: A biotechnology for mankind. In: Proceedings of the First International Conference on Kyusei Nature Farming. US Department of Agriculture, Washington, DC, USA. (Parr JF, Hornick SB and Whitman CE. ed.) pp.8-14 Hill DS, Stein JI, Torkewitz NR, Morse AM, Howell CR, Pachlatko JP, Becker JO and Ligon JM (1994). Cloning of genes involved in the synthesis of pyrrolnitrin from Pseudomnas fluorescens and role of pyrrolnitrin synthesis in biological control of plant disease. Appl Environ Microbiol. 60: 78-85 Hinsinger P (2001). Bioavailability of soil inorganic P in the rhizosphere as affected by root induced chemical changes: a review. Plant Soil. 237: 173-195 Hobbie JE and Hobbie EA (2006). N-15 in symbiotic fungi and plants estimates nitrogen and carbon flux rates in Arctic tundra. Ecology. 87: 816-822 Hodge A, Campbell CD and Fitter AH (2001). An arbuscular mycorrhizal fungus accelerates decomposition and acquires nitrogen directly from organic material. Nature. 413: 297299 Horner-Devine MC, Leibold MA, Smith VH and Bohannan BJM (2003). Bacterial diversity patterns along a gradient of primary productivity. Ecol. Lett. 6: 613-622 Hughes MN and Poole RK (1989). Metals and microorganisms. Chapman and Hall, London, pp. 412 Jakobsen I, Abbott LK and Robson AD (1992). External hyphae of vesicular-arbuscular mycorrhizal fungi associated with Trifolium subterraneum L. I: Spread of hyphae and phosphorus inflow into roots. New Phytol. 120: 371-380 Jayashree K, Shanmugam V, Raguchander T, Ramanathan A and Samiyappan R (2000). Evaluation of Pseudomonas fluorescens (Pf1) against blackgram and sesame root rot diseases. J. Biol. Contr. 14: 55-61 Katyal JC and Rattan RK (1993). Distribution of zinc in Indian soils. Fertilizer News. 38(6): 1526 Kavino M, Harish S, Kumar N, Saravanakumar D and Samiyappan R (2010). Effect of chitinolytic PGPR on growth, yield and physiological attributes of banana (Musa spp.) under field conditions. Appl. Soil Ecol. 45: 71-77

Microbes: In Action

Kavino M, Harish S, Kumar N, Saravanakumar D and Samiyappan R (2008). Induction of systemic resistance in banana (Musa spp.) against banana bunchy top virus (BBTV) by combining chitin with root-colonizing Pseudomonas fluorescens strain CHA0. Eur. J. Plant Pathol. 120: 353-362 Kloepper JW, Leong J, Teintze M and Schroth MN (1980a) Enhancing plant growth by siderophores produced by plant growth-promoting rhizobacteria. Nature. 286:885-886 Kloepper JW, Leong J, Teintze M and Schroth MN (1980b) Pseudomonas siderophores: A mechanism explaining diseasesuppressive soils. Curr Microbiol. 4:317-320 Kowalchuk GA and Stephen JR (2001). Ammonia-oxidizing bacteria: a model for molecular microbial ecology. Ann. Rev. Microbiol. 55:485-529 Leake JR and Read DJ (1997). Mycorrhizal fungi in terrestrial habitats. In: The Mycota IV. Environmental and Microbial Relationships (Wicklow DT and Söderström B. eds). Springer-Verlag, Heidelberg, pp. 281 Leake JR, Johnson D, Donnelly DP, Muckle GE, Boddy L and Read DJ (2004). Networks of power and influence: the role of mycorrhizal mycelium in controlling plant communities and agroecosystem functioning. Can J Bot. 82: 1016-1045 Loper JE (1988). Role of fluorescent siderophore production in biological control of Pythium ultimum by a Pseudomonas fluorescens strain. Phytopathol. 78:166-172 Mahdi SS, Hassan GI, Samoon SI, Rather HA, Dar SA and Zehra B (2010). Biofertilizers in organic agriculture. J Phytology. 2(10): 42-54 Maksimov IV, Abizgildina RR and Pusenkova LI (2011). Plant growth promoting rhizobacteria as alternative to chemical crop protectors from pathogens. Appl Biochem Microbiol. 47: 333-345 Manjula M and Podile AR (2001). Chitin-supplemented formulations improve biocontrol and plant growth promoting efficiency of Bacillus subtilis AF 1. Can J Microbiol. 47: 618-625 Marcel GA, Van Der Heijden, Richard DB and Nico M Van Straale (2008). The unseen majority: soil microbes as drivers of plant diversity and productivity in terrestrial ecosystems. Ecology Letters. 11(3):296-310 Mathiyazhagan S, Kavitha K, Nakkeeran S, Chandrasekar G, Manian KK, Renukadevi P, Krishnamoorthy AS and Fernando WGD (2004). PGPR mediated management of stem blight of Phyllanthus amarus (schum and thonn) caused by Corynespora cassiicola (berk and curt) Wei. Arch. Phytopathol. Plant Prot. 37:183-199 Mirza MS, Rasul G, Mehnaz S, Ladha JK, So RB, Ali S and Malik KA (2000). Beneficial effects of inoculated nitrogen-fixing bacteria on rice. In: The quest for nitrogen fixation in rice. International Rice Research Institute, Los Banos, (Ladha JK, and Reddy PM eds) pp. 191204 Mosse B, Stribley DP and Le Tacon F (1981). Ecology of mycorrhizae and mycorrhizal fungi. Adv. Microbial Ecol. 5:137-210 Mosttafiz S, Rahman M and Rahman M (2012). Biotechnology: Role of Microbes In Sustainable Agriculture And Environmental Health. Internet J Microbiol. 10(1). Muraleedharan H, Seeshadri S and Perumal K (2010). Biofertilizers (Phosphobacteria) Shri AMM Murugappa Chetiar Research centre, Chennai, India. Nandakumar R, Babu S, Viswanathan R, Raguchander T and Samiyappan R (2001). Induction of systemic resistance in rice against sheath blight disease by plant growth promoting rhizobacteria. Soil Biol. Biochem. 33: 603-612 Noble AD and Ruaysoongnern S (2010) The nature of sustainable agriculture. In: Soil Microbiology and Sustainable Crop Production, (Dixon R and Tilston E eds.) Berlin, Heidelberg, Germany: Springer Science and Business Media BV pp. 1-25 Parker DR, Aguilera JJ and Thomason DN (1992). Zinc-phosphorus interactions in two cultivars of tomato (Lycopersicon esculentum L.) grown in chelator-buffered nutrient solutions. Plant Soil. 143: 163-177 Parr JF, Papendick RI, Hornick SB and Meyer RE (1992). Soil quality: Attributes and relationship to alternative and sustainable agriculture. Amer J Alternative Agric. 7: 5-11

Role of Microbes in Agriculture

Paul D and Nair S (2008). Stress adaptations in a Plant Growth Promoting Rhizobacterium (PGPR) with increasing salinity in the coastal agricultural soils. J Basic Microbiol. 48: 378384 Paulitz TC and Loper JE (1991). Lack of a role for fluorescent siderophore production in the biological control of Pythium damping-off of cucumber by a strain of Pseudomonas putida. Phytopathology. 81: 930-935 Plassard C and Fransson P (2009). Regulation of low molecular weight organic acid production in fungi. Fungal Biol Rev. 23: 30-39 Raaijmakers JM, de Bruijn I, Nybroe O and Ongena M (2010). Natural functions of lipopeptides from Bacillus and Pseudomonas: More than surfactants and antibiotics. FEMS Microbiol Rev. 34: 1037-1062 Raaijmakers JM, Vlami M and de Souza JT (2002). Antibiotic production by bacterial biocontrol agents. Antonie Van Leeuwenhoek. 81: 537-547 Radjacommare R, Ramanathan A, Kandan A, Harish S, Thambidurai G, Sible GV, Ragupathi T and Samiyappan R (2004). PGPR mediates induction of pathogenesis-related (PR) proteins against the infection of blast pathogen in resistant and susceptible ragi [Eleusine coracana (L.) Gaertner] cultivars. Plant Soil. 266: 165-176 Raghu K and Macrae IC (2000). Occurrence of phosphate-dissolving microorganisms in the rhizosphere of rice Plants and in submerged soils. J Appl Bacteriol. 29: 582-586 Raguchander T, Jeyashree K and Samiyappan R (1997). Management of Fusarium wilt of banana using antagonistic microorganisms. J Biol Contr. 11: 101-105 Rai A, Rai S and Raksh*t A (2013). Mycorrhiza-mediated phosphorus use efficiency in plants. Environ Experimental Biol. 11: 107-117 Rai AN, Soderback E and Bergman B (2000). Cyanobacterium-plant symbioses. New Phytol. 147: 449-481 Rangaswami G (2004). Agricultural Microbiology. Prentice-Hall of India Pvt. Ltd. Read DJ and Perez-Moreno J (2003). Mycorrhizas and nutrient cycling in ecosystems- a journey towards relevance? New Phytol. 157: 475-492 Reganold JP, Papendick RI and Parr JF (1990). Sustainable Agriculture. Scientific American. 262(6): 112-120 Rillig MC and Mummey DL (2006). Mycorrhizas and soil structure. New Phytol. 171: 41-53 Saleem M, Arshad M, Hussain S and Bhatti AS (2007). Perspective of plant growth promoting rhizobacteria (PGPR) containing ACC deaminase in stress agriculture. J Ind Microbiol Biotechnol. 34: 635-648 Saravanan VS, Subramoniam SR and Raj SA (2003). Assessing in vitro solubilization of different zinc solubilizing bacterial (ZBS) isolates. Brazil J Microbiol. 34: 121-125 Sawers JH, Caroline G and Paszkowski U (2007). A study about cereal mycorrhiza, an ancient symbiosis in modern Agricuture. Department of Plant Molecular Biology, University of Lausanne, Biophore Building, Lausanne, Switzerland. Schroeder M (1932). Dis Assimilation des Luffstickstoffs durcheininge Bakterien Zentrab Bakteriol. Prasaitenkd, Infesktoinskr Hyg Abt. 2: 178-212 Shaharoona B, Arshad M and Zahir ZA (2006). Performance of Pseudomonas spp. Containing ACC-deaminase for improving growth and yield of maize (Zea mays L.) in the presence of nitrogenous fertilizer. Soil Biol Biochem. 38: 2971-2975 Shanmugam V, Sriram S, Babu S, Nandakumar R, Raguchander T, Balasubramanian P and Samiyappan R (2001). Purification and characterization of an extracellular a-glucosidase protein from Trichoderma viride which degrades a phytotoxin associated with sheath blight disease in rice. J Appl Microbiol. 90: 320-329 Simard SW, Jones MD and Durall DM (2002). Carbon and nutrient fluxes within and between mycorrhizal plants. In: Mycorrhizal Ecology. Ecological Studies 157 (Van der Heijden, MGA and Sanders, IR eds.) Springer Verlag, Heidelberg, Germany, pp. 33-74 Singh JS, Pandey VC and Singh DP (2011). Efficient soil microorganisms: A new dimension for sustainable agriculture and environmental development. Agriculture, Ecosystems and Environment. 140: 339-353

Microbes: In Action

Smith FW, Rae AL and Hawkesford MJ (2000). Molecular mechanisms of phosphate and sulphate transport in plants. Biochem. Biophys Acta. 1465: 236-245 Smith SE and Read DJ (1997). Mycorrhizal symbiosis. 2nd edn. Academic Press, San Diego. Smith SE and Read DJ (2008). Mycorrhizal symbiosis. 3rd edn. Academic Press, London. Sprent JI and Parsons R (2000). Nitrogen fixation in legume and non-legume trees. Field Crops Res. 65: 183-196 Steinberg PD and Rillig MC (2002). Glomalin production by an arbuscular mycorrhizal fungus: a mechanism of habitat modification. Soil Biol Biochem. 34: 1371-1374 Sugumaran P and Janarthanam B (2007). Solubilization of potassium containing minerals by bacteria and their effect on plant growth. World J Agric Sci. 3(3): 350-355 Tibbett M and Sander FE (2002). Ectomycorrhizal symbiosis can enhance plant nutrition through improved access to discrete organic nutrient patches of high resource quality. Ann Bot. 89: 783-789 Tiedje JM (1988). Ecology of denitrification and dissimilatory nitrate reduction to ammonium. In: Biology of Anaerobic Microorganisms (Sehnder, AJB ed.). Wiley, New York, pp. 179-244 Tisdale SL, Nelson WL and Beaton JD (1985). Soil Fertility and Fertilizers. 4th Ed. Macmillan, New York. van Loon LC, Bakker PA and Pieterse CM (1998) Systemic resistance induced by rhizosphere bacteria. Annu Rev Phytopathol. 36: 453-483 Vessey JK (2003). Plant growth promoting rhizobacteria as bio-fertilizers. Plant and Soil. 255: 571-580 Vitousek PM and Walker LR (1989). Biological Invasion by Myrica-faya in Hawaii–plant demography, nitrogen-fixation, ecostystem effects. Ecol. Monogr. 59: 247-265 Vogelsang KM, Reynolds H and Land Bever JD (2006). Mycorrhizal fungal identity and richness determine the diversity and productivity of a tallgrass prairie system. New Phytol. 172: 554-562 Whitman WB, Coleman DC and Wiebe WJ (1998). Prokaryotes: the unseen majority. Proc Natl Acad Sci. 95: 6578-6583 Yang J, Kloepper JW and Ryu CM (2009). Rhizosphere bacteria help plants tolerate abiotic stress. Trends in Plant Science. 14: 1-4

CHAPTER 3 Plant Growth Promotion by Soil Microorganisms through Root Interaction Sanjeev Singh and Joginder Singh Department of Biotechnology, School of Biotechnology and Bioscience, Lovely Professional University, Phagwara, Punjab – 144411 India Corresponding author: [emailprotected]

INTRODUCTION All living organism interact with the same or other living organism and their surroundings, abiotic, during their whole life time duration, e.g. Vine plants (biotic) interact with the wall (abiotic) to get support for their growth and plant require sun light for photosynthesis. Symbiosis is general term which is used to define close interaction between biological species like microbe-microbe interaction, plant-animal interaction, animal-microbe interaction, plant-microbe interaction, plant-plant interaction and animal- animal interaction. Symbiosis interaction might be categorized in three broad categories: 1. Positive interaction or Mutualism: both interacting species benefited e.g. mycorrhizae, the association between fungi and the roots of most kinds of plants. The fungi expedite the plant's absorption of certain nutrients, and the plants in turn provide the fungi with carbohydrates. 2. Negative interaction or Parasitism: in this one species is benefits but other is harmed e.g. Lice, which live on the bodies of vertebrates—mainly birds and mammals 3. Neutral interaction or Commensalism: in which one species benefits while other neither benefits nor harmed. eg epiphytes are plants that grow on the branches of other plants. In general, the host plant is unharmed, while the epiphyte that grows on it benefits. Microbes show all three types of symbiosis with plants and interact with all parts of plant like root, stem and leaves etc. but root is major part of interaction which show different positive effect on the plant growth. In this chapter, microorganism, bacteria, interaction in positive manner with plant is discussed. In the site of soil, there are numerous microorganism such as algae, bacteria, protozoa and fungi different types of interaction occur with plant root and microorganism. These microorganism are algae, fungi, protozoa and bacteria coexist in the soil, but bacteria are most abundant microorganism among them. (Das et al., 2013) These bacteria are abundant in the portion of soil which attached to the root system of plant. The narrow zone of soil directly

Microbes: In Action

surrounding the root system is referred to as Rhizosphere while the bacteria which are colonizing around the root is termed as Rhizobacteria (Nandal and Hood, 2013). Rhizopshere bacteria, which play important role in plant growth promotion and it also show impact in sustainable agriculture development and protecting the environment are termed as PGPR (Plant Growth Promoting Rhizobacteria). Concept of rhizosphere was first given by Hiltner (1904) to depict the zone of soil surrounding the roots where microbial populations are accelerated by root activities and PGPR term was coined for the first time by Kloepper et al., 1980. Plant roots also synthesize, accumulate, and secrete a diverse array of compounds secreted by plant roots act as chemical attractants for a vast number of heterogeneous, diverse and actively metabolizing soil microbial communities. The composition of these exudates is dependent upon the physiology species of plants and microorganisms (Nandal and Hood, 2013) These exudates also promote the plant-beneficial symbiotic interactions and inhibit the growth of the competing plant species (Nardi et al., 2000). Largely, three separate but interacting components are recognized in the rhizosphere: the rhizosphere (soil), the rhizoplane, and the root itself, of these, the rhizosphere is the zone of soil influenced by roots through the release of substrates that affect microbial activity. The rhizoplane, on the other hand, is the root surface including the strongly adhering soil particles while the root itself is a component of the system, because many microorganism also colonize the tissue (Nandal and Hood, 2013). There are two broad categories, direct and indirect methods, used by PGPRs to promote the growth of plant (Fig. 1).

FIG. 1: Overview of direct and indirect methods of PGPRs interaction with plant root

Plant Growth Promotion by Soil Microorganisms

DIRECT METHODS Phosphate Solublization Phosphate is categorized in macronutrient element category for plant growth because it makes up about 0.2% of plant's dry weight. After Nitrogen, phosphate is the second most frequently limiting macronutrient for plant growth. Phosphate is important part of nucleic acids, phospholipid and ATP (P element). Despite the fact that the amount of phosphorus in the soil is generally quite high (Often between 400 and 1,200 mg kg−1 of soil) most of this phosphorus is insoluble and therefore not available to support plant growth. The insoluble phosphorus is present as either an inorganic mineral such as apatite hydroxyapatite, and oxyapatite or as one of several organic forms including inositol phosphate (soil phytate), phosphom*onesters and phosphotriesters. While Phosphorus is taken by the plants from soil as phosphate anions. Even so, phosphate anions are highly reactive and may be trapped via precipitation with cations such as Mg+2, Ca+2, Al+3 and Fe+3 depending on the quality of the soil. Due to this limitation, phosphorus is essential element for the plant growth. Thus, solubilization and mineralization of phosphorus by phosphatesolubilizing bacteria is an important trait in PGPB as well as in plant growthpromoting fungi such as mychorrizae.

FIG. 2: Overview; Role of phosphate in plant and insoluble phosphate form, organic and inorganic, conversion into soluble form in soil by PGPRs.

Microbes: In Action

Different bacterial species solubilize insoluble inorganic phosphate compounds such as dicalcium phosphate, tricalcium phosphate, rock phosphate and hydroxyapatite (Fig. 2). These bacteria solubilize phosphate through the production of acids, and by some other mechanism and are termed as phosphate solubilizing bacteria (Das et al., 2013). Typically, the solubilization of inorganic phosphorus occurs as a consequence of the action of low molecular weight organic acids which are synthesized by various soil bacteria. Conversely, the mineralization of organic phosphorus occurs through the synthesis of a variety of different phosphatases, catalyzing the hydrolysis of phosphoricesters. Importantly, phosphate solubilization and mineralization can coexist in the same bacterial strain. To make this form of P available for plant nutrition, it must be hydrolyzed to inorganic P by means of acid and alkaline phosphatase enzymes. Because the pH of most soils ranges from acidic to neutral values acid phosphatases should play the major role in this process (Nandal and Hood, 2013). Different PSB have been isolated by several researchers from various soils and prove that inoculations of these bacteria increase the plant growth and yield. The bacterial genera with phosphate solubilising capacity are Azotobacter, Alcaligenes, Acinetobacter, Arthrobacter, Azospirillum, Beijerinckia, Burkholderia, Bacillus, Enterobacter, Erwinia, Flavobacterium, Microbacterium, Pseudomonas, Rhizobium and Serratia. Nitrogen Fixation Nitrogen is an essential elements for all forms of life; a basic requisite for synthesizing nucleic acids, proteins and other organic nitrogenous compounds. Although, there is about 78% nitrogen present in atmosphere, but it is not available for the plant. Unfortunately, No plant species is developed the mechanism for fixing atmospheric dinitrogen into ammonia and expend it directly for its growth but there are some bacterial species, nitrogen fixing microorganism, have been developed to convert this atmospheric nitrogen into plant utilizable form, ammonia (Fig. 3). This process, biological nitrogen fixation (BNF) is a complex process using enzyme system known as Nitrogenase. BNF imparts 180 X106 metric tons per year globally, out of which symbiotic Nitrogen fixation contributes 80% and the remaining comes from free living Nitrogen fixation. On the basis of plant-microbe interaction, these microorganism are divided into two broad categories. Symbiotic nitrogen fixation: This is a mutualistic relationship which shows interaction between a microbe and the plant. The microbes first infect and enter the root of leguminous plants. These bacteria colonize in the root and form nodules in which N2 fixation occurs. Rhizobia have the ability to lay symbiotic interactions by the colonization and formation of root nodules with leguminous plants, where nitrogen is fixed to ammonia and make it available for the plant. So the amount of nitrogen fixed is high. Free-living nitrogen fixing: Numerous nitrogen fixing microbes does not exhibit symbiotic interaction. These microbes are free living and survive on either plant residues or photosynthesis themselves. So, the amount of nitrogen fixed is comparatively small.

Plant Growth Promotion by Soil Microorganisms

FIG. 3: Overview of Nitrogen cycle and role of microorganism

Sequestration of Iron by Siderophores Siderophores (from the Greek: "iron carriers") are defined as relatively low molecular weight, ferric ion specific chelating agents elaborated by bacteria and fungi growing under low iron stress. (siderophore). Siderophore producing microorganisms provide benefit to plant by direct as well as indirect manner. Despite the fact that iron is the fourth most abundant element on earth, in aerobic soils, iron is not readily assimilated by either bacteria or plants because ferric ion or Fe+3, which is the predominant form in nature, is only sparingly soluble so that the amount of iron available for assimilation by living organisms is extremely low. Iron is an essential micronutrient for plants as it serves as a cofactor of many enzymes with redox activity and it is required in a number of major physiological processes like N2 fixation, photosynthesis, respiration, etc. in direct methods, to meet their iron requirement, microorganisms and plants have evolved specific mechanisms to chelate insoluble iron through the release of siderophores and uptake of iron-siderophore complexes through specific outer membrane receptor proteins (Nandal and Hood, 2013). Siderophores are iron binding protein of low molecular mass (`400-1500 dalton) and have an exceptionally high binding affinity (Ka ranging from 1023 to 1052) with ferric ion. These siderophores can be of different types: hydroxamates, phenol-atecholates, and carboxylates. Plants such as Oats, Sorghum, Cotton, Peanut, Sunflower and Cucumber demonstrate the ability to use microbial siderophores as sole source of iron than their own siderophores (phytosiderophores). Microbial siderophores are also reported to increase the chlorophyll content and plant

Microbes: In Action

biomass in plants of Cucumber. (Das et al., 2013) In indirect method, Biocontrol PGPRs also exert their antagonistic activity against plant pathogens by means of secretion of siderophores. These low molecular weight compounds (400–1, 500 Da) preferentially chelate iron (Fe+3) and transport it into the cell across the cell membrane (Neilands 1995; Wandersman and Delepelaire 2004). The siderophores bind most of the Fe+3 in the rhizosphere and effectively prevent the proliferation of fungal pathogens by depriving them of available iron (Kloepper et al., 1980; O' Sulivan and O' Gara 1992). Suppression of the pathogens arises because iron deficiency causes growth inhibition, decrease in nucleic acid synthesis, inhibition of sporulation, and causes changes in cell morphology (Mathiyazhagan et al., 2004). Among the biocontrol rhizobacteria, the fluorescent Pseudomonas spp. are efficient competitors for iron (Fe+3) in the rhizosphere of various crops producing two major types of siderophores: the fluorescent pigmented pyoverdins (pseudobactins) (Lemanceau et al., 1993) and the non-fluorescent siderophore called pyochelins (Leeman et al., 1996). Siderophores produced by certain strains of the P. fluorescens-putida group are responsible for enhanced plant growth and biocontrol and are most often associated with fungal suppression in the rhizosphere of several crops (Battu and Reddy, 2009). It is thus believed that siderophore production is another important mechanism by which some strains of bacteria protect plants against root pathogens. Production of Phytohormones Plant hormones are biochemical molecules synthesized by plant which work as signaling molecules and regulate the different signaling pathway which are linked with morphologically, biochemically and physiologically process in plant. Directly, phytohormones do regulate the plant growth and development. When the environmental conditions were not favourable for plant growth then plant regulate its metabolism and adjust the level of their endogenous phytohormone to overcome the effects of the environmental stress but due to this condition, plant growth becomes suppressed. If exogenous phytohormones are provided to maintain the level of plant hormone during the stress condition of plant, then plant negative response of growth and development could be altered. Some rhizosphere microorganism have been discovered which are capable to produce plant hormone. a) Auxin The existence of auxin as a mobile growth regulator was famously inferred by Charles and Frances Darwin, as described in their 1880 book, The Power of Movement in Plants. They were the first of the major plant hormones to be discovered. The name "Auxin" is derived from the Greek word "auxano" which mean "I grow" because according to Cholodny-Went hypothesis, auxin asymmetrical distribution in plant's body directs tropic growth of plant's root and stem. After the discovery of tropical growth, there are other functions of auxin have been discovered which regulate diverse cellular and developmental responses in plants, including cell division, expansion and differentiation, patterning of embryos, vasculature and other tissues, and distribution of growth

Plant Growth Promotion by Soil Microorganisms

between primary and lateral root and shoot meristems. This multiplicity of regulatory activities has spurred considerable interest in mechanisms of auxin signaling and response. Auxin might regulate some cellular responses (such as expansion or polarization) through direct effects on membrane or cytoskeletal functions, but it also regulates the expression of many genes whose products probably carry out most developmental responses. It has been estimated that up to 80% of the rhizosphere bacteria can synthesize IAA (Khalid et al., 2004; Patten and Glick, 1996). Bacteria which produce IAA can add to, or influence, the levels of endogenous plant auxin (Patten and Glick, 1996). Auxin produced by soil bacteria play significant role in plant developmental processes by adding or influencing the level of endogenous plant toxin. Evidently, IAA also acts as a reciprocal signaling molecule affecting gene expression in several microorganisms. Consequently, IAA plays a very important role in rhizobacteria-plant interactions (Spaepen and Vanderleyden, 2011). Moreover, down-regulation of IAA as signaling is associated with the plant defense mechanisms against a number of phyto-pathogenic bacteria as evidenced in enhanced susceptibility of plants to the bacterial pathogen by exogenous application of IAA or IAA produced by the pathogen (Spaepen and Vanderleyden, 2011). IAA has been implicated in virtually every aspect of plant growth and development, as well as defense responses. This diversity of function is reflected by the extraordinary complexity of IAA biosynthetic, transport and signaling pathways (Santner et al., 2009). Generally, IAA affects plant cell division, extension, and differentiation; stimulates seed and tuber germination; increases the rate of xylem and root development; controls processes of vegetative growth; initiates lateral and adventitious root formation; mediates responses to light, gravity and florescence; affects photosynthesis, pigment formation, biosynthesis of various metabolites, and resistance to stressful conditions. IAA produced by rhizobacteria likely, interfere the above physiological processes of plants by changing the plant auxin pool. Moreover, bacterial IAA increases root surface area and length, and thereby provides the plant greater access to soil nutrients. Also, rhizobacterial IAA loosens plant cell walls and as a result facilitates an increasing amount of root exudation that provides additional nutrients to support the growth of rhizosphere bacteria (Glick, 2012). IAA is involved in multiple processes including cell division, differentiation and vascular bundle formation, these three processes are also essential for nodule formation. Hence, it seems likely that auxin levels in the host legume plants are necessary for nodule formation (Glick, 2012; Spaepen et al., 2007). It is also reported that the inoculation with Rhizobium leguminosarum bv. viciae wherein the IAA biosynthetic pathway had been introduced, produced potential nitrogen fixing root nodules containing up to 60-fold more IAA than nodules formed by the wild-type counterpart in Vicia hirsute (Camerini et al., 2008). Thus, rhizobacterial IAA is identified as an effector molecule in plant– microbe interactions, both in pathogenesis and phytostimulation (Spaepen and Vanderleyden, 2011).

Microbes: In Action

b) Ethylene The plant hormone ethylene, gaseous hormone, is one of the simplest molecules with biological activity. According to the Hebrew Bible, the prophet Amos was a "herdsman and a nipper of figs." this statement is interpreted as indicating that as early as the ninth century B C E, an awareness existed that nipping or piercing figs produced ethylene gas thereby hastening the ripening process and making the figs sweeter (Bernard, 2012).

FIG. 4: Suppression of ethylene production in plant by using ethylene precursor (ACC) and convert into ammonia and alpha ketobutyrate by ACC deaminase.

ET affects numerous plant developmental processes including root growth, root hair formation, flowering, fruit ripening and abscission, and leaf and petal senescence and abscission (Dugardeyn et al., 2008). ET usually inhibits both primary root elongation and lateral root formation but it can promote root hair formation (Dodd et al., 2010). It generally inhibits stem elongation in most dicots favouring lateral cell expansion and leading to swelling of hypocotyls. ET also breaks seed and bud dormancy. It activates the synthesis of other plant hormones, inhibiting Rhizobia spp. nodule formation, inhibiting mycorrhizaeplant interaction. ET is synthesized under biotic stress conditions following infection by pathogens, as well as by abiotic stress conditions such as drought. It is therefore also known as the stress hormone. ET production is typically up-regulated in plants in response to pathogen attack, heat and cold stress, water logging, drought, excess heavy metals, high soil salinity, soil compaction and organic pollutants; radiation; wounding; insect predation; high salt; various pathogens including viruses, bacteria, and fungi. (Dodd et al., 2010; Glick, 2005). The endogenous level of ethylene is significantly increased which negatively affects the overall plant growth. For instance, the high concentration of ethylene

Plant Growth Promotion by Soil Microorganisms

induces defoliation and other cellular processes that may lead to reduced crop performance (Saleem et al., 2007; Bhattacharyya and Jha, 2012). Plant growth promoting rhizobacteria which possess the enzyme, 1-aminocyclopropane-1carboxylate (ACC) deaminase, facilitate plant growth and development by decreasing ethylene levels. The enzyme ACC deaminase is present in many rhizosphere bacteria, such as Achromobacter, Pseudomonas, and Variovorax and in the fungus Trichoderma (Fig 4). Such microbes can take up ACC secreted by the plant root and convert it into α-ketobutyrate and ammonia (Glick et al., 2007a). This results in the decrease of ACC levels, and therefore also of ethylene levels, in the plant and in decreased plant stress. ACC deaminase activity has been found in fungi such as Trichoderma (Viterbo et al., 2010) and in free-living soil bacteria, endophytes, and rhizobia from a wide range of genera, and there have been many correlations between ACC deaminase activity in a range of bacteria and their ability to promote plant growth under various conditions, for example in wheat (Zahir et al., 2009), maize (Shaharoona et al., 2006), and tomato (Grichko and Glick, 2001; Mayak et al., 2004a; Mayak et al., 2004b). c) Abcisic Acid (ABA) ABA is a 15-carbon compound which, like ethylene, is involved in plant responses to biotic and abiotic stresses. It inhibits seed germination and flowering. It is involved in protection against drought, salt stress and toxic metals. It also induces stomatal closure (Smyth, 2011). ABA can be produced in culture media by several bacteria such as Azospirillum brasilense (Cohen et al., 2008; Perrig et al., 2007) and Bradyrhizobium japonicum (Boiero et al., 2007). ABA levels in plant have been increased in Arabidopsis thaliana by Azospirillum brasilense Sp25 (Cohen et al., 2008). The effect of inoculation with ABA-producing bacteria on plant growth is experimentally poorly underpinned. Since ABA inhibits the synthesis of cytokinins (Miernyk, 1979) it was speculated that ABA increases plant growth by interfering with the cytokinin pool (Spaepen et al., 2009). It could also alleviate plant stress by increasing the root/shoot ratio (Boiero et al., 2007). 5. Volatiles Bacteria can produce a wide range of volatiles. While the biological function of most of these volatiles is not fully understood, it is assumed they are involved in a number of processes including cell-cell signaling, inter-species signaling, a possible carbon release valve and that these compounds can promote plant growth and act as microbial inhibiting agents (Wheatley, 2002; Vesperman et al., 2007; Kai et al., 2009). Bacterial volatiles produced by Bacillus spp. have been shown to promote plant growth in A. thaliana. Indirect Methods There are different methods and mechanisms which are utilized by microorganisms to interact with plant and helping in the development of plant. In this method, rhizobacteria don't interact directly with plant but by other activities which promote the plant development or affect the other

Microbes: In Action

microorganisms which are harmful or beneficial for the plant. The major indirect mechanism of plant growth promotion in rhizobacteria is through acting as biocontrol agents (Glick, 2012). PGPRs as Biocontrol Agent Biocontrol is general term which defines the control or suppression the growth of harmful or destructive organism by the use of other organism. These organisms which are used to control the population of the pathogen is called as biocontrol agents. They can suppress or reduce the population a broad spectrum bacteria, fungi and nematode which cause the harm to the plant. It has been observed that PGPR also provide the protection against the viral disease. PGPR may protect plants against pathogens by direct antagonistic interactions between the biocontrol agent and the pathogen, as well as by induction of host resistance. PGPR that indirectly enhance plant growth via suppression of phytopathogens do so by a variety of mechanisms. These include:   

The ability to produce siderophores (as discussed above) that chelate iron, making it unavailable to pathogens. The capacity to synthesize anti-fungal metabolites such as antibiotics, fungal cell wall-lysing enzymes, or hydrogen cyanide, which suppress the growth of fungal pathogens. The ability to successfully compete with pathogens for nutrients or specific niches on the root; and the ability to induce systemic resistance (Singh, 2013)

Antibiotic Production Antibiosis is an attractive and a highly effective mode of action of rhizobacteria in the suppression of soil borne infections in a number of crops (Handelsman and Stab, 1996). Antibiotics encompass a heterogeneous group of organic, lowmolecular-weight compounds that are deleterious to the growth or metabolic activities of other microorganisms. Some bacteria and fungi cause the diseases in plant and work as pathogen to suppress the growth of the plant. Antibiotics are produced by PGPR which block the division of pathogen or kill the pathogen so indirectly PGPRS are regulating the growth and development of plant. However, the first direct evidence for production of antibiotics by a fluorescent pseudomonad in the rhizosphere and its control of a plant root diseases. Antibiotics produced by these biocontrol PGPR reduce or suppress soil borne infections of cereal crops including wheat, rice, maize, chickpea, and barley (Raaijmakers et al., 2002). Some of these antibiotics cause membrane damage to pathogens such as Pythium spp. and inhibit zoospores formation (de Souza et al., 2003). Others such as the phenazines inhibit electron transport in disease causing organisms and also act by damaging lipids and other macromolecules (Haas and Defa*go, 2005). According to Haas and Défa*go (2005), six classes of antibiotic compounds (for which their modes of action are partly understood) are better related to the biocontrol of root diseases: phenazines, phloroglucinols, pyoluteorin, pyrrolnitrin, cyclic lipopeptides (all of which are diffusible) and hydrogen cyanide (HCN; which is volatile).

Plant Growth Promotion by Soil Microorganisms

Antifungal Activity PGPR improve plant growth by preventing the proliferation of phytopathogens and thereby support plant growth. Some PGPR synthesize antifungal antibiotics, e.g. P. fluorescens produces 2, 4-diacetyl phloroglucinol which inhibits growth of phytopathogenic fungi (Nowak, 1994). Certain PGPR degrade fusaric acid produced by Fusarium sp. causative agent of wilt and thus prevents the pathogenesis (Toyoda et al., 1991). Some PGPR can also produce enzymes that can lyse fungal cells. For example, Pseudomonas stutzeri produces extracellular chitinase and laminarinase which lyses the mycelia of Fusarium solani (Mauch et al., 1988). In recent years, fluorescent Pseudomonas has been suggested as potential biological control agent due to its ability to colonize rhizosphere and protect plants against a wide range of important agronomic fungal diseases such as black root-rot of tobacco (Voisard, et al., 1989), root-rot of pea (Papavizas et al., 1974), root-rot of wheat (Garagulia et al., 1974), damping-off of sugar beet (Fenton et al., 1992, Shanahan et al., 1992, Kumar et al., 2002) and as the prospects of genetically manipulating the producer organisms to improve the efficacy of these biocontrol agents (Dowling et al., 1994). HCN Production HCN production by rhizospheres could affect the plant through direct or indirect or synergistically. One group of microorganisms which acts as biocontrol agents of weeds include the deleterious Rhizobacteria (DRB) that can colonize plant root surfaces and able to suppress plant growth. (Saharan and Nehra, 2011) Cyanide acts as a general metabolic inhibitor, it is synthesized, excreted and metabolized by hundreds of organisms, including bacteria, algae, fungi, plants, and insects, as a mean to avoid predation or competition. HCN could also be an alternative approach to suppress the growth or kill the microorganism instead of using antibiotic producing microorganism. Excess dependent on antibiotic producing bacteria as biocontrol agent arise the problem of transforming the normal target strain into antibiotic resistant strain. To prevent this from happening, some researchers have utilized biocontrol strains that synthesize hydrogen cyanide as well as one or more antibiotics. HCN is produced by many fluorescent pseudomonad in the exponential growth phase in media containing FeCl3 or inorganic phosphate may also influence plant root pathogens and suppress the diseases caused by them. Role of HCN production by fluorescent pseudomonad in control of root pathogens is as yet unclear it is possible that HCN production in rhizosphere has different effects on different plant types. For tobacco plants, it has been shown that HCN production by fluorescent pseudomonad stimulated hair root formation. No adverse effect on plant growth by HCN producing pseudomonad could be observed in experiments with neutral or artificial soil under plant normal nutrition. Induction of Systemic Resistance Plants play a key role in the sustainability of life on earth. They fix the solar energy that drives nearly all living processes. As a result, plants are members of

Microbes: In Action

complex communities and interact both with antagonists and beneficial organisms. (ISR1)-in the starting, during evolution, plants developed unique defense system to fight with their enemies. These enemies are not only pathogenic bacteria and fungi, even virus, herbivores insect and nematode. The plant immune system is based on a surprisingly complex defense signaling network that is highly flexible in its capacity to recognize and respond to the invader encountered. Plant hormones and volatile organic compounds emerged as important signaling molecules in local and systemic induced defense responses to pathogen or insect attack. Non-pathogenic rhizobacteria and fungi have been shown to suppress disease by inducing a resistance mechanism in the plant called "Induced Systemic Resistance" (ISR) (Van Loon et al., 1998). A wide variety of root-associated mutualists, including Pseudomonas, Bacillus, Trichoderma, and mycorrhiza species sensitize the plant immune system for enhanced defense without directly activating costly defenses (Pieterse et al., 2014). Phenotypically, PGR mediated ISR resembles classic pathogen induced resistance, in which non-infected parts of previously pathogen infected plants become more resistance to further infection. This latter form of induced resistance is often referred to as systemic acquired resistance (SAR). ISR and SAR act through different signaling pathways. Induction of SAR is through salicylic acid (SA) and ISR requires jasmonic acid (JA) and ethylene (ET) signaling pathways (Van Loon et al., 1998). These accumulating signaling molecules coordinate the defense responses and when applied exogenously, are sufficient to induce resistance (Ryals et al., 1996). The protection mediated by ISR is significantly less than that obtained by SAR (Van Loon, 2000) and a degree of dependence on plant genotype is observed in the generation of ISR (Bloemberg and Lugtenberg, 2001). However, ISR and SAR together provide a better protection than each of them alone, indicating that they can act additively in inducing resistance to pathogens. Mechanism of ISR-Mediated by PGPR PGPR bring about ISR through fortifying the physical and mechanical strength of the cell wall as well as changing the physiological and biochemical reaction of the host leading to the synthesis of defense chemicals against the challenge pathogen. a) Structural and Ultra-Structural Cell Wall Modifications in the Host Plants To prevent the entry of invading pathogen, plants successfully developed defense mechanism for protecting cell walls against the spread of pathogen. It is well known that PGPR induces cell wall structural modification in response to pathogenic attack. Seed-treatment of PGPR in bean induces the lignification of cell wall. Treatment of pea seeds with P. yuorescens strain 63-28 has resulted in formation of structural barriers, viz., cell wall apposition (papillae) and deposition of newly formed callose and accumulation of phenolic compounds at the site of penetration of invading hyphae of Pythium ultimum and F. oxysporum f. sp. pisi. Such a rapid defense reaction at sites of fungal entry delays the infection process and allows sufficient time for the host

Plant Growth Promotion by Soil Microorganisms

to build up other defence reactions to restrict pathogen growth to the outer most layer of root tissue. b) Biochemical/Physiological Changes in the Host Plants Application of PGPR results in biochemical or physiological changes in the plants. Normally ISR by PGPR is associated with the accumulation of PR proteins (pathogenesis-related proteins) synthesis of phytoalexin and other secondary metabolites. In pea, seed treatment with P. fluorescens strain 63-28 has produced hydrolytic enzymes such as chitinases and b-1, 3 glucanases. These host lytic enzymes accumulate at the site of penetration of the fungus, F. oxysporum f. sp. pisi resulting in the degradation of fungal cell wall. ISR has been correlated with a two-fold increase in activity of pathogenesis-related peroxidase and chitinase proteins. Defense chemicals other than PR proteins are also induced in ISR by PGPR in certain crops. Accumulation of phytoalexin in response to Pseudomonas sp. strain WCS 417r treatment in carnation results in protection of carnation from wilt disease incidence (Van Peer et al., 1991). Increased peroxidase activity as well as an increase in the level of mRNAs encoding for phenylalanine ammonia lyase (PAL) and chalcone synthase (which lead to synthesis of phytoalexin) are recorded in the early stages of interaction between bean roots and various bacterial endophytes Normally Diabrotica beetles are attracted to volatiles, cucurbitacins (triterpenoids occur mainly in cucurbitaceae), coming from cucurbit blossoms and probably use these olfactory clues in long-range host finding. The cucurbitac in causes locomotory arrest and compulsive feeding of Diabrotic beetles (Anderson and Metcalf, 1986; Lewis et al., 1990). Unless a feeding stimulant is detected on the cucumber plant, the beetles may leave the host within 1-2 min (Lewis et al., 1990). Due to PGPR treatment, there is a shift in the metabolic pathway in cucumber plants away from the cucurbitac in synthesis and towards that of other plant defence compounds, resulting in fewer beetles being attracted. In nematode control, PGPR induce resistance by altering root exudates or inducing the host to produce repellents that alert nematode attraction or recognition of the host (Oostendorp and Sikora, 1990) and altering the syncytial development or sex ratio in the root tissue (Wyss, 1989). In rice, seed treatment with PGPR strains increases the chitinase enzyme activity and phenolic content and this is correlated with the reduced nematode infestation. (Ramamoorthy et al., 2001) Bacteriocins Bacteriocins are antimatabolites or proteinaceous toxin produced by bacteria which inhibit the growth of similar or closely related bacteria. Bacteriocins differ from traditional antibiotics in one critical way: they commonly have a relatively narrow killing spectrum and are only toxic to bacteria closely related to the producing strain. The colicins, proteins produced by some strains of Escherichia coli that are lethal for related strains, are the most representative bacteriocins produced by Gram-negative bacteria. (Riley and Wertz, 2002) Like colicin, a name derived from E. coli, other bacteriocins have been thus defined and

Microbes: In Action

named, such as pyocins from P. pyogenes strains, cloacins from Enterobacter cloacae, marcescins from Serratia marcescens and megacins from B. megaterium (Cascales et al., 2007). Interestingly, bacteriocins from Bacillus spp. are increasingly becoming more important due to their sometimes broader spectra of inhibition (as compared with most lactic bacterial bacteriocins), which may include Gram-negative bacteria, yeasts or fungi, in addition to Gram-positive species, some of which are known to be pathogenic to humans and/or animals (Abriouel et al., 2011). Competition for Nutrients and Suitable Niches In ecology world, there is a famous principle "Competitive Exclusion Principle". It is also called Gause's law of competitive exclusion which state if two species, with the same niche, coexist in the same ecosystem, then one will be excluded from the community due to intense competition for the same resource. Fluorescent Pseudomonas can protect plant root form disease causing microorganism to compete with them for nutrient and suitable niche. Nutrient competition varies at different rhizospheres depending on the available source of carbon, nitrogen, sulfur, phosphate and micronutrients. This is not yet confirmed that whether better capabilities to utilize a particular types of nutrient or nutrients can confer a significant competitive advantages on a fluorescent Pesudomonas strain (Lindow SE, 1987). REFERENCES Abriouel H, Franz CM, Ben Omar N and Galvez A (2011). Diversity and applications of Bacillus bacteriocins. FEMS Microbiol Rev. 35:201-232 Anderson JF and Metcalf RL (1986). Identification of a volatile attractant for Diabrotica and Acalymma spp. from blossoms of Cucurbita maxima duch*esne. J. Chem. Ecol. 12: 687-699 Battu PR and Reddy MS (2009). Siderophore mediated antibiosis of rhizobacterial fluorescent Pseudomonads against rice fungal pathogens. Int J Pharm Tech Res. 1: 227-229 Bloemberg GV and Lugtenberg BJ (2001). Molecular basis of plant growth promotion and biocontrol by rhizobacteria. Curr Opin Plant Biol. 4: 343-350 Boiero L, Perrig D, Masciarelli O, Penna C, Cassan F and Luna V (2007). Phytohormone production by three strains of Bradyrhizobium japonicum and possible physiological and technological implications. Appl. Microbiol. Biotechnol. 74: 874-880 Camerini S, Senatore B, Lonardo E, Imperlini E, Bianco C, Moschetti G, Rotino GL, Campion B and Defez R (2008). Introduction of a novel pathway for IAA biosynthesis to rhizobia alters vetch root nodule development. Arch. Microbiol. 190: 67-77 Cascales E, Buchanan SK, duch*e D, Kleanthous C, Lloubes R, Postle K, Riley M, Slatin S and Cavard D (2007). Colicin Biology. Microbiol Mol Biol Rev. 71: 158-229 Cohen AC, Bottini R and Piccoli PN (2008). Azospirillum brasilense Sp 245 produces ABA in chemically-defined culture medium and increases ABA content in Arabidopsis plants. Plant Growth Regul. 54: 97-103 Das AJ, Kumar M and Kumar R (2013). Plant Growth Promoting Rhizobacteria (PGPR): An Alternative of Chemical Fertilizer for Sustainable. Research Journal of Agriculture and Forestry Sciences. 1(4): 21-23 de Souza JT, Weller DM and Raaijmakers JM (2003). Frequency, diversity and activity of 2,4diacetylphloroglucinol producing fluorescent Pseudomonas spp. in Dutch take-all decline soils. Phytopathology. 93: 54-63 Dodd IC, Zinovkina NY, Safronova VI and Belimov AA (2010). Rhizobacterial mediation of plant hormone status. Ann. Appl. Biol. 157: 361-379

Plant Growth Promotion by Soil Microorganisms

Dowling DN, O'Gara F (1994). Metabolites of Pseudomonas involved in the biocontrol of plant disease. Trends in Biotechnology. 12 ( 4): 133-141 Dugardeyn J and van der Straeten D (2008). Ethylene: fine-tuning plant growth and development by stimulation and inhibition of elongation. Plant Science. 175: 59-70 Fenton AM, Stephens PM, Crowley J, O'Callaghan M and O'Gara F (1992). Exploitation of gene(s) involved in 2,4-diacetylphloroglucinol biosynthesis to confer a new biocontrol capability to a Pseudomonas strain. Applied and Environmental Microbiology. 58 ( 12): 38733878 Garagulia AD, Kiprianova EA and Boiko OI (1974). Antibiotic effect of bacteria from the genus Pseudomonas on phytopathogenic fungi. MikrobioL Zh. (Kiev). 36 ( 2): 197-202 Glick BR (2005). Modulation of plant ethylene levels by the bacterial enzyme ACC deaminase. FEMS Microbiol Lett. 251: 1-7 Glick BR (2012). Plant Growth-Promoting Bacteria: Mechanisms and Applications. Hindawi Publishing Corporation. Glick BR, Cheng Z, Czarny J and Duan J (2007). Promotion of plant growth by ACC deaminase-producing soil bacteria. Eur. J. Plant Pathol. 119: 329-339 Grichko VP and Glick BR (2001). Amelioration of flooding stress by ACC deaminasecontaining plant growth-promoting bacteria. Plant Physiol. Biochem. 39: 11-17 Haas D and Defa*go G (2005). Biological control of soil-borne pathogens by fluorescent pseudomonads. Natra Rev Microb. doi:10.1038/nrmicro1129 Handelsman J and Stab EV (1996). Biocontrol of soilborne plant pathogens. Plant C. 8: 8551869 Hiltner L (1904). Uber neuere Erfahrungen und Probleme auf dem Gebiete der Bodenbakteriologie unter besonderer Berücksichtigung der Grundungung und Brache. Arb DLG. 98: 59-78 Kai M, Haustein M, Molina F, Petri A, Scholz B and Piechulla B (2009). Bacterial volatiles and their action. Appl. Microbiol. Biotechnol. 81: 1001-1012 Kloepper JW, Leong J, Teintze M and Scroth MN (1980). Enhancing plant growth by siderophores produced by plant growth promoting rhizobacteria. Nature. 286: 885-886 Kumar NR, Arasu VT and Gunasekaran P (2002). Genotyping of antifungal compounds producing plant growth-promoting rhizobacteria, Pseudomonas fluorescens. Current Science. 82 ( 12): 1465-1466 Labuschagne Nico, Pretorius T and Idris AH (2010). Plant Growth Promoting Rhizobacteria as Biocontrol Agents against Soil-Borne Plant Diseases. Microbiology Monographs. 18: 211230 Leeman M, den Ouden FM, Pelt JA, Dirik FPM, Steij LH, Bakker PAHM and Schippers B (1996). Iron availability affects induction of systemic resistance to Fusarium wilt of radish by Pseudomonas fluorescens. Phytopathology. 86:149-155 Lemanceau P, Bakker PAHM, De Kogel WJ, Alabouvette C and Schippers B (1993). Antagonistic effect of non-pathogenic Fusarium oxysporum Fo47 and pseudobactin 358 upon pathogenic Fusarium oxysporum f. sp. dianthi. Appl Environ Microbiol. 59: 74-82 Lewis PA, Lampman RL and Metcalf RL (1990). Kairomonal attractants for Acalymma vittatum (Coleoptera: Chrysomelidae). Environ. Entomol. 19: 8-14 Lindow SE (1987). Competitive exclusion of epiphytic bacteria by Ice Pseudomonas syringae mutants. Appl Environ Microbiol. 53: 2520 Mathiyazhagan S, Kavitha K, Nakkeerans S, Chandrasekar MK, Renukadevi P, Krishnamoorthy AS, Fernando WGD (2004). PGPR mediated management of stem blight of Phyllanthus amarus (Schum and Thonn) caused by Corynespora cassiicola (Berk and Curt) wei. Archives Phytopathol Plant Prot. 37:183-199 Mauch F, Mauch-Mani B and Boller T (1988). Antifungal hydrolases in pea tissue. II. Inhibition of fungal growth by combinations of chitinase and /3-1,3-glucanase. Plant Physiology. 88 (Suppl 3): 936-942 Mauch F, Mauch-Mani B and Boller T (1988). Antifungal hydrolases in pea tissue. II. Inhibition of fungal growth by combinations of chitinase and /3-1,3-glucanase. Plant Physiology. 88 ( 3): 936-942

Microbes: In Action

Mayak S, Tirosh T and Glick BR (2004a). Plant growth-promoting bacteria that confer resistance to water stress in tomatoes and peppers. Plant Sci. 166: 525-530 Mayak S, Tirosh T and Glick BR (2004b). Plant growth-promoting bacteria confer resistance in tomatoes plants to salt stress. Plant Physiol Biochem. 42: 565-572 Miernyk JA (1979). Abscisic acid inhibition of kinetin nucleotide formation in germinating lettuce seeds. Physiol. Plantarum. 45: 63-66 Nandal M and Hooda R (2013). Plant Growth Promoting Rhizobacteria: A Review Article. International Journal of Current Research. 5(12): 3863-3871 Nardi S, Concheri G, Pizzeghello D, Sturaro A, Rella R and Parvoli G (2000). Soil organic matter mobilization by root exudates. Chemosphere. 5: 653-658 Natalia VM (2013). Endophytic bacteria with plant growth promoting and biocontrol abilities. Doctoral thesis, Leiden University (baap) Neilands J (1995). Siderophores: structure and function of microbial Iron transport compounds. J Biol Chem. 45: 26723-26726 Nowak-Thompson B, Gould SJ, Kraus J and Loper JE (1994). Production of 2,4diacetylphloroglucinol by the biocontrol agent Pseudomonas fluorescens Pf-5. Canadian Journal of Microbiology. 40(12): 1064-1066 O'Sulivan DJ and O' Gara F (1992). Traits of fluorescent Pseudomonas spp. involved in the suppression of plant root pathogens. Microbiol Rev. 56:662-676 Oostendorp M and Sikora RA (1990). In vitro interrelationship between rhizosphere bacteria and Heterodera schachtii. Rev. Nematol. 13(3): 269-274 Papavizas GC and Ayers WA (1974). Aphanomyces species and their root diseases in pea and sugarbeet. A Review, US Department of Agriculture, Washington DC. Perrig D, Boiero ML, Masciarelli OA, Penna C, Ruiz OA, Cassan FD and Luna MV (2007). Plant-growth-promoting compounds produced by two agronomically important strains of Azospirillum brasilense and implications for inoculants formulation. Appl. Microbiol. Biotechnol. 75: 1143-1150 Pieterse CMJ, Christos Z, Roeland LB, David MW, Saskia CMVW, Peter AHMB (2014). Induced Systemic Resistance by Beneficial Microbes, Phytopathology. 52:347-375 Raaijmakers JM, Vlami M and de Souza JT (2002). Antibiotic production by bacterial biocontrol agent. Anton van Leeuwenhoek. 81: 537-547 Ramamoorthy V, Viswanathan R, Raguchander T, Prakasam V and Samiyappan R (2011). Review article Induction of systemic resistance by plant growth promoting rhizobacteria in crop plants against pests and diseases, Crop Protection. 20: 1-11 Riley MA and Wertz JE (2002). Bacteriocins: Evolution, ecology, and application. Annu Rev Microbiol. 56: 117-137 Ryals JA, Neuenschwander UH, Willits MG, Molina A, Steiner HY and Hunt MD (1996). Systemic acquired resistance. Plant Cell. 8: 1808-1819 Saharan BS and Nehra V (2011). Plant Growth Promoting Rhizobacteria: A Critical Review, Life Sciences and Medicine Research. 21: 1-30 Santner A, Calderon-Villalobos LIA and Estelle M (2009). Plant hormones are versatile chemical regulators of plant growth. Nature Chem. Biol. 5: 301-307 Shaharoona B, Arshad M and Zahir ZA (2006). Effect of growth promoting rhizobacteria containing ACC-deaminase on maize (Zea mays L.) growth under axenic conditions and on nodulation in mung bean (Vigna radiata L.). Lett. Appl. Microbiol. 42: 155-159 Shanahan P, O'Sullvan DJ, Simpson P, Glennon JD and O'Gara F (1992). Isolation and characterization of an antibiotic-like compound from a fluorescent pseudomonad and investigation of physiological parameters influencing its production. Applied and Environmental Microbiology. 58(Suppl 1): 353-358 Singh JS (2013). Plant Growth Promoting Rhizobacteria Potential Microbes for Sustainable Agriculture. Resonance. Smyth E (2011). Selection and analysis of bacteria on the basis of their ability to promote plant development and growth. PhD Thesis, University College Dublin. Spaepen S and Vanderleyden J (2011). Auxin and plant-microbe interactions. Cold Spring Harb. Perspect. Biol. 1: 3: 4

Plant Growth Promotion by Soil Microorganisms

Spaepen S, Vanderleyden J and Okon Y (2009). Plant Growth-Promoting Actions of Rhizobacteria. Ann. Botan. Res. 51: 283-320 Spaepen S, Vanderleyden J and Remans R (2007). Indole- 3-acetic acid in microbial and microorganism-plant signaling. FEMS Microbiol. Rev. 31: 425-448 Toyoda H and Utsumi R (1991). Method for the prevention of Fusarium diseases and microorganisms used for the same. US Patent No. 4988, pp. 586 Van Loon LC (2000). Systemic induced resistance. In: Slusarenko AJ, Fraser RSS and Van Loon LC (eds) Mechanisms of Resistance to Plant Diseases. Kluwer Academic Publishers, Dordrecht,pp. 521-574 Van Loon LC, Bakker PAHM and Pieterse CMJ (1998). Systemic resistance induced by rhizosphere bacteria. Annu Rev Phytopathol. 36: 453-83 Van Peer R, Niemann GJ and Schippers B (1991). Induced resistance and phytoalexin accumulation in biological control of Fusarium wilt of carnation by Pseudomonas sp strain WCS 417r. Phytopathology. 81: 728-734 Vesperman A, Kai M and Piechulla B (2007). Rhizobacterial volatiles affect the growth of fungi and Arabidopsis thaliana. Appl. Environm. Microbiol. 73: 5639-5641 Viterbo A, Landau U, Kim S, Chernin L and Chet I (2010). Characterization of ACC deaminase from the biocontrol and plant growth-promoting agent Trichoderma asperellum T203. FEMS Microbiol. Lett. 305: 42-48 Voisard C, Keel C, Haas D and Defa*go G (1989). Cyanide production by Pseudomonas fluorescens helps suppress black root rot of tobacco under gnotobiotic conditions. The EMBO Journal. 8(Suppl 2): 351-358 Wandersman C and Delepelaire P (2004). Bacterial iron sources: from siderophores to hemophores. Annu Rev Microbiol. 58: 611-47 Wheatley RE (2002). The consequences of volatile organic compound mediated bacterial and fungal interactions. Antonie Van Leeuwenhoek. 81: 357-364 Wyss U (1989). Video assessment of root cell responses to Dorylaimid and Tylenchid nematodes. In: Veech JA, Dickson DW (Eds.), Vistas on Nematology. Society of Nematologists, Inc., Hyattsville, Maryland, pp. 211-220 Zahir ZA, Ghani U, Naveed M, Nadeem SM and Asghar HN (2009). Comparative effectiveness of Pseudomonas and Serratia sp. containing ACC-deaminase for improving growth and yield of wheat (Triticum aestivum L.) under salt stresses conditions. Arch. Microbiol. 191: 415-424

CHAPTER 4 Bio-fertilizers – Most Prominent Option for Revitalization of Soil Health Umesh C. Pachouri1, Joginder Singh1, Manoj Kumar2, Ashish Vyas1, Avinash Bohra3 and Sachendra Bohra3 1

Department of Biotechnology, School of Biotechnology and Bioscience, Lovely Professional University, Phagwara, Punjab – 144411 India 2 Amity Institute of Microbial Technology, Amity University Uttar Pradesh, Noida, UP – 201303, India 3 Department of Botany, Jai Narain Vyas, University, Jodhpur, India -342 001 Corresponding author: [emailprotected]

INTRODUCTION The world's population is assumed to increase from 7 billion now to 8.3 billion in 2025. The world will need 70 to 100 percent more food by 2050 (Godfray et al., 2010). Therefore, the production of cereals, especially wheat, rice and maize, which accounts for half of the human's calorie intake, has to be increased. Currently, plant growth is enhanced by the input of chemicals which act as plant growth regulators (using a hormonal mechanism) and as nutrients. Of the nutrients added to the soil, nitrogen and phosphorous are the major ones. The high input of chemicals raises a number of concerns such as water contamination leading to euthrophication and health risks for humans (Lugtenberg et al., 2013). Moreover, it results in soil degradation and loss of biodiversity. In this chapter we will describe beneficial microbes which can act as environmentally friendly biofertilizers for agrochemicals. Their application will increase the sustainability of agriculture. Biofertilizers are low cost, renewable sources of plant nutrients which supplement chemical fertilizers. These are nothing but selected strains of beneficial soil microorganisms cultured in the laboratory and packed in a suitable carrier. They can be used either for seed treatment or soil application. Biofertilizers generate plant nutrients like nitrogen and phosphorous through their activities in the soil or rhizosphere and make available to plants in a gradual manner. Biofertilizers are gaining momentum recently due to the increasing emphasis on maintenance of soil health, minimize environmental pollution and cut down on the use of chemicals in agriculture. In rainfed agriculture, these inputs gain added importance in view of their low cost, as most of the farmers are small and marginal and cannot afford to buy expensive chemical fertilizers. Biofertilizers are also ideal input for reducing the cost of cultivation and for practicing organic farming (Muraleedharan et al., 2010).

Microbes: In Action

Biofertilizer is still an unclear term. It can be easily found that biofertilizers are identified as plant extract, composted urban wastes, and various microbial mixtures with unidentified constituents, and chemical fertilizer formulations supplemented with organic compounds. However biofertilizer is most commonly referred to the use of soil microorganisms to increase the availability and uptake of mineral nutrients for plants. Hence, it is necessary to define the term "Biofertilizer". There is a proposal that "biofertilizer" be defined as a substance which contains living micro- organisms which colonizes the rhizosphere or the interior of the plant and promotes growth by increasing the supply or availability of primary nutrient and/or growth stimulus to the target crop, when applied to seed, plant surfaces, or soil. Whether the existence of a microorganism increases the growth of plants by making nutrients more available or replacing soil nutrients or increasing plant access to nutrient, as long as the nutrient status of the plant has been enhanced by the microorganisms, the substance that was applied to the plant or soil containing the microorganisms, can be characterized as a biofertilizer. This definition separates biofertilizer from organic fertilizer containing organic matter. 'Biofertilizer' is a substance which contains living microorganism which, when applied to seed, plant surfaces, or soil, colonizes the rhizosphere or the interior of the plant and promotes growth by increasing the supply or availability of primary nutrients to the host plant. Biofertilizers are not fertilizers. Fertilizers directly increase soil fertility by adding nutrients. Biofertilizers add nutrients through the natural processes of fixing atmospheric nitrogen, solubilizing Phosphorus, and stimulating plant growth through the synthesis of growth promoting substances. Bio-fertilizer is very vast subject, it just does not mean fertilizer form microbial source. Today many plant extracts, composted urban waste, microbial mixture, and organic compound also coined as bio-fertilizers. Bio-fertilizers are defined as substance which contains micro-organism which colonizes with the interior walls of the plant and promotes their growth by increasing the availability of primary nutrients or growth stimulators. Bio-fertilizers are broadly categorized in three ways as Nitrogen Fixing, Phosphate mobilizing, and organic matter decomposers (Table 1). All these have their own type of specific role and also play a very important role in maintaining the health of plant throughout their life cycle, continuing the soil quality and in increasing the yield without any side effect to environment. Thus they are eco-friendly as compared to chemical fertilizers. Microbes which are involved in Nitrogen fixing are – Rhizobium, Azotobacter, and Azospirillum (Fig. 1). These microbes contains unique gene called as Nif-Gene which make them capable of fixing nitrogen (Table 2). Another type is Phosphate mobilizing, these are – Bacillus Pseudomonas, Species of Aspergillus species and VA Mycorrhiza. The decomposers of Organic matter are – Cellulomonas and Arthrobacter. All these types of microbes have special properties which make them capable of developing agriculture in true sense. In present scenario, microorganisms are used as bio-fertilizer along with various micro nutrients, vitamins, growth hormones like Gibberellin and Auxin. Subsequently in modern world of Biotechnology, Biopesticides are also used

Bio-fertilizers

along with Bio-fertilizers which helps plant to naturally develop resistance against diseases causing microorganism and pests. Bio-pesticides are the natural chemicals or micro-organism or biochemical which can kill micro-organism or pest naturally and has no adverse effect on mammals as well as environment. It has more advantages as compare to chemical pesticides as it produces very less harmful residues, are biodegradable that is they get digested naturally, does not enter in food chain of animals and mammals. TABLE 1: Different types of biofertilizers (modified from Sharma et al., 2012) S. No.

Groups

Examples

N2 fixing Biofertilizers 1

Free-living

Symbiotic

3 Associative Symbiotic P Solubilizing Biofertilizers 1

Bacteria

Fungi

Azotobacter, Clostridium, Anabaena, Nostoc, Beijerinkia, Derxia, Klebsiella, Rhodobacter Rhizobium, Bradyrhizobium, Azorhizobium, Frankia, Anabaena, Acetobacter Azospirillum, Gluconoacetobacter diazotrophics Bacillus megaterium, Bacillus polymyxa, Bacillus circulans, Pseudomonas striata Penicillium sp., Aspergillus awamori

P Mobilizing Biofertilizers 1

Arbuscular mycorrhiza

2 3

Ectomycorrhiza Orchid mycorrhiza

Glomus sp., Gigaspora sp., Acaulospora sp., Scutellospora sp., Enterophosphora sp. and Sclerocystis sp. Laccaria sp., Pisolithus sp., Boletus sp., Amanita sp. Rhizoctonia solani

Sulphur oxidizer Biofertilizers 1 Bacteria Thiobocblus thioxidans Biofertilizers for Micro nutrients 1

Silicate and Zinc Bacillus sp. solubilizers 2 Potassium solubilizers Erwinia, Pseudomonas sp., Bacillus sp., Fracturia auerentia 3 Manganese solubilizers Pencillium citrinum 4 Zinc mobilizers Thiobacillus thiooxidans Plant Growth Promoting Rhizobacteria 1 2

Bacteria Fungi

Pseudomonas fluorescens, Bacillus sp, Burkholderia, Herbaspirillum Piriformospora indica

Bio-filmed bio-fertilizers 1

Bacteria and Fungi

Fungal-bacterial bio-films (FBB), Fungal-rhizobial bio-films (FRB)

Microbes: In Action

FIG. 1: Symbolic representation of sequence of nitrogen assimilation and fixation by different rhizospheric bacteria associated with plant root. TABLE 2: An overview of biological N2 fixed by diverse organisms or system Organism or system Free-living microorganisms Cyanobacteria Azotobacter Clostridium pasteurianum Grass-Bacteria associative symbioses Azospirillum Cyanobacterial associations Gunnera Azolla Lichens Leguminous plant symbiosis with rhizobia Grain legumes (Glycine, Vigna, Lespedeza, Phaseolus) Pasture legumes (Trifolium, Medicago, Lupinus) Actinorhizal plant symbioses with Frankia Alnus Hippophaë Ceanothus Coriaria Casuarina

N2 fixed (kg ha-1y-1) 25 0.3 0.1-0.5 5-25 10-20 300 40-80 50-100 100-600 40-300 1-150 1-50 50-150 50

Biofertlizers are actually the living microorganisms which increase the fertility of the soil by providing nutrients required by the plants. These nutrients are in the form of animal wastes and other organic materials produced by the microorganisms. Due to these naturally occurring biofertlizers and nutrients,

Bio-fertilizers

plants have less chances of suffering from any diseases. Microorganisms create a healthy environment for the plant in which the plant can grow without suffering from any harmful diseases and also do not cause any kind of pollution in the environment. Numerous species of soil bacteria which flourish in the rhizosphere of plants, but which may grow in, on, or around plant tissues, stimulate plant growth. These bacteria are collectively known as plant growth promoting rhizobacteria (PGPR). Some PGPR appear to promote growth by acting as both biofertilizer and biopesticides. The search for PGPR and investigation of their modes of actions are increasing at a rapid pace as efforts are made to exploit them commercially as biofertilizers. Modes of PGPR action include fixing N2, increasing the availability of nutrients in the rhizosphere, positively influencing root growth and morphology, and promoting other beneficial plant-microbe symbiosis. The combination of these modes of actions in PGPR is also addressed, as well as the challenges facing the more widespread utilization of PGPR as biofertilizers. DIFFERENT TYPES OF BIOFERTILIZERS 1. Rhizobium: For more than 100 years, biological nitrogen fixation (BNF) has commanded the attention of scientists concerned with plant mineral nutrition, and it has been exploited extensively in agricultural practice (Burris, 1994; Dixon and Wheeler, 1986). However, its importance as a primary source of N for agriculture has diminished in recent decades as increasing amounts of nitrogen fertilizer have been used for the production of food and cash crops (Peoples et al., 1995). However, international emphasis on environmentally sustainable development with the use of renewable resources is likely to focus attention on the potential role of BNF in supplying N for agriculture. The expanded interest in ecology has drawn attention to the fact that BNF is ecologically benign and its greater exploitation can reduce the use of fossil fuels and can be helpful in reforestation and in restoration of misused lands to productivity (Sprent and Sprent, 1990; Zahran, 1999).

Rhizobium (Deshwal and Chaubey, 2014)

Microbes: In Action

Rhizobium belongs to bacterial group and the classical example is symbiotic nitrogen fixation. The bacteria infect the legume root and form root nodules within which they reduce molecular nitrogen to ammonia which is reality utilized by the plant to produce valuable proteins, vitamins and other nitrogen containing compounds (Fig. 2). The site of symbiosis is within the root nodules. It has been estimated that 40-250 kg N2/ha/ year is fixed by different legume crops by the microbial activities of Rhizobium. Inoculation of Rhizobium biofertilizer to legume crops enhances nodulation, nitrogen fixation and yield. Nodulation surveys indicate a need for inoculation every season for majority of legume crops cultivated in India. Competition between inefficient native strains to efficient inoculant strains appears to be a bottle neck in realizing higher yields from Rhizobium inoculation.

FIG. 2: Infection and early organogenesis of a nodule lobe in actinorhizal plants (Obertello et al., 2004)

2. Frankia: Casurania (non-leguminous tree) symbiosis: Non leguminous tree nodulated with Frankia are called actinorhizal plant. Nodules are formed by filamentous spore forming actinomycetes in 25 genera of 8 angiosperm families.

Bio-fertilizers

This kind of symbiosis has promising role in improving nitrogen economy by N2 fixation and also help in stabilizing eroding land surfaces. The actinorhizal nodules represent the cluster of modified roots with Frankia infected cells found in the cortex. Nodules first appear as swelling and later develops vesicles which are the sites of N2 fixation. The amount of nitrogen fixation in Frankia is about 90-200 kg N2/ha/yr with Alunus and Croiatria species.\

Frankia (Karthkeyan et al., 2013)

3. Azotobacter: It is the important and well known free living nitrogen fixing aerobic bacterium. It is used as a Bio-Fertilizer for all non-leguminous plants especially rice, cotton, vegetables etc. Azotobacter cells are not present on the rhizoplane but are abundant in the rhizosphere region. The lack of organic matter in the soil is a limiting factor for the proliferation of Azotobacter in the soil. It is used in the cultivation of many important crops because it is the important source of providing nitrogen to the plants. It enables the plant to germinate and grow without being effected from any harmful microbes. Apart from fixing nitrogen, they also known to release growth promoting substances like indole acetic acid (IAA), gibberellic acid and exhibit fungistatic activity. Increase in yield due to Azotobacter inoculation has been reported in cereals such as maize, pearl millet, wheat and sorghum. Azotobacter inoculation curtails the nitrogen requirement of fertilizers by 10 to 20% under normal field conditions.

Azotobacter colonies (Salhia, 2010)

Microbes: In Action

4. Azospirillum: It belongs to bacteria and is known to fix the considerable quantity of nitrogen in the range of 20- 40 kg N/ha in the rhizosphere in nonnon-leguminous plants such as cereals, millets, Oilseeds, cotton etc. Azospirilla are the bacteria which colonize the root zone and fix nitrogen in loose association with C4 plants such as maize, sorghum, sugarcane etc. It also produces growth promoting substances such as IAA, gibberellins, pantothenic acid, thiamine and niacin which promotes root proliferation, plant growth and yield. Azospirillum is remarkably versatile, it fixes atmospheric N2, mineralizes nutrients from soil, sequesters Fe, survives in stressed environmental conditions and also favours beneficial mycorrhizal plant associations. Recently they are known to mitigate negative effects of NaCl plant growth in wheat seedlings for plant growth (Brahmaprakash and Sahu, 2012). Inoculation technology with Azospirillum could be extended in arid soils in order to protect crops against drought. Azospirillum biofertilizers are suitable for C4 crops such as maize, sorghum and other cereals like rice, wheat, barley, ragi and various horticultural crops. Azospirillum can fix nitrogen from 10 to 40 kg/ha. But still, there is wider gap in exploring them as potential bio-fertilizer and still a lot can be done in sustaining cereal production. 5. Gluconoacetobacter diazotrophicus: Nitrogen fixing bacteria Gluconoacetobacter diazotrophicus earlier known as Acetobacter diazotrophicus discovered from sugarcane crop. The bacterium colonizes the internal tissues of sugarcane and fixes nitrogen upto 200 kg/ha. It is an acid and sucrose loving (30% of sucrose) with highest pH (5.5) and oxygen tolerant bacterium. It is present in xylem vessels, intercellular space of root, shoot or leaf, ensuring proper supply of nutrients for nitrogen fixation. 6. Cyanobacteria: A group of one-celled to many-celled aquatic organisms. Also known as blue-green algae are excellent N2 fixers. Cyanobacteria include, colonial species in which consists heterocyst have the ability to differentiate into different cell types (Sethi et al., 2014). Heterocyst are thick walled cells containing nitrogenase enzyme vital for N2 fixation. They are specialized structures for N2 fixation and able to fix nitrogen (N2) into ammonia (NH4+), which can be utilized by plants. The capacity of nitrogen fixation varies with agroclimatic conditions. They can provide 20-30 kg N2/ha/Yr in rice fields. In addition to nitrogen, cyanobacteria enrich soil with extracellular carbohydrates and many secondary metabolites. They are also known to increase soil water holding capacity and ameliorates degraded soil due to excessive use of chemical fertilizers and salt affected soils. 7. Anabaena azollae: Azolla is a free-floating water fern that floats in water and fixes atmospheric nitrogen in association with nitrogen fixing blue green alga Anabaena. Anabaena is considered to be a potential biofertilizer in terms of nitrogen contribution to rice. This association can fix N2 in rice ecosystem in the range of 30-100 kg N2/ha/season. Apart from nitrogen fixation, Anabaena azollae is also known to suppress weed population in wet land rice and provides additional economic advantage to rice cultivation. Azolla fronds consist of sporophyte with a floating rhizome and small overlapping bi-lobed leaves and roots (Fig. 3). Long before its cultivation as a green manure, Azolla has been used as a fodder for domesticated animals such as pigs and ducks. In recent days,

Bio-fertilizers

Azolla is very much used as a sustainable feed substitute for livestock especially dairy cattle, poultry, piggery and fish.

Anabaena Azollae (Adams et al., 2005)

Fig. 3. Location of Anabaena azollae (cyanobacterium) in the leaf cavity of Azolla filiculoides.

8. Phosphate solubilizing microorganisms (PSM): Phosphate Solubilizers have the ability to dissolve the fixed phosphate and convert it in the form which can be utilized by the plants. They produce enzymes, hormones and organic acids. These components make possible the solubilization of insoluble phosphate so that it can easily be used by the plants (Fig. 4). Most soils are

Microbes: In Action

deficient in soluble forms of phosphorus (P), one of the major essential macronutrients required for plant growth (Park et. al., 2010). Phosphorus, besides to nitrogen is one of the most important elements in crop production. It makes up to about 0.2% of plant dry weight. Only 15 to 20 per cent of applied phosphorus is recovered by the crops and remaining gets fixed in the soil. The fixed form does not contribute to the available phosphorous content in the soil. It has a defined role in plant metabolism such as cell division, development, photosynthesis, breakdown of sugar, nuclear transport within the plant, transfer of genetic characteristics from one generation to another and regulation of metabolic pathways (Kuhad et al., 2011). The plants obtain their phosphate requirements from the soil pool. It occurs in soil as inorganic phosphate, produced by weathering by parent rock or as organic phosphate derived from decayed plant, animal or microorganisms.

FIG. 4: Schematic diagram of soil phosphorus mobilization and immobilization by bacteria

The phosphate available for plant growth depends not only on the total amount of phosphorous in the environment but also on its solubility, which in turn is dictated by chemical reactions and biological interaction in the soil. The makeup of a soil (soil texture) and its acidity (pH) determine the extent to which nutrients are available to plants. The diverse soil phosphate forms can be generally categorized as soil solution phosphate, insoluble organic and insoluble inorganic phosphate. Many phosphate-solubilizing bacteria (PSB) belonging to the Pseudomonas, Bacillus, Rhizobium, Agrobacterium, Burkholderia, Achromobacter, Micrococcus, Aerobacter, Enterobacter, Flavobacterium, and Erwinia genera have been isolated from soil samples (Fernández et al., 2007). Efficient and economic use of phosphate fertilizer could be achieved by using PSMs in legumes, cereals and other useful crops. Micro-organisms with phosphate solubilizing potential increase the availability of soluble phosphate and enhance the plant growth by improving biological nitrogen fixation in leguminous plants. 9. Mycorrhiza: This P-mobilizers facilitate mobilization of soluble phosphorus from distant places in soil where plant roots cannot reach and thus increase availability of P to plants (Fig. 5). Mycorrhiza are prominent P mobilizers in a symbiotic association with plant roots. The fungal partner is benefited by obtaining its carbon requirements from host's photosynthates and

Bio-fertilizers

the plant in turn gains the much needed nutrients which would otherwise be inaccessible to the host. This uptake of nutrients is facilitated with the help of a fine absorbing hyphae of the fungus. These fungi are associated with majority of agricultural crops. Probably Vesicular Arbuscular mycorrhiza (VAM) is the most abundant fungi in agricultural crops and account for 5–50% of the biomass of soil microbes. Seven genera of VAM these fungi produce symbiosis with plants forms a large number of spores that penetrate into the plant root and form two types of structures, i.e. vesicles and arbuscules. Vesicles are smooth oval bodies that are most likely storage structures. Arbuscules are formed inside plant cells. Nutrients travel from soil through fungal hyphae to these arbuscules which gradually degenerate and provide nutrients to plants. The AM fungus penetrates the cortical cells of the roots of a vascular plant. Fungi make colonies either intracellularly or extracellularly in the roots of the plants and provide nutrients to the plants which are helpful in its growth. Fungi are very important for the soil life. Thus the association helps in higher uptake of P and better utilization of other nutrients like N, Cu, Zn and S, etc. VAM fungi also play an important role in water economy of plants and also improving the hydraulic conductivity of the root at lower soil water potentials. A few proposed mechanisms by which VAM fungi also help in activation of plant defense systems include changes in exudation patterns and concomitant changes in mycorrhizosphere populations, increased lignification of cell walls, and competition for space for colonization and infection sites (Cardoso and Kuyper, 2006).

FIG. 5: Role of plants and their mycorrhizal symbionts together with rhizosphere bacterial populations on the use of soil phytate (Becquer et al., 2014).

10. Sulphur oxidizers: Sulfur is extremely important to plant growth and soil health and the genus Thiobacillus is an important group of sulphur oxidizer (Fig. 6). The application of sulfur coupled with thiobacilli renders alkali soils fit for cultivation of crops. The formation of sulfuric acid by Thiobacillus in soil

Microbes: In Action

following additions of elemental sulfur augments nutrient mobilization by increasing the level of soluble phosphate, potassium, calcium, manganese, aluminium and magnesium. In fact, manganese deficiency in soils can be corrected by sulfur applications. Thiobacilli can also be used in the manufacture of a form of organic fertilizer long favored in Australia. In 'biosuper', a mixture of rock phosphate and sulfur is inoculated with Thiobacillus thiooxidans. The sulfuric acid produced in the mixture dissolves the phosphate and thereby enhances phosphorus nutrition of plants. Thiobacillus also played an important role in controlling plant diseases in sulfur amended soils with regard to potato scab caused by Streptomyces scabies and the rot of sweet potatoes caused by S. ipomoea. Under acidic soil conditions (below pH 5.0), inoculation of soil with thiobacilli after addition of sulfur effectively minimizes losses due to these pathogens.

FIG. 6: Oxidation of elemental sulfur by Thiobacilli (Näveke, 1986)

11. Zinc solubilizers: Zinc (Zn) is an utmost important micronutrient (0.008%) on the earth's crust but still 60 per cent of Indian soils exhibit deficiency if Zn content < 1.5 ppm below the critical level of Zn. The plant constraints in absorbing zinc from the soil are overcome by external application of soluble zinc sulphate (ZnSO4). But the fate of applied zinc in the submerged soil conditions is pathetic and 75% of applied zinc is transformed into different mineral fractions. There appears to be two main mechanisms of zinc fixation one operates in acidic soils and is closely related with cation exchange and other operates alkaline conditions where fixation takes place by complexation by organic ligands. Zn is an important element present as cofactor and metal activator. Exogenous application of soluble zinc sources, similar to fertilizers applications has been advocated to various crops (Bapiri et al., 2012). This causes transformation of about 96-99 percent of applied available zinc to various unavailable can be reverted back to available forms by inoculating Zn solubilizers like Pseudomonas sp., Bacillus sp., and Aspergillus niger. Among fungal genera A. niger possesses immense potential of solubilizing zinc and used to quantify zinc in soils containing low zinc. Lichens and conifers are conspicuous for higher Zn content and the highest concentration of this element has been found in poisonous mushroom. 12. Potassium solubilizer bacteria: Potassium (K) is an essential macronutrient and most abundantly absorbed cation that plays an important

Bio-fertilizers

role in the growth, metabolism and development of plants. Potassium availability to crop plants in soil is generally low since nearly 90 to 98 per cent of total potassium in the soil is in unavailable mineral forms. Microbial inoculants that are able to dissolve potassium from mineral and rocks, have influence on plant growth with both economic and environment advantage. Many indigenous soil microorganisms have the potential to absorb and mobilize the fixed form of nutrient from trace mineral sources. A wide range of bacteria namely Pseudomonas, Burkholderia, Acidothiobacillus ferrooxidans, Bacillus mucilaginosus, Bacillus edaphicus, B. circulans and Paenibacillus sp. has been reported to release potassium in accessible form from potassium-bearing minerals in soils (Parmar and Sindhu, 2013). These potassium solubilizing bacteria (KSB) were found to dissolve potassium, silicon and aluminium from insoluble K-bearing minerals such as micas, illite and orthoclases, by excreting organic acids which either directly dissolved rock K or chelated silicon ions to bring K into the solution. Inoculation with potassium solubilizing bacteria have been reported to exert beneficial effects on growth of cotton and rape, pepper and cucumber, sorghum, wheat and Sudan grass. 13. Silicate solubilizing bacteria (SSB): Silicon a biologically important element, required in living organisms in a very less amount. Among the plants silica concentration are found to be higher in monocotyledons than in dicotyledons and its level increased from legumes < fruit crops < vegetables < grasses < grain crops (Thiagalingam et al., 1977). Grasses accumulates 2 to 20 percent foliar dry weight as hydrated polymer or silica gel. Rice accumulates 4-20 percent silicon in straw and almost every part of rice contains this element which is not at all added exogenously as fertilizer as done with nitrogen, phosphorus and potassium the trinity of nutrients. To the plants it provides natural defense against many fungal diseases, hence silicon availability to the plants is very much important. Silicon tends to maintain erectness of rice leaves and clumps there by increasing the photosynthesis because of better light interception. The oxidizing power of rice roots and accompanying tolerance to high levels of iron and manganese are found to be depending on silicon nutrition. Silicon nutrition also alleviate many abiotic stresses including physical stress like lodging, drought, radiation, high temperatures, freezing, UV and chemical stress like salt, metal toxicity, nutrient imbalance and many others. The beneficial effects are attributed to Silicon deposition in cell walls of roots, leaves, culms and hulls. Silicon deposition in roots reduces the binding sites for metals resulting in decreased uptake and translocation of salts and toxic metals from roots to shoot. Silicon alleviated effects have been associated with an increase in antioxidant defense abilities Silicon is second most abundant element found on the earth, but its solubility in soil is a major concern. Therefore identification of efficient bacterial strains which could solubilize silicate is of paramount importance. Moreover, solublization of silica also releases several other essential nutrients in the soil. Silicate minerals like Talc, Dolomite and Magnesium trisilicate were easily solubilised by the bacterium. Microorganisms are capable of degrading silicates and aluminum silicates. During the metabolism of microbes several organic acids are produced and these have a dual role in silicate weathering. During the

Microbes: In Action

metabolism of microbes several organic acids are produced and these have a dual role in silicate weathering. They supply H+ ions to the medium and promote hydrolysis and the organic acids like citric, oxalic acid, Keto acids and hydroxy carboxylic acids which from complexes with cations, promote their removal and retention in the medium in a dissolved state (Rana et al., 2013). Silicate bacteria are also known to dissolve potassium, silica and aluminium from insoluble minerals and they are known to liberate organic acids during solubilisation. A variety of soil microorganisms have been found to solubilize silicate minerals including bacteria like Erwinia, Pseudomonas sp. and Bacillus sp. 14. Manganese solubilizers: Manganese is one of nine of the essential nutrients that plants require for growth. Many processes are dependent on this nutrient including chloroplast formation, photosynthesis, nitrogen metabolism and synthesis of some enzymes. Manganese is also involved in pollen germination, pollen tube growth, root cell elongation and resistance to root pathogens. This role of manganese in plants is extremely crucial. Deficiency of manganese, which is common in soils that have neutral to high pH or a substantial deal of organic matter, can cause serious problems with plants. Penicillum citrinum a fungal culture present in soil is known to solubilize manganese from the low grade manganese ores and from the soil if it present. The fungus produces reductive compounds such as organic acids and which help in solubilizing of manganese. 15. Plant Growth Promoting Rhizobacteria (PGPR): The group of bacteria that colonize roots or rhizosphere soil and beneficial to crops are referred to as plant growth promoting rhizobacteria (PGPR). Generally, plant growth promoting rhizobacteria facilitate the plant growth directly by either assisting in resource acquisition (nitrogen, phosphorus and essential minerals) or modulating plant hormone levels, or indirectly by decreasing the inhibitory effects of various pathogens on plant growth and development in the forms of biocontrol agents (Ahemada and Kibretb, 2014). Numerous workers have documented the increased health and productivity of different plant species by the application of plant growth promoting rhizobacteria under both normal and stressed conditions. The PGPR, are characterized by the following inherent properties: (i) proficient enough to colonize the root surface; (ii) survive, multiply and compete with other microbiota, at least for the time needed to express their plant growth promotion/protection activities and (iii) promotes plant growth. Somers et al. (2004) classified PGPR based on their functional activities as 1. Biofertilizers (increasing the availability of nutrients to plant). 2. Phytostimulators (plant growth promotion, generally through phytohormones). 3. Rhizoremediators (degrading organic pollutants). 4. Biopesticides (controlling diseases, mainly by the production of antibiotics and antifungal metabolites). Several mechanisms such as alteration in the composition of rhizospheric microorganisms, production of plant signaling compounds, bacteriocins, siderophores, plant growth hormones and improving availability of nutrients by rhizospheric microorganisms have been reported for such synergism (Fig. 6;

Bio-fertilizers

Akhtar et al., 2012). The plant-beneficial rhizobacteria may decrease the global dependence on hazardous agricultural chemicals which destabilize the agroecosystems. PGPR mainly includes species of Agrobacterium, Allorhizobium, Arthrobacter, Azorhizobium, Azotobacter, Azospirillum, Bacillus, Bradyrhizobium, Burkholderia, Caulobacter, Chromobacterium, Erwinia, Flavobacterium, Mesorhizobium, Micrococcous, Pseudomonas, Rhizobium, Serratia etc.

FIG. 6: Plant growth-promoting mechanisms from rhizobacteria (Rajkumar et al., 2009)

16. Bio-filmed bio-fertilizers - Application of developed bio-film as biofertilizer has a great potential in crop production. A bio-film consists of microbial cells (algal, fungal, bacterial and/or other microbial) plus an extracellular biopolymer (EPS) produced by the cells which provides structure and protection to the community. Formation of fungal-bacterial bio-films (FBBs) by bacterial colonization on biotic fungal surfaces gives the biofilms enhanced metabolic activities compared to monocultures. Beneficial biofilms enveloped in vitro cultured conditions both fungal and bacterial strains were used as biofertilizers for non-legume species with good efficacy results. Application of biofilm inoculant containing a fungal – rhizobia consortium significantly increased N2 fixation in soybean compared to traditional Rhizobium inoculation. Wheat seedlings inoculated with biofilm production bacteria exhibited an increase yield in moderate saline soils. Biofilms seem also to help the micro-organ to survive after inoculation even under stress conditions. This is a key aspect for the effectiveness of PGPM inoculation under agricultural conditions. The biofilmed inocula can be

Microbes: In Action

effectively used in bio-solubilization of rock-phosphate. Further they can also be used for successful establishment of introduced beneficial micro-organisms in plants for bio-control of disease etc. Pleurotus ostreatus, Pseudomonas flurescens biofilm increase endophytic colonization of tomato by P. flourescens. Diverse forms of biofilmed inocula may satisfy the future demand of augmented crop productivity with increased N2 fixation, nutrient uptake and bio-control of diseases. Formulation of Biofertilizer Presently, a range of commercial biofertilizer formulations are available and different strategies have been applied to ensure maximum viability of the microorganisms used in such formulations (Brar et al., 2012). These strategies comprise: (i) optimization of biofertilizer formulation, (ii) application of thermo-tolerant/drought-tolerant/genetically modified strains and, (iii) application of liquid biofertilizer. For convenience of application, a carrier material is used as a vehicle for the microorganisms to be used as biofertilizer. Moreover, such materials may have a role in maintaining the viability (shelf-life) of the microorganisms prior to its release into the field as well as they also provide a suitable microenvironment for rapid growth of the organisms upon their release. A carrier could be a material, such as peat, vermiculite, lignite powder, clay, talc, rice bran, seed, rock phosphate pellet, charcoal, soil, paddy straw compost, wheat bran or a mixture of such materials. In common practice, for better shelf-life of biofertilizer formulation, a carrier or a mixture of such carrier materials are selected based on the viability of the microorganisms mixed with them. Similarly, pre-sterilization of the carrier material and its enrichment with nutrient is the other strategy to improve the shelf-life by allowing the microorganism to maintain/grow in a non-competitive microenvironment (Yardin et al., 2000). Sucrose, maltose, trehalose, molasses, glucose and glycerol are some supplementary nutrients and/cell protectants commonly used with a carrier material to ensure maximum cell viability and extended shelf-life. REFERENCES Adams DG, Bergman B, Nierzwicki-Bauer SA, Rai AN and Schussler A (2006). CyanobacterialPlant Symbioses. In: M Dworkin, S Falkow, E Rosenberg, KH Schleifer and Stackebrandt E (Eds.) The Prokaryotes. A Handbook on the Biology of Bacteria, Third edition. Vol. 1: Symbiotic Associations, Biotechnology, Applied Microbiology, Springer, New York, pp. 331-363 Ahemada M and Kibretb M (2014). Mechanisms and applications of plant growth promoting rhizobacteria: Current perspective. Journal of King Saud University - Science. 26(1): 1-20 Akhtar A, Hisamuddin Robab MI, Abbasi and Sharf R (2012). Plant growth promoting Rhizobacteria: An overview. J. Nat. Prod. Plant Resour. 2(1):19-31 Baker AL et al., (2012). Phyco*key - an image based key to Algae (PS Protista), Cyanobacteria, and other aquatic objects. University of New Hampshire Center for Fresh water Biology. Bapiri A, Asgharzadeh A, Mujallali H, Khavazi K and Pazira E (2012). Evaluation of Zinc solubilization potential by different strains of Fluorescent Pseudomonads. Journal of Applied Sciences and Environmental Management. 16(3): 295- 298 Becquer A, Trap J, Irshad U, Ali MA and Claude P (2014). From soil to plant, the journey of P through trophic relationships and ectomycorrhizal association. Front. Plant Sci. 5: 548 Brar SK, Sarma SJ and Chaabouni E (2012). Shelf-life of Biofertilizers: An Accord between Formulations and Genetics. J Biofertilizers Biopesticides. 3:e109

Bio-fertilizers

Burris RH (1994). Biological nitrogen fixation-past and future. In: Hegazi NA, Fayez M, Monib M, editors. Nitrogen fixation with non-legumes. Cairo, Egypt: The American University in Cairo Press;. pp. 1-11 Cardoso IM and Kuyper TW (2006). Mycorrhizas and tropical soil fertility. Agriculture. Ecosystems and Environment. 116 (1): 72-84 Deshwal VK and Chaubey A (2014). Isolation and Characterization of Rhizobium leguminosarum from Root nodule of Pisum sativum L. Journal of Academia and Industrial Research. 2(8): 464 Dixon ROD and Wheeler CT (1986). Nitrogen fixation in plants. Blackie Glasgow, United Kingdom. Fernandez LA, Zalba P, Gomez MA and Sagardoy MA (2007). Phosphate-solubilization activity of bacterial strains in soil and their effect on soybean growth under greenhouse conditions. Biology and Fertility of Soils. 43 6): 805-809 Godfray HCJ, Beddington JR, Crute IR, Haddad L, Lawrence D, Muir JF, et al., (2010). Food security: the challenge of feeding 9 billion people. Science. 327: 812-818 Karthikeyan A, Chandrasekaran K, Geetha M and Kalaiselvi R (2013). Growth esponse of Casuarina equisetifolia Forst. rooted stem cuttings to Frankia in nursery and field conditions. J. Biosci. 38: 741-747 Kuhad RC, Singh S, Lata and Singh A (2011). Phosphate-Solubilizing Microorganisms. In: Bioaugmentation, Biostimulation and Biocontrol, Singh A, Parmar N and Kuhad RC (Eds.). Springer Berlin Heidelberg. pp. 65-84 Lugtenberg BJJ, Malfanova N, Kamilova F and Berg G (2013). Plant growth promotion by microbes. In: de Brujn FJ (ed) Molecular microbial ecology of the rhizosphere. Wiley, Hoboken. vol. 2, pp. 561-573 Muraleedharan H, Seshadri S and Perumal K (2010). Booklet on Biofertilizer Phosphobacteria, Published by Shri AMM Murugappa Chettiar Research Centre, Taramani, Chennai, pp. 4-6 Naveke R (1986). Bacterial leaching of ores and other materials. Institut für Mikrobiologie, Technische Universitat. Obertello M, Sy MO, Laplaze L, Santi C, Svistoonoff S, Auguy F, Bogusz D and Franche C (2004). Actinorhizal nitrogen fixing nodules: infection process, molecular biology and genomics. African Journal of Biotechnology. 2(12): 528-538 Park KH, Lee OM, Jung HI, Jeong JH, Jeon YD, Hwang DY, Lee CY and Son HJ (2010). Rapid solubilization of insoluble phosphate by a novel environmental stress-tolerant Burkholderia vietnamiensis M6 isolated from ginseng rhizospheric soil. Applied microbiology and biotechnology. 86(3): 947-955 Parmar P and Sindhu SS (2013). Potassium Solubilization by Rhizosphere Bacteria: Influence of Nutritional and Environmental Conditions. Journal of Microbiology Research. 3(1): 2531 Peoples MB, Herridge DF, Ladha JK (1995). Biological nitrogen fixation: an efficient source of nitrogen for sustainable agricultural production. Plant Soil. 174:3-28 Rajkumar M, Vara Prasad MN, Freitas H and Ae N (2009). Biotechnological applications of serpentine soil bacteria for phytoremediation of trace metals. Critical Reviews in Biotechnology. 29(2): 120-130 Rana R, Ramesh and Kapoor P (2013). Biofertilizers and Their Role in Agriculture. Popular Kheti. 1(1): 56-61 Salhia BM (2010). The Effect of Azotobacter chrococcum as Nitrogen biofertilizer on the growth and yield of Cucumis Sativus. Botany Masters Thesis, The Islamic University- Gaza. Sethi SK, Sahu JK and Adhikary SP (2014). Microbial biofertilizers and their pilot-scale production. Microbial Biotechnology: Progress and Trends. 297. Sharma P, Kaur N and Garg K (2012). Revitalizing Soil Health with Bio-fertilizers. Biofertiliser News Letter. 20(2): 5-11 Sprent JI and Sprent P (1990). Nitrogen fixing organisms. Pure and applied aspects. Chapman and Hall, London, United Kingdom.

Microbes: In Action

Thiagalingam K, Silva JA and Fox RL (1977). Effect of calcium silicate on yield and nutrient uptake in plant growth on a humic ferriginous latosol. In: Proc. Conf. on chemistry and fertility of tropical soils. Kuallalumpur, Malaysia, Malaysian society of soil science. pp. 149-155 Yardin MR, Kennedy IR and Thies JE (2000). Development of high quality carrier materials for field delivery of key microorganisms used as bio-fertilisers and bio-pesticides. Radiation Physics and Chemistry. 57: 565-568 Zahran HH (1999). Rhizobium-legume symbiosis and nitrogen fixation under severe conditions and in an arid climate. Microbiology and molecular biology reviews. 63(4): 968989

CHAPTER 5 Plant Growth Promoting Rhizobacteria – An Environment Friendly Approach for Improving Plant Growth Ashish Sharma1 and Leena Parihar2 1

Botany Department, DAV University, Jalandhar-Pathankot highway, Jalandhar-144011 India Department of Botany, School of Biotechnology and Bioscience, Lovely Professional University, Phagwara, Punjab – 144411 India Corresponding author: [emailprotected]

INTRODUCTION Bacteria that colonize the rhizosphere and plant roots, and enhance plant growth by any mechanism are referred to as plant growth-promoting rhizobacteria (PGPR). PGPRs are characterized by the following distinctive features: firstly, they must be proficient to colonize the root surface and they must survive, multiply and compete with other microbiota, at least for the time needed to express their plant growth promotion/protection activities, and secondly, they must promote plant growth (Ahemad and Kibert, 2014). PGPR have been applied to various crops to enhance growth, seed emergence and crop yield, and some have been commercialized (Dey et al., 2004; Herman et al., 2008; Minorsky, 2008). Pseudomonas fluorescens B16 isolated from the roots of graminaceous plants has been shown to colonize the roots of various plants, and to increase the height, flower number, fruit number and total fruit weight of tomato plants (Minorsky, 2008). In another study PGPRs isolated and characterized from the rhizospheric soil of rice fields were shown to increase plant height, root length, and dry matter production of shoot and root of rice seedlings. Hence, it was suggested that the use of PGPR as inoculant biofertilizers might be beneficial for rice cultivation as they enhanced growth of rice, and induced IAA production and phosphorus solubilization (Ashrafuzzaman et al., 2009). To identify the plant growth promoting effect of Pseudomonas genera, Deshwal and Kumar, 2013 tested 140 different Pseudomonas isolates for plant growth promoting activity. They tested for IAA production, HCN production, siderophore production and phosphorus solubilisation activity. They demonstrated that 99 isolates produced IAA, 81 isolates produced HCN and 75 isolates produced siderophores and 95 isolates showed phosphorus solubilisation potential. Demonstration of these parameters clearly suggests the plant growth promoting activities of the used species. Moreover, the species used

Microbes: In Action

belonged to four species viz. P. putida, P. fluorescens, P. cepacia and P. aeruginosa. With rice, Azospirillum brasilense (James et al., 2000), Herbaspirillum seropedicae (Baldani et al., 2000), Burkholderia vietnamensis (Van et al., 2000; Baldani et al., 2000) and Rhizobium leguminosarum bv. trifolii (Yanni and ElFattah, 1999; Yanni et al., 2001) have all increased the yield of rice in field studies as a result of PGPR effects. With these results in mind Nguyen et al., 2003 prepared a biofertilizer from local isolates and observed that grain yield of rice increased in a three year trial and also that the total nitrogen uptake by the rice crop increased. They suggested that evidence of significant stimulation of early root and seedling growth and of panicle numbers and seeds per panicle as a result of applying biofertiliser is clear and use of PGPR is an attractive strategy for increasing rice production and quality (Nguyen et al., 2003). Plant growth promoting rhizobacteria affect plant in many ways (table 2), which can be classified under direct plant growth promotion or indirect plant growth promotion. Direct plant-growth-promoting rhizobacteria enhance plant growth in the absence of pathogens. The effects shown by such bacteria fall under the following classes: 1. Biofertilizers: some rhizobacteria promote plant growth in the absence of pathogen pressure. The bacteria that can be used as biofertilizers are symbiotic nitrogen fixing bacteria Rhizobium and Bradyrhizobium (Van and Vanderlayden, 1995); free living nitrogen fixing bacteria Azospirillum (Okon et al., 1998) and some bacteria that can solubilize phosphorus and support plant growth (Vassilev et al., 2006). 2. Rhizoremidiators: this strategy involves the selection of pollutant-degrading rhizobacteria that live on, or are close to, the root so that they can use root exudate as their major nutrient source, and application of these bacteria along with their host plant to remove the pollutant from the soil (Kuiper et al., 2001). 3. Phytostimulators: some bacteria produce substances that stimulate the growth of plants in the absence of pathogens. The best understood example is the hormone auxin. In addition, other hormones as well as certain volatiles and the cofactor pyrrolquinoline quinone (PQQ) produced by the bacteria help stimulate plant growth (Lugtenberg and Kamilova, 2009). 4. Stress controllers: plant growth promoting bacteria that contain the enzyme 1-aminocyclopropane-1-carboxylate (ACC) deaminase facilitate plant growth and development by decreasing plant ethylene levels. Such bacteria take up the ethylene precursor ACC and convert it into 2-oxobutanoate and NH3. Several forms of stress are blocked by ACC deaminase producers, such as effects of phytopathogenic bacteria, and resistance to stress from polyaromatic hydrocarbons, from heavy metals such as Ca2+ and Ni2+, and from salt and draught (Glick et al., 2007). However, indirect control of the plant growth mainly involves the action of PGPRs in the form of biocontrol agents. The use of microbes to control diseases, which is a form of biological control, is an environment-friendly approach. The microbe is a natural enemy of the pathogen, and if it produces secondary metabolites, it does so only locally, on or near the plant surface, i.e., the site where it should act (Lugtenberg and Kamilova, 2009).

Plant Growth Promoting Rhizobacteria

TABLE 1: Different plant growth promoting rhizobacteria and their modes of action Bacterial inoculants

Mode of action

Bacillus sp. RM2 IAA production, Phosphorus solubilization Enterobacter sp. RNF267 IAA production, phosphorus solubilization, ACC deaminase activity, ammonia production Klebsiella pneumoniae IAA production, phosphorus solubilization, ACC KiSII deaminase activity, ammonia production, siderophore production Herbaspirillum sp. Indole like compounds, phosphorus solubilization, siderophore production Acinetobacter Indole like compounds, phosphorus solubilization, siderophore production Pseudocidovorax sp Indole like compounds, phosphorus solubilization, siderophore production Bacillus pumilus ACC deaminase activity, IAA production, phosphorus solubilization, phytate mineralization, siderophore production Pseudomonas IAA production, siderophore production, HCN fluorescens production Pseudomonas sp. Siderophore production Bacillus subtilis Siderophore production, IAA production, antifungal activity Paenibacillus polymyxa Siderophore production, IAA production, antifungal activity Pseudomonas Siderophore production aeruginosa 4EA Azospirillum IAA production, nitrogenase activity amazonense Serratia marcesens IAA production, siderophore production, HCN production Glucanacetobacter Zn solubilization diazotropicus Bravibacterium sp Siderophore production Enterobacter sp Siderophore production

Reference Minaxi et al., 2012 George et al., 2013 George et al., 2013

Souza et al., 2012 Souza et al., 2012 Souza et al., 2012 Gururani et al., 2012

Meera and Balabaskar, 2012 Rajkumar et al., 2005 Loon, 2007 Loon, 2007 Naik and Dubey, 2011 Rodrigues et al., 2008 Selvakumar et al., 2008 Saravanan et al., 2007 Noordman et al., 2006 Sharma et al., 2013

Several chemical changes in soil are associated with plant growth-promoting rhizobacteria (PGPR). Some bacterial strains directly regulate physiology by mimicking synthesis of plant hormones, whereas others increase mineral and nitrogen availability in the soil as a way to augment growth. Identification of bacterial chemical messengers that trigger growth promotion has been limited due mainly to the lack in knowledge about how plants respond to external stimuli. It was proved in a series of experiments that some PGPRs release a blend of volatile components that promote growth of Arabidopsis thaliana. In their study the volatile components 2,3-butanediol and acetoin were released exclusively from two bacterial strains that trigger the greatest level of growth promotion. This demonstration that PGPR strains released different volatile blends that influenced plant growth established volatile organic compounds as signaling molecules mediating plant–microbe interactions (Ryu et al., 2003).

Microbes: In Action

In another study four potential phosphate solubilizing bacteria were isolated from non rhizospheric soils. Under in vitro conditions, all the four isolates were found to produce indole acetic acid, solubilized phosphorus and also produced hydrogen cyanide. The plant growth promotion was demonstrated using cow pea. Root length and shoot length of the treated plants increased by 1.5 times that of control. Dry mass of the seedlings doubled and the diameter of the leaves also increased in the host plants after treatment with the bacteria demonstrating the plant growth promoting activity of the isolated bacteria (Deepa et al., 2010). BIOFERTILIZERS

FIG 1: Different methods by which the beneficial microbes can help the plants to show vigorous growth. (adopted from Pineda et al., 2010)

PGPRs and Plant Growth Promotion Application of plant growth-promoting rhizobacteria (PGPR) has been shown to increase growth and development of many crops under field and controlled environmental conditions. In this regard five bacterial isolates were isolated and tested for IAA production, P solubilization and plant growth promoting activities. The isolated strains were found to enhance root and shoot dry matter by more than 50% in treated lentil plants. Besides number of pods per plant, 1 000-grain weight, dry matter yield and grain yield was also found to be higher in treated plants in comparison to control. The bacterial strains also led to an increase in the uptake of N and P by the treated plants and this uptake was positively correlated to the root dry matter production (Zafar et al., 2012). In another study a rhizobacterial isolate RM-2 was characterized and identified to be belonging to Bacillus sp. and its plant growth promoting attributes were tested both in laboratory and field conditions. The isolate possessed activities such as P solubilization, ACC deaminase activity, antifungal activity, ammonia and IAA production. The isolate positively influenced the growth and nutrient uptake of cowpea plants. Inoculated plants showed higher

Plant Growth Promoting Rhizobacteria

seed germination, shoot and root length, fresh weight, dry weight and leaf area. Yield of the treated plants was also found to be significantly higher in comparison to the uninoculated control plants (Minaxi et al., 2012) Those bacterial endophytes that also provide some benefit to plants may be considered to be plant growth promoting bacteria (PGPB). In an experiment bacterial endophytes with such properties were isolated from the soil samples collected from all around the world. Most of the bacteria under study belonged to Pseudomonas and Microbacterium genera. All the selected isolates possessed ACC deaminase activity, produced IAA, siderophores and NH3. They were shown to solubilize P and Fe in lab conditions and in a bioassay for measuring their effect on root length, root length of the treated plants was found to be considerably increased (Rashid et al., 2012). In another investigation three plant growth promoting bacteria strains viz. Pseudomonas, A. brasilense and Serratia were used to study the phosphate uptake and growth promotion in rice plants. All the isolates were demonstrated to be P solubilizers in vitro, upon inoculation root length, shoot length, shoot phosphate content and yield of the treated plants was found to be considerably increased, hence, it was reported that selected bacteria can be used to enhance P uptake and growth of the rice plants (Nico et al., 2012). In another study instead of bacterial and fungal inoculants, yeast was used to test whether it promoted rice growth or not. In the experiment yeast culture was found to produce IAA, ACC deaminase, polyamines, phytase and to solubilize P. It was also demonstrated to colonize the plant roots. Upon inoculation root length and shoot length was found to be increased by 15% and 30% respectively. Root and shoot dry weight of the treated plants was also found to be significantly higher for plants treated with the yeast inoculants in comparison to the control (Amprayn et al., 2012). In another experiment the response of three rice cultivars to PGPB inoculation under field conditions was studied. PGPB inoculation increased aerial biomass production, harvest index, and grain yield of the Supremo 13 cultivar by 4.7%, 16%, and 20.2%, respectively. Inoculation of the Yerua cultivar increased aerial biomass by 1.9% and grain yield by 11%. On the other hand, control plants of the Camba INTA cultivar produced 8.7% and 7.3% more aerial biomass and grain yield than inoculated plants, respectively. Inoculation reduced the percentage of chaffy grains of the three rice cultivars. The results indicate that the combined inoculation with P. fluorescens and A. brasilense has significant potential when applied to rice (Salamone et al., 2012). In another experiment one bacterial and three cyanobacterial strains were used to inoculate wheat plants and its effect on growth, yield and micronutrient content of the inoculated plants was studied. It was observed that grain yield, total biomass, 1000 grain weight was significantly higher in the treated plants and the values for harvest index showed an increase of upto 20% in comparison to the control. Among the micronutrients, Zn was found statistically at par to the control, however, Fe, Cu and Mn showed an increase of upto 105%, 150% and 37% respectively. Hence it was concluded that the inclusion of PGPR in the existing biofortification strategies is essential considering the scenario of micronutrient malnutrition worldwide (Rana et al., 2012).

Microbes: In Action

Two bacterial isolates belonging to Pseudomonas fluorescens and Pseudomonas putida were evaluated for growth and nutrient uptake in various crops. It was found that both the inoculants produced IAA and promoted growth individually and in combination. Yield of the wheat plants was shown to be increased by almost 20% and in soybean by almost 25%. Uptake of Fe, Zn, Cu, Mn, Ca etc. was found to be increased by 30%, 41%, 26%, 35% and 50% respectively in wheat and soybean plants under treatment. Hence the use of PGPRs can be developed into an potential strategy for increasing yield and micronutrient content in the economically important crops (Shabayev, 2012). In another experiment a number of bacteria were isolated and tested for plant growth promotion activities in rice. Out of around 300 bacteria l isolates 5 were tested in field and the results obtained showed that the bacterial inoculants increased the shoot length and shoot dry matter by almost 25% while an increase of around 30% was found in root length and dry matter. Moreover, number of panicle and yield of the rice plants was found to be almost doubled in field conditions in comparison to the control. Also the isolates promoted the increased uptake of N, P and K by the treated rice plants (Souza et al., 2012). In another experiment bacteria isolated from rice rhizosphere were tested for increasing the growth and yield of the rice plants. Upon inoculation the root length, shoot length, root dry weight and shoot dry weight showed a significant increase in comparison to the control plants. Chlorophyll a and b content showed an increase of upto more than 60% in rice plants, 30 days after transplanting. Bacterial inoculation also helped the rice plants to withstand and cope up with the artificially inflicted salt stress at the flowering stage, hence incorporation of PGPRs in rice cultivation can be a huge boon to the current production trends (Bal et al., 2012). Plant Growth Promoting Rhizobacteria and Biocontrol 'Suppressive soils' soils that inhibit the growth of bacteria and fungi having phytotoxic effects on beneficial plant populations, contain rhizobacteria that are able to control plant diseases that are caused by these fungi or bacteria. Many different types of mechanisms have been identified for biocontrol activity which includes competition for nutrients, niche exclusion, induced systemic resistance (ISR), and the production of anti-fungal metabolites (AFMs). The biocontrol agents that are best-characterized at the molecular level belong to the genus Pseudomonas. Many agricultural practices are also important for providing control of some plant diseases. In natural systems plant pathogens co-exist with host plants and other microorganisms, therefore, biological control means any reduction in the incidence and severity of the pathogen achieved through any biological mechanism. Disease control that is obtained through the action of naturally occurring or introduced antagonists, that occurs by manipulating the microenvironment to favor the activity of antagonists or that is achieved through the induction of plant resistance mechanisms by non-pathogenic or incompatible micro-organisms, are all examples of biological control. Microbial antagonism of plant pathogens occurs in several ways, the most common mechanisms being parasitism and predation, competition for nutrients

Plant Growth Promoting Rhizobacteria

or space, production of antimicrobial substances and induced resistance. As our knowledge of these mechanisms has increased, it has become apparent that antagonism often involves the synergistic action of several mechanisms. Competition for Nutrients and Space All organisms require nutrients and space for their comfortable growth, but many different types of microorganisms can occupy same space and will require same type of nutrients for their growth leading to competition. The organism which is able to utilize lesser space well, or is able to grow comfortably with less nutrients usually overgrow other microorganisms thus obliterating them from the space. A soil-borne pathogen which infects only certain parts of the root may therefore be limited by competition for suitable colonisable sites or space on the root surface. The rhizosphere is a region with high microbial activity, due to the production of many different types of metabolites as root exudates. This competition for nutrients also results in competition for oxygen. However, on the leaf surface, where nutrients are in short supply, competition for nutrients is thought to play a significant role in disease suppression. Competition for the same site is sometimes called 'site exclusion' and frequently takes place amongst organisms which are closely related taxonomically (e.g. the fireblight bacterium Ertutnia amglouora and the saprophytic species E. herbicola). In the case of competition for nutrients the situation is similar. Antagonists with the same nutrient requirements as the pathogen are its most effective competitors. One of the best documented examples of nutrient competition in biological control involves competition for iron between fluorescent pseudomonads and soilborne fungal pathogens such as (Fusarium oxysporum). Bacteria like Pseudomonas fluorescens and P. putida produce siderophores, which bind iron and facilitate its transport from the environment into the microbial cell. The siderophores pyoverdine and pseudobactin have a high affinity for the soluble ferric iron (Fe3+) and inhibit the growth of pathogens by making iron unavailable to them. The applicability of nutrient competition for biological control depends on the type of pathogen that is targeted. It may not be useful in suppressing biotrophs (obligate parasites) such as rusts and powdery mildews because they do not require exogenous nutrients to infect the host. On the other hand, a nectrotrophic pathogen such as Botrytis cinerea is directly affected. Such pathogens require some exogenous nutrients during a definite saprophytic phase prior to infecting the host and are therefore vulnerable to nutrient competition. Parasitism and Predation Parasitism is a type of relationship in which one organism depends on other organism for nutrients and growth and in turn harms the other organism. The parasitism of one fungus by another (hyperparasitism or mycoparasitism) is well documented and different steps involved are morphological disturbance, direct penetration of hyphae and hyphal lysis. Environmental factors like temperature, pH, light, nutrient status, C:N ratio have diverse effects on hyperparasitism. The genus Trichoderrna contains some of the most studied mycoparasites. Formulations of some species are available commercially and are used to control

Microbes: In Action

fungal pathogens in the soil and on aerial plant surfaces. This mycoparasite penetrates resting structures such as sclerotia or may parasitise growing hyphae by coiling round them. Trtchoderma harzianum degrades fungal cell walls by the lytic action of glucanases and chitinases, while other species also produce cellulase. Trichoderma species are amenable to genetic manipulation and their usefulness in integrated disease management programs has been enhanced by the production of pesticide-tolerant strains with enhanced hyperparasitic and lytic capabilities. Other widely studied mycoparasites include Coniothgrium minitans and Sporidesmium sclerotiorum, which are antagonists of sclerotial fungi, and Gliocladium spp., which parasitise a range of soil-borne pathogens. Mycoparasitic Pythium spp. appear to have some affinity for plant-parasitic members of the same genus. On the phylloplane, several fungi, including Verticittium lecanii, Sphaerellopsis filum and Cladosporium sp., are known to attack rust fungi. Cross Protection and Induced Resistance It is difficult to distinguish clearly between cross protection and induced resistance. In cross protection, an organism which first arrives at an infection site acts directly or indirectly against a pathogen that arrives later. For example, symptomless strains of tobacco mosaic virus are used to protect tomatoes from virulent strains of the same virus. One of the best known examples of cross protection involves inoculation of young citrus trees in the nursery with a mild strain of tristeza virus (mild strain protection). Inoculated trees are protected from later infection by the more virulent strain and this protection will last for many years. Induced resistance which is a form of cross protection, is achieved by restricted inoculation of plants with pathogens, attenuated pathogens (e.g. pathogens inactivated by heat treatment) or selected non-pathogens or by treatment with chemical substances which stimulate an immune response. Host defence mechanisms recognise and respond to this perceived threat so that they are already operating when the pathogen subsequently attacks. The nature of the immune response is poorly understood, but the concept is not new and it provides protection against a broad spectrum of pathogens across many crop species including cereals, cucurbits, legumes, solanaceous plants and fruit trees. For instance, seedlings can be protected from wilt-inducing strains of Fusarium oxysporum by prior inoculation with non-pathogenic strains. However, the protection is not complete and impractically high quantities of the protectant are required for success. Inoculation of cucurbits with Colletotrichum lagenarium or tobacco necrosis virus systemically protects plants against disease caused by numerous pathogens. Infiltration of leaves with heat-killed cells of the bacterium Ralstonia solanacearum can give protection against the virulent pathogen. In this case some type of inhibitor is thought to be induced in response to the recognition of dead cells. PGPRS AND NUTRIENT AVAILABILITY Besides the conventional breeding, fertilization and transgenic approaches, an approach that has been less widely known since recent times and very less explored for the accumulation of zinc and iron in the crop plants is the use of

Plant Growth Promoting Rhizobacteria

iron and zinc solubilizing plant growth promoting rhizobacteria. Some examples of bacteria that have been used for the accumulation, uptake and enhancement of micronutrients in different cereal grains are presented in table 3. In one such report application of PGPR alleviated the deficiency symptoms of zinc and invariably increased the total biomass (23%), grain yield (65%) and harvest index as well as the Zn concentration in the grains. The selected PGPR strains can serve as efficient solubilizers of zinc, allowing farmers to avoid the use of costly chemical zinc fertilizer in rice crop (Tariq et al., 2007). TABLE 2: Some bacteria used as inoculants for micronutrient enhancement in different crops. S. No.

PGPR strain

Methylobacterium oryzae Azospirillum brasilense

Providencia sp.

Pseudomonas sp.

Trichoderma

AMF

7 8

Enterobacter Pseudomonas putida

Chryseobacterium sp. Pseudomonas fluorescens Bacillus amyloliquifaciens

Bacillus sp.

Bacillus aryabhattai

Element Crop in which enhanced effect is reported Mn Zn Cu Fe Fe Zn Mn Cu Zn Fe Fe Zn Fe Zn Cu Mn Zn Fe Fe Zn Cu Fe Zn Zn Fe Mn Cu Zn Mg Fe Zn

Rice

Wheat

Maize Lentil Wheat

Red pepper Rice Vicia faba Tomato

Soya bean

Maize

Soya bean

Level of Reference enhancement 3.8% 11.3% 45.3% 38.4% 4 times 1.5 times 2.2 times 3 times 4 times 1.5 times 2 times 2 times 1.5 times 1.6 times 1.4 times 1.2 times 1.5 times 1.2 times 1.8 times 3 times 2 times 1.5 times 1.2 times 1.2 times 1.5 times 1.3 times 1.2 times 1.8 times 1.3 times 1.8 times 1.4 times

Madhiyan et al., 2010

Rana et al., 2012

Shabayev et al., 2012 Mishra et al., 2011 Santiago et al., 2010

Kim et al., 2010 Sharma et al., 2013 El-Ghany et al., 2013 Radzki et al., 2013

Sharma et al., 2013

Goteti et al., 2013

Ramesh et al., 2014

Microbes: In Action

S. No.

PGPR strain

13 14

Burkholdria sp. Enterobacter intermedis

Element Crop in which enhanced effect is reported Fe Fe Zn

Wheat Maize Sinapis alba

Level of Reference enhancement 1.9 times 1.3 times 1.5 times 1.4 times

Arruda et al., 2013 Plociniczak et al., 2013

Besides for zinc and iron PGPR have been used for the solubilization and uptake of other minerals in crops other than rice. Like in a review published by Richardson et al., 2009 they documented the use of PGPR strains for the uptake of nitrogen and phosphorus by a variety of crops. In another report published by Redon et al., 2009 they documented the use of AM fungi in Medicago tranculata and reported that inoculation with AM fungi resulted in increased uptake of metals like Cd, Zn, etc. However, in the developing field of PGPRs still the reports regarding the use of selected PGPR strains for growth enhancement and Zn and Fe uptake remain scarce. Microbial associations with roots are complex in soil and can enhance the ability of plants to acquire nutrients from soil through a number of mechanisms. These include; 1. An increase in the surface area of roots by either a direct extension of existing root systems (e.g. mycorrhizal associations) or 2. By enhancement of root growth, branching and/or root hair development (e.g. through plant growth promoting rhizobacteria), 3. A direct contribution to nutrient availability though either N fixation (e.g. rhizobia and diazotrophs) or by stimulation and/or contribution to metabolic processes that mobilize nutrients from poorly available sources (e.g. organic anions) or, an indirect effect on nutrient availability by secretion of siderophores. 4. Displacement of sorption equilibrium that results in increased net transfer of nutrients into solution and/or as the mediators of transformation of nutrients between different pools (e.g. nitrification inhibitors and microbialmediated processes that alter the distribution of nutrients between inorganic and organic forms) or 5. Through the turnover of microbial biomass within rhizosphere (Richardson 2007; Richardson et al., 2009). Keeping all these points in mind we conducted a research to explore the effect of PGPR inoculation on the rice growth and micronutrient content. From the results obtained it was evident that inoculation of rice plants with PGPRs enhanced the micronutrient level of rice plants as well as grains. To assess the level of Zn and Fe uptake in rice plants, levels of superoxide dismutase and carbonic anhydrase (physiological markers for Zn enhancement) and catalase and peroxidise (physiological markers for Fe enhancement) were estimated. Moreover, Fe and Zn contents in roots and shoots of rice plants were also estimated using atomic absorption spectroscopy. Increase Fe and Zn levels positively correlated with the enhanced enzyme concentration, which showed that increase in Fe content of leaf, increases the content and activity of CAT and

Plant Growth Promoting Rhizobacteria

POD enzymes, i.e. plant positively respond to the increased level of Fe by the action of PGPR application. Similar was reported for the Zn uptake in plants. Besides these localization of Fe and Zn in the rice grains was studied by DTZ and Prussian blue staining reactions for Zn and Fe respectively. Staining of Zn and Fe in grains (Fig. 1 & 2) revealed that treatments P. putida, B 17 and BN 30 primarily showed deposition of Fe and Zn in aleurone layer of the rice grains, while the treatments P. fluorescens, A. lipoferum, B 19 and BN 17 showed deposition in both aleurone and endosperm whereas, only B 15 showed total localization of Fe and Zn in the endosperm portion of the rice grains obtained from the treated plants. The said isolates i.e. B 17, BN 30, B 19, BN 17 and B 15 were found to belong to Enterobacter sp., and were highly active in increasing the content of Fe and Zn in higher plants.

FIG 1: Localization of iron (blue) and zinc (pink) in the grains of three genotypes of rice under the influence of treatment by B 15 after harvest.

Microbes: In Action

FIG 2: Localization of iron (blue) and zinc (pink) in the grains of three genotypes of rice in the untreated control after harvest.

Iron (Fe) is an essential element for plant growth and development. Some plant growth-promoting rhizobacteria can increase Fe uptake by plants through reduction of Fe(III) to Fe(II) at the root surface. Novel bacterial strains with high Fe(III) reduction ability were isolated and their role in plant Fe uptake was evaluated. In the study, four bacterial strains (UMCV1 to UMCV4) isolated from rhizosphere of bean and maize plants showed Fe reducing activity. All four isolates showed Fe reduction to an order of upto 3-6 fold higher in comparison to uninoculated soil in non-flooded conditions and also the bacterial isolates showed almost 2-3 fold increase in the Fe uptake by the roots when associated with roots of bean plants grown in alkaline soil or in mineral medium. In addition, the bacterial isolates were able to stimulate plant growth in vitro and on a broad level, plants grown in inoculated soil were generally bigger and with higher Fe content than those grown in sterilized soil (Cantero et al., 2007). Above assertions have provided an exclusive picture that application of PGPRs to seeds and/or roots of plants have the potential to increase the nutrient

Plant Growth Promoting Rhizobacteria

content of the plants on a whole. In a similar type of experiment this was proven to be true for mycorrhizal fungi. Maize was used as experimental material and treatments were composed of inoculated and un-inoculated plants. A significant increase in the root and shoot dry mass, root cation exchange capacity, root, shoot and grain P and Zn content in the plants treated with mycorrhiza was observed in comparison to the un-inoculated plants (Subramanian et al., 2008). In another study to access the role of PGPRs on nutrient uptake two rhizospheric Pseudomonas spp. were taken and their bioassociative effect with root nodulating symbiotic nitrogen fixer Rhizobium leguminosarum-PR1 on plant growth and nutrients uptake by lentil (Lens culinaris L.), was studied under greenhouse conditions. In Pseudomonas treated plants more vigorous vegetative growth with increase in nodulation, leghaemoglobin content, physiologically available iron, total iron, chlorophyll content, P uptake and N uptake was observed. Coinoculation of Pseudomonas with R. leguminosarum recorded maximum increase in the nodulation, leghaemoglobin content, total iron, total chlorophyll content, N uptake and P uptake over the plants treated with R. leguminosarum alone suggesting a strong synergistic relationship between Pseudomonas sp. and R. leguminosarum (Mishra et al., 2011). Rhizosphere microbes can enhance nutrient uptake by plants. Hence, the effect of Trichoderma asperellum inoculation on the uptake of Fe, Cu, Mn, and Zn by wheat (Triticum aestivum L) was studied. The treatment of wheat plants with T34 has resulted in an increase in the Fe, Cu, Mn and Zn contents in the aerial parts of the plants resulting in almost 50% increase in the concentration of the micronutrients in comparison to the control, providing yet another evidence that PGPR application can result in increasing the concentration of various micronutrients in aerial parts of cereal crops (Santiago et al., 2010). In another experiment Methylobacterium oryzae and three arbuscular mycorrhizal (AM) fungi were evaluated for nutrient uptake on red pepper (Capsicum annum L.). The co-inoculation of M. oryzae and AM fungi significantly increased various plant growth parameters like root and shoot length, fresh and dry weight and chlorophyll content compared to uninoculated controls. Also nitrogen and phosphorus content of the plants increased, besides these Zn, Cu, Fe and Mn content of the inoculated plants also increased by almost 1.5 times that of uninoculated control in most of the inoculation treatments. The results obtained suggest that apart from affecting plant growth and nutrient uptake individually, microorganisms can also form mutualistic relationships thereby benefiting the plant (Kim et al., 2010). CONCLUSION Plant growth promoting rhizobacteria are a group of bacteria that normally colonize the roots of higher plants and exhibit their effects either by direct growth promotion or indirect growth promotion. These bacteria can show their effect by production of phytohormones, acting as biofertilizers, fixing nitrogen, making the micronutrients available to the plants, controlling potential pathogens, antibiosis and competition. Alongside these effects, these bacteria also enhance the crop production and yield. Owing to the variety of effects these bacteria exhibit and the regulation of plant growth they demonstrate their use

Microbes: In Action

should be popularized in the modern agriculture, as this strategy can be the harbinger of the second green revolution which is the need of the hour. REFERENCES Ahemad M and Kibert M (2014). Mechanisms and applications of plant growth promoting rhizobacteria: Current perspective. J. King Soud Univ. 26: 1-20 Amprayn K, Rose MT, Kecskes M, Pereg L, Nguyen HT and Kennedy IR (2012). Plant growth promoting characteristics of soil yeast (Candida tropicalis HY) and its effectiveness for promoting rice growth. App. Soil Ecol. 61: 295- 299 Arruda L, Beneduzi A, Martins A, Lisboa B, Lopes C, Bertolo F, Passaglia LMP and Vargas LK (2013). Screening of rhizobacteria isolated from maize (Zea mays L.) in Rio Grande do Sul State (South Brazil) and analysis of their potential to improve plant growth. App. Soil Ecol. 63: 15-22 Ashrafuzzaman M, Hossen FA, Ismail MR, Hoque MA, Islam MZ, Shahidullah SM and Meon S (2009). Efficiency of plant growth promoting rhizobacteria (PGPR) for the enhancement of rice growth. Afr. J. Biotechnol. 8: 1247-1252 Bal HB, Nayak L, Das S and Adhya TK (2012). Isolation of ACC deaminase producing PGPR from rice rhizosphere and evaluating their plant growth promoting activity under salt stress. Plant Soil. DOI 10.1007/s11104-012-1402-5 Baldani VLD Baldani JI and Dobereiner J (2000). Inoculation of rice plants with the endophytic diazotrophs Herbaspirillum seropedicae and Burkholderia spp. Biol. Fertility Soils. 30: 485-491 Cantero EV, Calderon EH, Becerra CV, Meza JEL, Cuevas RA and Bucio JL (2007). Role of dissimilatory fermentative iron-reducing bacteria in Fe uptake by common bean (Phaseolus vulgaris L.) plants grown in alkaline soil. Plant Soil. 291: 263-273 Deepa CK, Dastager SG and Pandey A (2010). Isolation and characterization of plant growth promoting bacteria from non-rhizospheric soil and their effect on cowpea (Vigna unguiculata (L.) Walp.) seedling growth. World J Microbiol Biotechnol. 26: 1233-1240 Dey R, Pal KK, Bhatt DM and Chauhan SM (2004). Growth promotion and yield enhancement of peanut (Arachis hypogaea L.) by application of plant growth-promoting rhizobacteria. Microbiol. Res. 159: 371-394 El-Ghany MFA, Mahmoud SA and Attia M (2013). Synergistic effect between Pseudomonas putida and arbuscular mycorrhizal fungi on Vicia faba L. growing in heavy metals polluted soil. J. App. Sci. Res. 9: 4397-4403 George P, Gupta A, Gopal M, Thomas L and Thomas GV (2013). Multifarious beneficial traits and plant growth promoting potential of Serratia marcescens KiSII and Enterobacter sp. RNF 267 isolated from the rhizosphere of coconut palms (Cocos nucifera L.). World J. Microbiol. Biotechnol. 29: 109-117 Glick BR, Cheng Z, Czarny J and Duan J (2007). Promotion of plant growth by ACC deaminase-producing soil bacteria. Eur. J. Plant Pathol. 119: 329-339 Goteti PK, Emmanuel LDA, Desai S and Shaik MHA (2013). Prospective Zinc Solubilising Bacteria for Enhanced Nutrient Uptake and Growth Promotion in Maize (Zea mays L.). Indian J. Microbiol. http://dx.doi.org/10.1155/2013/869697. Gururani MA, Upadhyaya CP, Baskar V, Venkatesh J, Nookaraju A and Park SW (2012). Plant growth-promoting rhizobacteria enhance abiotic stress tolerance in Solanum tuberosum through inducing changes in the expression of ros-scavenging enzymes and improved photosynthetic performance. J. Plant Growth Regul. DOI 10.1007/s00344-012-9292-6 Herman MAB, Nault BA and Smart CD (2008). Effects of plant growth promoting rhizobacteria on bell pepper production and green peach aphid infestations in New York. Crop Protect. 27: 996-1002 James EK, Gyaneshwar P, Barraquio WL, Mathan N and Ladha JK (2000). Endophytic diazotrophs associated with rice. In: The Quest for Nitrogen Fixation in Rice. Ladha, JK and Reddy PM, eds. International Rice Research Institute, Los Baños, Philippines, pp. 119-140

Plant Growth Promoting Rhizobacteria

Kim K, Yim W, Trivedi P, Madhaiyan M, Boruah HPD, Islam MR, Lee G and Sa T (2010). Synergistic effects of inoculating arbuscular mycorrhizal fungi and Methylobacterium oryzae strains on growth and nutrient uptake of red pepper (Capsicum annuum L.). Plant Soil. 327: 429-440 Kuiper I, Bloemberg GV and Lugtenberg BJJ (2001). Selection of a plant-bacterium pair as a novel tool for rhizostimulation of polycyclic aromatic hydrocarbon-degrading bacteria. Mol. Plant Microbe Interact. 14: 1197-205 Loon LCV (2007). Plant responses to plant growth-promoting rhizobacteria. Eur. J. Plant Pathol. 119: 243-254 Lugtenberg B and Kamilova F (2009). Plant Growth Promoting Rhizobacteria. Annu. Rev. Microbiol. 63: 541-56 Madhaiyan M, Poonguzhali S and Sa T (2007). Metal tolerating methylotrophic bacteria reduces nickel and cadmium toxicity and promotes plant growth of tomato (Lycopersicon esculentum L.). Chemosphere. 69: 220-228 Meera T and Balabaskar P (2012). Isolation and characterization of pseudomonas fluorescens from rice fields. International J. Food Agric. Vet. Sci. 2: 113-120 Minaxi NL, Yadav RC and Saxena J (2012). Characterization of multifaceted Bacillus sp. RM-2 for its use as plant growth promoting bioinoculant for crops grown in semi arid deserts. App. Soil Ecol. 59: 124- 135 Minorsky PV (2008). On the inside. Plant Physiol. 146: 323-324 Mishra PK, Bisht SC, Ruwari P, Joshi GK, Singh G, Bisht JK and Bhatt JC (2011). Bioassociative effect of cold tolerant Pseudomonas spp. and Rhizobium leguminosarum-PR1 on iron acquisition, nutrient uptake and growth of lentil (Lens culinaris L.). Europ. J. Soil Biol. 47: 35-43 Naik MM and Dubey SK (2011). Lead-enhanced siderophore production and alteration in cell morphology in a Pb-resistant Pseudomonas aeruginosa strain 4EA. Curr Microbiol. 62: 409414 Nguyen HT, Deaker R, Kennedy IR and Roughley RJ (2003). The positive yield response of field-grown rice to inoculation with a multi-strain biofertiliser in the hanoi area, Vietnam. Symbiosis. 34: 1-15 Nico M, Ribaudo CM, Gori JI, Cantore ML and Cura JA (2012). Uptake of phosphate and promotion of vegetative growth in glucose-exuding rice plants (Oryza sativa) inoculated with plant growth-promoting bacteria. App. Soil Ecol. 61: 190-195 Noordman WH, Reissbrodt R, Bongers RS, Rademaker ILW, Bockelmann W and Smit G (2006). Growth stimulation of Brevibacterium sp. by siderophores. J. Appl. Microbiol. 101: 637-646 Okon Y, Bloemberg GV and Lugtenberg BJJ (1998). Biotechnology of biofertilization and phytostimulation. In Agricultural Biotechnology, ed. A Altman, pp. 327–49. New York: Marcel Dekker Pineda A, Zheng SJ, Loon JJA, Pieterse CMJ and Dicke M (2010). Helping plants to deal with insects: the role of beneficial soil-borne microbes. Trends Plant Sci. 15: 507-514 Plociniczak T, Sinkkonen A, Romantschuk M and Seget SP (2013). Characterization of Enterobacter intermedius MH8b and its use for the enhancement of heavy metals uptake by Sinapis alba L. App. Soil Ecol. 63: 1-7 Radzki W, Manero FJG, Algar E, Garcia JAL, Villaraco AG and Solano BR (2013). Bacterial siderophores efficiently provide iron to iron-starved tomato plants in hydroponics culture. Antonie van Leeuwenhoek. 104: 321-330 Rajkumar M, Lee KJ, Lee WH and Banu JR (2005). Growth of Brassica juncea under chromium stress: influence of siderophores and indole-3-acetic acid producing rhizosphere bacteria. J. Environ. Biol. 26: 693-699 Ramesh A, Sharma SK, Sharma MP, Yadav N and Joshi OP (2014). Inoculation of zinc solubilizing Bacillus aryabhattai strains for improved growth, mobilization and biofortification of zinc in soybean and wheat cultivated in Vertisols of central India. App. Soil Ecol. 73: 87-96

Microbes: In Action

Rana A, Joshi M, Prasanna R, Shivay YS and Nain L (2012). Biofortification of wheat through inoculation of plant growth promoting rhizobacteria and cyanobacteria. Europ. J. Soil Biol. 50: 118-126 Rashid S, Charles TC and Glick BR (2012). Isolation and characterization of new plant growth-promoting bacterial endophytes. App. Soil Ecol. 61: 217- 224 Redon PO, Beguiristain T and Leyval C (2009). Differential effects of AM fungal isolates on Medicago truncatula growth and metal uptake in amultimetallic (Cd, Zn, Pb) contaminated agricultural soil. Mycorrhiza. 19: 187-195 Richardson AE, Barea JM, McNeill AM and Combaret CP (2009). Acquisition of phosphorus and nitrogen in the rhizosphere and plant growth promotion by microorganisms. Plant Soil. 321:305-339 Richardson AE, George TS, Jakobsen I and Simpson RJ (2007). Plant utilization of inositol phosphates. In: Turner BL, Richardson AE, Mullaney EJ (eds) Inositol phosphates: linking agriculture and the environment. CABI, Wallingford, UK, pp 242-260 Rodrigues EP, Rodrigues LS, de Oliveira ALM, Baldani VLD, Teixeira KRS, Urquiaga S and Reis VM (2008). Azospirillum amazonense inoculation: effects on growth, yield and N2 fixation of rice (Oryza sativa L.). Plant Soil 302: 249-261 Ryu CM, Farag MA, Hu CH, Reddy MS, Wei HX, Pare PW and Kloepper JW (2003). Bacterial volatiles promote growth in Arabidopsis. Proc. Natl. Acad. Sci. USA. 100: 4927-4932 Salamone IEG, Funes JM, Salvo LP, Ortega JES, D'Auria F, Ferrando L and Scavino AF (2012). Inoculation of paddy rice with Azospirillum brasilense and Pseudomonas fluorescens: Impact of plant genotypes on rhizosphere microbial communities and field crop production. App. Soil Ecol. 61: 196-204 Santiago A, Quintero JM, Aviles M and Delgado A (2010). Effect of Trichoderma asperellum strain T34 on iron, copper, manganese, and zinc uptake by wheat grown on a calcareous medium. Plant Soil. DOI 10.1007/s11104-010-0670-1 Saravanan VS, Madhaiyan M and Thangaraju M (2007). Solubilization of zinc compounds by the diazotrophic, plant growth promoting bacterium Gluconacetobacter diazotrophicus. Chemosphere. 66: 1794-1798 Selvakumar G, Mohan M, Kundu S, Gupta AD, Joshi P, Nazim S and Gupta HS (2008). Cold tolerance and plant growth promotion potential of Serratia marcescens strain SRM (MTCC 8708) isolated from flowers of summer squash (Cucurbita pepo). Lett. Appl. Microbiol. 46: 171-75 Shabayev VP (2012). Mineral Nutrition of Plants Inoculated with Plant Growth Promoting Rhizobacteria of Pseudomonas Genus. Biol Bulletin Review. 2: 487-499 Sharma A, Patni B, Shankhdhar D and Shankhdhar SC (2012). Zinc-an indispensable micronutrient. Physiol. Mol. Biol. Plants. DOI 10.1007/s12298-012-0139-1 Souza R, Beneduzi A, Ambrosini A, Costa PB, Meyer J, Vargas LK, Schoenfeld R and Passaglia LMP (2012). The effect of plant growth-promoting rhizobacteria on the growth of rice (Oryza sativa L.) cropped in southern Brazilian fields. Plant Soil. DOI 10.1007/s11104012-1430-1 Subramanian KS, Bharathi C and Jegan AK (2008). Response of maize to mycorrhizal colonization at varying levels of zinc and phosphorus. Biol Fertil Soils. 45: 133-144 Tariq M, Hameed S, Malik KA and Hafeez FY (2007). Plant root associated bacteria for zinc mobilization in rice. Pak. J. Bot. 39: 245-253 Van VT, Berge O, Ke SN, Balandreau J and Heulin T (2000). Repeated beneficial effects of rice inoculation with a strain of Burkholderia vietnamiensis on early and late yield components in low fertility sulphate acid soils of Vietnam. Plant Soil. 218: 273-284 Van RP and Vanderleyden J (1995). The Rhizobium-plant symbiosis. Microbiol. Rev. 59: 124142 Vassilev N, Vassileva M and Nicolaeva I (2006). Simultaneous P-solubilizing and biocontrol activity of microorganisms: potentials and future trends. Appl. Microbiol. Biotechnol. 71: 137-144 Yanni YG, Rizk RY, El-Fattah FKA, Squartini A, Corich V, Giacomini A, Bruijn F, Rademaker J, Maya-Flores J, Ostrom P, Vega-Hernandez M, Hollingsworth RI, Martinez-Molina E,

Plant Growth Promoting Rhizobacteria

Ninke K, Philip-Hollingsworth S, Mateos PF, Velasquez E, Triplett E, Umali-Garcia M, Anarna JA, Rolfe BG, Ladha JK, Hill J, Mujoo R, Ng PK and Dazzo FB (2001). The beneficial plant growth-promoting association of Rhizobium leguminosarum bv. trifolii with rice roots. Aus. J. Plant Physiol. 28: 845-870 Yanni, YG and El-Fattah FKA (1999). Towards integrated biofertilization management with free living and associative dinitrogen fixers for enhancing rice performance in the Nile delta. Symbiosis. 27: 319-331 Zafar M, Abbasi MK, Khan MA, Khaliq A, Sultan T and Aslam M (2012). Effect of plant growth-promoting rhizobacteria on growth, nodulation and nutrient accumulation of lentil under controlled conditions. Pedosphere. 22: 848-859

CHAPTER 6 Microbial Osmoadaptation – A Road Towards Sustainability in Extreme Conditions Abhishek Vashishtha and Pawan Kumar Dhawal Department of Microbiology, Maharaja Ganga Singh University, Bikaner- 334004 India Corresponding author: [emailprotected]

INTRODUCTION State of Rajasthan (India) harbours a number of saline water bodies including Pachpadra, Sambhar, Didwana. Evaporation of marine salty water and the development of hypersaline habitats, over the years, have been changing the distribution pattern of saline water bodies. Many times, sea water condensation and evaporation of surface water acts as the reason for development of saline water bodies. Hypersaline environments, due to their high salinity, exposure to high and low temperature, low oxygen conditions and in some cases high pH values, constitute typical example of environment with extreme conditions. Hypersaline water bodies are known toharbour a diverse group of halophilic bacteria. Halophile is a group of microorganisms that live in saline environments and in many cases require high concentration of various salts to survive. Halophilic organisms are found in all the three domains of life: Archaea, Bacteria and Eukaryaand over a wide range of extreme conditions (salinity, temperature, light intensity, pressure, oxygen and nutrient conditions). Most widely distributedhalophilic organisms comes from bacterial and archaeal group (Ventosa, 2006) and includes cyanobacteria, sulfur oxidizing bacteria, heterotrophic bacteria, aerobic and anaerobic bacteria. Organisms requiring more than 1% sodium chloride for optimal growth are considered as halophilic. Halophilic microorganisms, depending upon the sodium chloride required for optimal growth, have been categorized into three different groups (Kushner et al., 1988) viz (a) slight halophiles (marine bacteria)- that can grow best in media supplemented with 1% - 3% sodium chloride; (b) moderate halophiles- that can grow best in media containing 3% 15% sodium chloride and (c) extreme halophiles- that show optimal growth in media containing 15% -30% sodium chloride. Because of the presence of saline environment, their enzymes and proteins of many halophiles are adapted for proper functioning of the cell i.e. they have evolved a complex physiological and molecular mechanism for sustaining a normal life at high salt concentrations. An excessively high ratio of acidic and basic amino acid is found in their proteins. This ratio helps them to combat high salinity and provide structural– functional stability (DasSarma, 2001).

Microbes: In Action

In addition to above mentioned three groups of halophiles, another group of microbes, called halotolerant, is also found. Halotolerant bacteria can grow in high salt concentration but high salinity is not a prerequisite for their growth. Halotolerant species lives in hyper saline lakes, salt marshes, saline deserts etc. A large number of halotolerant bacteria belongs to several genera like Bacillus, Pseudomonas, Micrococcus, Staphylococcus (Hrenovic and Ivankovic, 2009; Empadinhas and Da Costa, 2008); Cyanobacteria like Spirulina (Nubel et al., 2000), Dunaliella salina (DasSarma and DasSarma, 2012); fungi like Saccharomyces cerevisiae, Hortaea werneckii, Debaryomyces hansenii, (GundeCimerman et al., 2009). Halotolerant microorganisms are of potent applications in many fields. They play a significant role in nutrient cycling under saline conditions. OSMOREGULATION Regulation of osmosis is a prerequisite for an organismsinhabitating in saline conditions. As a matter of fact, they do it to maintain turgor pressure and to prevent cellular dehydration and desiccation (Shivanand and Mugeraya, 2011). Osmoregulation in prokaryotes is helpful to understand cellular response and adaptation to altering environmental conditions. Now-a-days, it is gaining considerable attention from the perspective of having wide range of applications in fermentation industries and agriculture (Csonka and Hanson, 1991). Two strategies are generally employed by halophilic and halotolerant microorganisms to enable themselves to thrive in changing and high salt concentrations. One strategy called 'salt-in' strategy works for selective input of K+ ions into the cytoplasm and hence maintain cellular ionic balance. Generally extreme halophiles including archaea use this approach. Such organisms adapt themselves in such a way that their cellular machinery requires high salinity for proper functioning. Another strategy called "organic solute in" relies on maintaining the osmotic balance by using compatible solutes. Use of compatible solutes enables halophiles to sustain in extreme cytoplasmic salinity. Such microbes have unique property of getting adopted in wide range of salinities. Salt – Instrategy The "salt-in" strategy has been reported in halophilicarchaea and extremely halophilic bacteria like Halobacteriaceae, Salinibacter, Halanaerobiales and many others. These organisms are well suited to thrive in high to very high saline conditions. Their growth retards (some are unable to survive) in low salinity conditions. To maintain turgor pressure and counterbalance the external salinity, such halophiles accumulate very high intracellular KCl content, even higher than the external NaCl concentration (Oren, 1999; Galinski, 1994; Lanyi, 1974). Generally, bacteria employing 'salt-in' strategy to maintain high cytoplasmic salinity and do not produce organic solutes to maintain osmotic balance. In this approach all intracellular proteins and enzymes remain stable and active in the presence of molar concentrations of KCl and other salts (Ventosa et al., 1998; Galinski et al., 1994). In salt-in strategy, bacteria generally keep their cytoplasm almost free of

Microbial Osmoadaptation

sodium. However, to combat the situation of osmotic balance they accumulate potassium (in an energy dependant manner) along with the Cl-counter ion (Saum et al., 2012). The K+concentration in cytoplasm rises up to hundred times more than the surrounding environment. A proton motive force is used to maintain this gradient of ions. Theorganisms employing this strategy, use combined action of the membrane bound proton-pump, bacteriorhodopsin, the "proton gradientconsuming" protein ATP synthase and Na+/H+antiporter to produce electrical potential (Δψ) that activates the uptake of potassium ions (Wagner et al., 1978). The potassium ions are then taken up via a K+uniport mechanism. For such type of transport to take place, an electrical potential (Δψ) more than the diffusion potential of K+ (Δψ K) is required. Growth of many microbes depends upon presence of chloride. In the absence of chloride they cannot grow. It is a consequence of high salinity that chloride accumulates in the cytoplasm. In many cases Cl- compensates for the external salinities and also regulates many cellular processes (Dohrmann et al., 1999). Primary or secondary transporter drives the influx of the counterion chloride (Epstein, 2003). A light-independent Cl-/Na+symporter has also been reported in some organisms (Duschl et al., 1986), but till now not much is known about this transport mechanism, moreover the transporter remain unknown also. Halorhodopsin, a heptahelical membrane protein, mediated transport system for chloride pump has also been reported (Schobert, 1982). This is a light driven reaction. In fact, halorhodopsin is a member of archael rhodopsin subfamily which also includes bacteriorhodopsin and some other sensory rhodopsins (Saum and Muller, 2008). Proteins of many organisms, that employ salt-in strategy, have unique composition of amino acids. They exhibit high concentration of acidic and low amount of aromatic amino acids (Oren et al., 2005; Oren and Mana, 2002). The presence of acidic amino acids is very important for proper folding and activity of proteins and requires the presence of high salt concentration. In fact, the presence of acidic amino acids leads to the dominance of charged amino acids on the surface of enzymes and ribosomes. Their presence stabilizes the hydration shell of the molecules under excessively saline conditions. Under low salinity conditions, due to repulsion, the negatively charged ions works in opposite direction i.e. after removal of shielding cations, they cause destabilization of the molecule. This is the basic reason why bacteria employing this strategy do not show diverse range of adaptations and always need high salinity for optimal growth. ORGANIC-SOLUTES-INSTRATEGY A more flexible second strategy called low salt, organic solute-in strategy is found in moderately halophilicbacteria that can grow over a wide range (typically 0.5 M to 3 M NaCl) of salinities (Roessler et al., 2001) and halotolerant bacteria. This strategy of osmotic adaptation, to provide osmotic balance, works to exclude salts from the cytoplasm as much as possible and to accumulate organic solutes (like glycerol and other sugar alcohols, amino acids and derivatives such as glycine, betain and ectoine, simple sugars etc.) to provide

Microbes: In Action

osmotic balance (Galinski 1995). These osmoprotectants (except ectoines) remain same for eukaryotes and prokaryotes (Rhodes and Hanson, 1993). In general these osmoprotectants works to counteract osmotic dehydration in the cell. Moreover they also protect living organisms against other stresses like temperature (Ko et al., 1994) and desiccation (Galinski, 1995). The accumulation of organic solutes may be achieved either by de novo synthesis or by uptake from the surrounding medium. These organic solutes are known as "compatible solutes" because they do not upset normal metabolism of cell when present in high cytoplasmic concentrations. They are small, basically neutral, compounds which are highly water soluble (Brown, 1976). Compatible solutes are stress protective, salt antagonistic agents which works to stabilize whole cells along with biomolecules. Because of their stabilizing property, osmoregulator solutes have industrial and research applications. Compatible solutes have protein-stabilizing properties which arehelpful in proper folding of polypeptide chains (Arakawa et al., 1985). Due to their stabilizing effect on protein molecules, sometimes they are also referred to as chemical chaperones (Chattopadhyay et al., 2004). Compatible solutes are known to alter the structure of solvent and dynamic properties of proteins; however, they do not affect the protein structure (Lamosa et al., 2003). It has also been observed that compatible solutes can influence the protein-DNA interactions as well (Kurz, 2008; Pul et al., 2007). Compatible Solutes A large variety of compatible solutes are used by halophilic microorganisms (Fig. 1). The compatible solutes are soluble organic molecules of diverse chemical nature like carbohydrates, amino acids, sugars, polyols, derivatives of carbohydrates etc.

FIG. 1: Structure of different Compatible Solutes

Microbial Osmoadaptation

Ectoine Ectoine (1,4,5,6-tetrahydro-2-methyl-4-pyrimidinecarboxylicacid), which is synthesized by most halophilic and halotolerant bacteria is one of the most common osmotic solutes found in prokaryotic world. Ectoine biosynthesis is a prerequisite for osmoprotection and hence survival of some osmotically challenged bacteria like Vibrio parahaemolyticus (Ongagna-Yhombi and Boyd, 2013). It was first discovered in Ectothiorhodospirahalo chloris, which is a haloalkaliphilic photosynthetic sulfur bacteria. It is a cyclic tetrahydro pyrimidine. In addition to external salt concentration, ectoine production is found to depend upon a number of parameters like growth stage, type of carbon source and aeration. In most of the organisms synthesizing ectoine, its production starts only above 0.6 M NaCl concentration. The maximum production occurs in exponential stage (Onraedt et al., 2003). Ectoine is also found in many aerobic heterotrophic eubacteria. Many times it is synthesized along with its 5-hydroxy derivative called hydroxyectoine (Rothschild et al., 2001). Ectoine biosynthesis starts with aspartate semi aldehyde. Aspartate semi aldehyde is then converted into L-2,4-diaminobutyric acid which in turn is acetylated to form Nγ-acetyldiaminobutyric acid (NADA). NADA cyclization ultimately leads to ectoine formation. This biosynthesis is a result of interaction three genes (ectABC) which are arranged on the same operon (Saum et al., 2008). The product of these genes ectA, ectB and ectC are diaminobutyric acid acetyltransferase, diaminobutyric acid amino transferase and ectoine synthase respectively (Shivanand and Mugeraya, 2011). The actR acts as a regulator gene in ectoine biosynthesis (Mustakhimov et al., 2012). The ectoine concentration remains low at low salinities and increases with increase of salinity (Saum and Muller, 2008). Ectoine concentration increases in stationery phase and become maximum in late stationery phase. Hydroxylectoine, in most of the organisms is synthesized directly from ectoine. NADA hydroxylates to 3-hydroxyl-Nγ-acetyl diamino butyric acid which in turn cyclizes to hydroxyectoine synthase (Canovas et al., 1998) which is responsible for hydroxyectoine formation. This reaction is highly regionselective and sterospecific (Widderich et al., 2014). The hydroxyectoine shows stress-protective property. Moreover, it has function preserving properties different from ectoine. The hydroxylation reaction of ectoine is mediated by EctD protein (Eilert et al., 2013). EctD protein is a member of 2-oxoglutaratedependent dioxygenase and non – heme-containing iron (II) superfamily (Widderich et al., 2014; Widderich et al., 2013). Glycine Betaine Glycine betaine (N,N,N-trimethylglycine) is an important osmoprotectant synthesized in response to abiotic stresses. Betaines are found in many halophilic phototrophic and chemotrophic eubacteriaandarchae bacteria. In addition, they are also synthesized by many animals and plants in response to abiotic stress (Kempf and Bremer, 1998). Many phylogenetically related families of extremehalophilic bacteria have Glycinebetaine with the primary amine methylated to form a quaternary amine (Nyyssola et al., 2000). Betain is actively

100

Microbes: In Action

transported from complex medium and accumulate as an osmolyte in majority of cells. External NaCl concentrations affect the concentration of betaine inside the cell and hence betaine concentration varies according to external NaCl concentrations. For example, Imhoff and Rodriguez (1984) while working on eight different halophiles confirmed the above facts. They found that the average betaine concentrations in halophiles at 3, 10 and 20% NaClconcentration (0.51, 1.7 and 3.4 M) were 0.21 ± 0.2, 0.65 ± 0.06 and 0.97 ± 0.09 M. Some methanogens have also been reported to accumulate betaine (Robertson et al., 1990). Biosynthetic pathway for betaine includes two step oxidation of choline. In the first step, choline is converted to betaine aldehyde. This reaction is catalyzed by membrane bound choline dehydrogenase or soluble choline oxidase. In the second step, betaine aldehyde is converted to glycinebetaine. In many bacteria, the second step is also catalyzed by one of these two enzymes (Boch et al., 1996; Lamark et al., 1991). In most of the organisms including plants, animals and bacteria the second step is catalyzed by NAD+ dependent betaine-aldehyde dehydrogenase (Chern and Pietruszko, 1995). Many workers have identified another mechanism for conversion of glycine to betaine. This process is a threestep series of methylation reaction. It is catalyzed by two methyl transferases viz. (a) glycine sarcosine methyl transferases and (b) sarcosine dimethyl transferases (Nyyssola et al., 2000). Genes for glycine betain biosynthesis are found on bet operon. Four genes have been identified by Andresen et al. (1988) for choline dehydrogenase (betA), betaine-aldehyde dehydrogenase (betB), a choline transporter (betT) and a putative regulator (betI). Glycine betaine has a number of biotechnological applications. They are known to reduce the side effects of many anti-inflammatory preparations. They are known to enhance product yield and specificity of PCR amplification reactions, especially GC-rich templates of DNA (Roberts, 2005). Betaine can also act as an effective cryo-protectant for long term storage, even better than serum albumin and dextran (Cleland et al., 2004). Betaine has some medicinal uses also. They exhibits anticoagulant properties and hence have important role to prevent thrombus formation (Messadek, 2005). They are also important for treatment of adipose tissue infiltration of liver (Detkova, 2007). Trehalose Trehalose is a non-reducing glucose disaccharide, used by organisms to counteract drying, but it also serves as an osmolyte (Mercedes et al., 2012; Roberts, 2005). It is an odorless white powder with relative sweetness 45% that of sucrose and is composed of two glucose units linked together in a α-1,1 glycosidic linkage. It is found in a wide variety of organisms ranging from bacteria and archaea to fungi, plants and invertebrates. Trehalose is not only useful as a cryoprotectant and lyoprotectant during the freeze–drying of biomolecules, the presence of this disaccharide helps in preserving the membrane structure and thus it is also used for long-term conservation of microorganisms (Empadinhas et al., 2008). In fact it replaces water shell around the membrane proteins and thus facilitates to preserve the 3D structure. Trehalose also protect many enzymes from thermoinactivation and provide

Microbial Osmoadaptation

101

them thermotolerance. The level of thermotolerance is co-related with the level of trehalose. Nihira et al. (2013) discovered a potassium ion - dependent trehalosephosphorylase. This enzyme exists as an active diamer at high K+ concentration (Mercedes et al., 2012) and belongs to glycosyltransferase family. Trehalose has several roles and few of them are species specific. In many microorganisms, it appears to act as a source of energy especially during spore germination (Elbein, 2003). In anhydrobiotic organisms, trehalose is known to by preserving the membranes during drought period (Drennan et al., 1993). In mycobacteria Trehalose gets incorporated into the glycolipids and acts as a structural component (Elbein, 2003). In bacteria like Escherichia coli, it helps to combat cold stress, probably by stabilizing cell membranes and preventing protein denaturation, whereas in yeast it plays a role in osmotic (Hounsa et al., 1998), heat, and desiccation tolerance (Hottiger et al., 1987), and it may act as a free radical scavenger (Benaroudj, 2001). Microarray analyses have shown that trehalose affects the levels of genes involved in abiotic stress (Schluepmann et al., 2004; Bae et al., 2005). The mechanism by which trehalose helps alleviate the stress condition is not salt specific, but is rather related to the ability of trehalose to stabilize membranes and protein structure. Bacteria like E. coli can adapt to osmotic stress by accumulating cytoplasmic trehalose produced endogenously. Excess trehalose is excreted and then degraded by periplas mictrehalase (treA) to glucose, which is subsequently reutilized by the cells. Furthermore, E. coli, S. meliloti, B. japonicum mutants lacking trehalose biosynthesis genes are sensitive to osmotic stress (Sugawara et al., 2010). Trehalose is an essential osmolyte in cyanobacteria. In cyanobacteria, its presence was first demonstrated in Rivularia atra, obtained from the tidal zone of the coastal waters. It is now known that more than forty strains of cyanobacteria grown under high salt concentration accumulate trehalose and in twenty of them accumulated trehaloseas the major compatible solute (Hagemann, 2011). Trehalose can be synthesized by five different mechanisms. There are five known pathways reported in living organisms for trehalose biosynthesis. Some organisms use only one pathway, while others may use multiple pathways depending on the stress affecting the organism (Paul et al., 2008). TPS-TPP (OtsA-OtsB) pathway which is a two steps procedure is most common for trehalose biosynthesis. This pathway is used in almost all domains of life i.e. archaea, bacteria, fungi, plants and arthropods (Paul et al., 2010). In bacteria OtsA enzyme catalyze the conversion of glucose-6-phosphate and Uridine Diphosphate (UDP)-glucose tointermediate trehalose-6-phosphase, and then OtsB catalyze the dephosphorylation of trehalose-6-phosphate totrehalose. In plants trehalose 6-phosphate synthase (TPS) and trehalose-6-phosphate phosphatase (TPP) catalyze these reactions. In addition to TPS- TPP pathway four other pathways used for synthesis of Trehalose are TreY-TreZ pathway, TreS pathway, TreT pathway andTreP pathway. Amino Acids N-Acetyl--Lysine and -Glutamine Methanogens employ a different strategy for osmoregulation. To combat with osmotic imbalance they generally accumulate some -amino acids.-amino

102

Microbes: In Action

acids are different type of amino acids in the sense that they are not incorporated to form any type of protein macromolecule. Thus they are very effective in acting as compatible solutes. At high external NaCl concentration (>1M), these amino acids accumulates in two zwitterionic forms. Many mesophilic and some thermophilic bacteria have been detected to accumulate N-acetyl--lysine (Sowers et al., 1995 and 1990). In some other methanogenic bacteria like Methanohalophilus species,-Glutamine has been reported. -Glutamine is a unique amino acid and is synthesized and accumulated along with N-acetyl--lysine and betaine (Lai et al., 1991). Two main enzymes are involved in two step biosynthesis of N-acetyl-lysinein methanogenicarchaea. In the first step, α-lysine is converted to β-lysine by the action of α-lysine-2,3-aminomutase enzyme (Ruzicka et al., 2000). Another enzyme β-lysine acetyltransferase, catalyzes the second step in which amino group is acetylated in the -position. This leads to the conversion of the basic amino acid lysine into uncharged, highly water-soluble and zwitterionic molecule (Roberts, 2005). Pfluger et al. (2003) while working on Methanosarcina mazei G01 identified the genes encoding these two enzymes. Amino mutase is encoded by ablA gene while ablB is known to code for -lysine acetyltransferase. Both these are arranged in a single operon and their expression is salt dependent. Pfluger et al. (2003) further reported the presence of hom*ologous genes in many methanogens like Methanococcus maripaludis. -Glutamine is synthesized from -glutamate by an unusual glutamine synthetase (Roberts et al., 1992). Two open reading frames (glnA1 and glnA2) encode glutamine synthetase (Gln). The first open reading frame (glnA1) remains associatedwith a gene (glnR) which codes for the regulatory protein GlnR. GlnR protein is involved in nitrogen metabolism in bacteria like Bacillus subtilis. The second open reading frame (glnA2) islocated separately on the genome. This open reading frame is controlled by a promoter recognized by σB, the general stress σ-factor (Saum et al., 2006) β-Glutamate β-glutamate is another predominant osmoregulators found in Methanogens. βglutamate works along with α-glutamate. Study of Robertson et al. (1990) suggested that level of both the α- and β-glutamate increases with increasing external NaCl. Glutamate generally accumulates when the extracellular concentration of NaCl is less than 1M beyond whichNε-acetyl-β-lysine becomes the major solute (Ciulla et al., 1999; Robertson et al., 1992). β-glutamate is predominantly found in methanogens, however recently this solute has also been detected in a few otherbacteria, for example Gram-positive organism Nocardiopsis halophila. This organism also accumulates the zwitterioni chydroxyectoine (DasSarma et al., 2002). Many halophilic organisms use glutamine as osmoregulator molecule. Glutamate biosynthesis requires contribution of either of two enzymes viz glutamate synthase (GOGAT) or glutamate dehydrogenase (GDH). Glutamate synthase enzyme is heterodimer made up of three subunits- one larger subunit and two smaller subunits. The larger subunit is encoded by gltA open reading

Microbial Osmoadaptation

103

frame. gltB1 and gltB2 open reading frames encode for smaller subunits. The glutamate dehydrogenase enzyme is encoded by two open reading frames vizgdh1 and gdh2 (Saum et al., 2006). Glutamate production is generally accompanied by the catalytic activity of glutamate dehydrogenase enzyme. This enzyme reductively acts on one molecule each of 2-oxoglutarate and NH4+ to form one molecule of glutamate (Reitzer, 1996). In organisms like Bacillus subtilis, glutamate dehydrogenase enzyme is also involved in nitrogen metabolism. However role of gltA, is not very significant. Proline One of the major compatible solutes found in halophilic bacteria inhabiting in moderate salt concentration(s) is proline. Proline as compatible solute is also found in few non-halophiles like Bacillus subtilis. Proline as an osmoregulator compatible solute is effective at moderate saline conditions only. Its role diminishes at extreme salinities. The moderately halophilic bacterium Halobacillus halophilus synthesizes glutamate and glutamine at salinities of about 1 M NaCl (Saum et al., 2006). At salinities higher than 1M, this organism reset the switch of osmolyte pool and synthesizes proline. Proline is produced up to a maximum of 3M salinity. Galinski (1995) suggested that ectoine alone or in combination with proline accumulates in halophilic/halotolerantBacillus strains. Bacillus subtilischiefly accumulatesproline and are incapableof synthesizing other compatible solutes. Three genes involved in proline synthesis have been identified as proH, proJand proA. These are organized in a single operon. The products of these three genes are pyrroline-5-carboxylate reductase (ProH), glutamate 5-kinase (ProJ) and glutamate 5-semialdehyde dehydrogenase (ProA) (Saum and Müller, 2007). These three genes act on glutamate to synthesize proline. In Halobacillus halophilus, it has been speculated that not only high level of NaCl stimulate production of proline but increased level of glutamate is also responsible to trigger the proline production (Saum and Muller, 2008). Hence, glutamate is regarded as second messenger in Halobacillus halophilus besides of being a compatible solute. REFERENCES Andresen PA, Kaasen I, Styrvold OB, Boulnois G and Strom AR (1988). Molecular cloning, physical mapping and expression of the bet genes governing the osmoregulatory cholineglycine betaine pathway of Escherichia coli. J. Gen. Microbiol. 134: 1737-1746 Arakawa T and Timasheff SN (1985). The stabilization of proteins by osmolytes. Biochem. J. 47: 411-414 Bae H, Herman E, Bailey B, Bae HJ and Sicher R (2005). Exogenous trehalose alters Arabidopsis transcripts involved in cell wall modification, abiotic stress, nitrogen metabolism, and plant defense. Physiologia Plantarum. 125(1): 114- 126 Benaroudj N, Lee DH and Goldberg AL (2001). Trehalose accumulation during cellularstress protects cells and cellular proteins from damage by oxygen radicals. J. Biol. Chem. 276(26): 24261-24267 Boch J, Kemp B, Schmid R and Bremer E (1996). Synthesis of the osmoprotectant glycine betaine in Bacillus subtilis: characterization of the gbsAB genes. J. Biol. Chem. 178: 51215129 Brown AD (1976). Microbial water stress. Bacteriol. Rev. 40: 803-846

104

Microbes: In Action

Canovas D, Vargas C, Csonka LN, Ventosa A and Nieto JJ (1998). Synthesis of glycine betaine from exogenous choline in the moderately halophilic bacterium Halomonas elongata. Appl. Environ Microbiol. 64: 4095-4097 Chattopadhyay MK, Kern R, Mistou MY, Dandekar AM, Uratsu SL and Richarme G (2004). The chemical chaperone proline relieves the thermosensitivity of a dnaK deletion mutant at 42°C. J. Bacteriol. 186: 8149-8152 Chern MK and Pietruszko T (1995). Human aldehyde dehydrogenase E3 isozyme is a betaine aldehyde dehydrogenase. Biochem. Biophys. Res. Commun. 213: 561-568 Ciulla RA and Roberts MF (1999). Effects of osmotic stress on Methanococcus thermolithotrophicus: 13C-edited 1H-NMR studies of osmolyte turnover. Biochem. BiophysicsActa. 1427: 193-204 Cleland D, Krader P, McCree C, Tang J and Emerson D (2004). Glycine betaine as a cryoprotectant for prokaryotes. J. Microbiol. Methods. 58: 31-38 Csonka LN and Hanson AD (1991). Prokaryotic osmoregulation: genetics and physiology. Annu. Rev. Microbiol. 45: 569-606 DasSarma S (2001). Halophiles. Encycl. Life Sci. 1-9 DasSarma S and Arora P (2002). Halophiles. In Encyclopedia of Life Sciences Volume 8. Nature Publishing Group: 458-466. DasSarma S and DasSarma P (2012). Halophiles. In: eLS. John Wiley and Sons, Ltd: Chichester. DOI: 10.1002/9780470015902.a0000394.pub3. Detkova EN and Boltyanskaya YV (2007). Osmoadaptation of haloalkaliphilic bacteria: role of osmoregulators and their possible practical application. Microbiology. 76: 511-522 Dohrmann AB and Muller V (1999). Chloride dependence of endospore germination in Halobacillus halophilus. Arch. Microbiol. 172: 264-267 Drennan PM, Smith MT, Goldsworth D and van Staden J (1993). The occurrence oftrehalose in the leaves of the desiccation-tolerant angiosperm Myrothamnus flabellifolius Welw. J. Plant Physiol. 142(4): 493-496 Duschl A and Wagner G (1986). Primary and secondary chloride transport in Halobacteriu mhalobium. J. Bacteriol. 168: 548-552 Eilert E, Kranz A, Hollenberg CP, Piontek M and Suckow M (2013). Synthesis and release of the bacterial compatible solute 5-hydroxyectoine in Hansenula polymorpha. J. Biotechnol. 167: 85-93 Elbein AD, PanYT, Pastuszak I and Carroll D (2003). New insights on trehalose: amultifunctional molecule. Glycobiology. 13(4): 17r-27r. Empadinhas N and daCosta MS (2008). Osmoadaptation mechanisms in prokaryotes: distribution of compatible solutes. Int. Microbiol. 11: 151-161 Epstein W (2003). The roles and regulation of potassium in bacteria. Prog. Nucleic Acid Res. Microbiol. 75: 293-320 Galinski EA (1995). Osmoadaptation in bacteria. Adv. Microb. Physiol. 37: 273-328 Galinski EA and Truper HG (1994). Microbial behavior in salt-stressed ecosystems. FEMS Microbiol. Rev. 15: 95-108 Gunde-Cimerman N, Ramos J and Plemenitas A (2009). Halotolerant and halophilic fungi. Mycol. Res.113(11): 1231-1241 Hagemann M (2011). Molecular biology of cyanobacterial salt acclimation. FEMS Microbiol. Reviews. 35(1): 87-123 Hottiger T, Boller T and Wiemken A (1987). Rapid changes of heat and desiccation contentcorrelated with changes of trehalose content in Saccharomyces cerevisiae cell subjected to temperature shifts. FEBS Letters. 220(10): 1223-1229 Hounsa CG, Brandt, Thevelein J, Hohmann S and Prior BA (1998). Role of trehalose in survival of Saccharomyces cerevisiae under osmotic stress. Microbiology. 144(3): 671-680 Hrenovic J and Ivankovic T (2009) Survival of Escherichia coli and Acinetobacter juniiat various concentrations of sodium chloride. Eur. Asia J. BioSci. 3: 144-151 Imhoff JF and Rodriguez-Valera (1984). Betain is the main compatible solute of halophilic eubacteria. J. Bacteriol. 160: 478-479

Microbial Osmoadaptation

105

Kempf B and Bremer E (1998). Uptake and synthesis of compatible solutes as microbial stress responses to high osmolality environments. Arch. Microbiol. 170: 319-330 Ko R, Smith LT and Smith GM (1994). Glycine betaine confers enhanced osmotolerance and cryotolerance on Listeria monocytogenes. J. Bacteriol. 176: 426-431 Kurz M (2008). Compatible solute influence on nucleic acids: Many questions but few answers. Saline Syst. 4: 1-14 Kushner DJ and Kamekura M (1988). Physiology of halophilic eubacteria. In Halophilic Bacteria; Rodriguez-Varela F, Ed.; CRC Press: Boca Raton, FL, USA, 109-138 Lai MC, Sowers KR, Robertson DE, Roberts MF and Gunsalus RP (1991). Distribution of compatible solutes in the halophilic methanogenic archaebacteria. J. Bacteriol. 173: 5352-5358 Lamark T, Kaasen I, Eshoo MW, McDougall J and Strom AR (1991). DNA sequence and analysis of bet genes encoding theosmoregulatory choline-glycine betaine pathway of Escherichia coli. Mol. Microbiol. 5: 1049-1064 Lamosa P, Turner DL, Ventura R, Mayco*ck C and Santos H (2003). Protein stabilization by compatible solutes. Effect of diglycerol phosphate on the dynamics of Desulfovibrio gigas rubredoxins studied by NMR. Eur. J. Biochem. 270: 4606-4614 Lanyi JK (1974). Salt-dependent properties of proteins from extremely halophilic bacteria. Bacteriol. Rev. 38: 272-290 Mercedes RB, Montserrat A, Manuel S, Javier RM, Fernando IG, Laszlo CN, Joaqun JN and Carmen V (2012). Role of Trehalose in Salinity and Temperature Tolerance in the Model Halophilic Bacterium Chromohalobacter salexigens. PLoS ONE. 7(3): 1-5 Messadek J (2005). Glycine betaine and its use. US Patent, 6855734 Mustakhimov II, Reshetnikov AS, Fedorov DN, Khmelenina VN and Trotsenko YA (2012). Role of EctR as transcriptional regulator of ectoine biosynthesis genes in Methylophagathal assica. Biochemistry (Mosc). 77: 857-863 Nihira T, Yuka S, Kazuhiro C, Motomitsu K, Kenichi O and Hiroyuki N (2013). Potassium ion-dependent trehalosephosphorylase from halophilic Bacillus selenitireducens MLS10. FEBS Letters. 587:(21): 3382-3386 Nubel U, Garcia-Pichel F and Muyzer G (2000). The halotolerance and phylogeny of cyanobacteria with tightly coiled trichomes (Spirulina turpin) and the description of Halospirulina tapeticolagen. nov., sp. nov. International Journal of Systematic and Evolutionary Microbiology. 50: 1265-1277 Nyyssola A, Kerovuo J, Kaukinen P, von Weymarn N and Reinikainen T (2000). Extreme halophiles synthesize betaine from glycine by methylation. J. Biol. Chem. 275: 2219622201 Ongagna-Yhombi SY and Boyd EF (2013). Biosynthesis of the osmoprotectantectoine, but not glycine betaine, is critical for survival of osmotically stressed Vibrio parahaemolyticus cells. Appl. Environ. Microbiol. 79: 5038-5049 Onraedt A, Walcarius B, Soetaert W and Vandamme EJ (2003). Dynamics and optimal conditions of intracellular ectoine accumulation in Brevibacterium sp. Commun. Agric. Appl. Biol. Sci.68: 241-246 Oren A (1999). Bioenergetic aspects of halophilism. Microbiol. Mol. Biol. Rev. 63: 334-348 Oren A and Mana L (2002). Amino acid composition of bulk protein and salt relationships of selected enzymes of Salinibacter ruber, an extremely halophilic bacterium. Extremophiles. 6: 217-223 Oren A, Larimer F, Richardson P, Lapidus A and Csonka LN (2005). How to be moderately halophilic with broad salt tolerance: clues from the genome of Chromohalobacter salexigens. Extremophiles. 9: 275-279 Paul MJ, Jhurreea D, Zhang Y, Primavesi LF, Delatte T, Schluepmann H and Wingler A (2010). Upregulation of biosynthetic processes associated with growth by trehalose-6-phosphate. Plant Signaling and Behavior. 5(4): 368-392 Paul MJ, Primavesi LF, Jhurreea D and Zhang Y (2008). Trehalose metabolism and signaling. Ann. Rev. Plant Biol. 59(1): 417-441

106

Microbes: In Action

Pfluger K, Baumann S, Gottschalk G, Lin W, Santos H and Muller V (2003). Lysine-2,3aminomutase and b-lysine acetyltransferase genes of methanogenicarchaea are salt induced and are essential for the biosynthesis of Ne -acetyl-b-lysine and growth at high salinity. Appl. Environ. Microb. 69: 6047-6055 Pul U, Wurm R and Wagner R (2007). The role of LRP and H-NS in transcription regulation: involvement of synergism, allostery and macromolecular crowding. J. Mol. Biol. 366: 900915 Reitzer LJ (1996). Ammonium assimilation and the biosynthesis of glutamine, glutamate, aspartate, asparagine, L-alanine, and D-alanine. In Escherichia coli and Salmonella. Cellular and Molecular Biology Volume 1. Edited by: Neidhardt FC, Curtiss III R, Ingraham JL, Lin ECC, Low KB, Magasanik B, Reznikoff WS, Riley M, Schaechter M, Umbarger HE. Washington, DC: Am. Soc. Microbiol.pp. 391-407 Rhodes D and Hanson AD (1993). Quaternary ammonium and tertiary sulfonium compounds in higher. Annu. Rev. Plant Physiol. Mol. Biol. 44: 357–384 Roberts MF (2005). Organic compatible solutes of halotolerant and halophilic microorganisms. Saline Syst. 1: 1-30 Roberts MF, Lai MC and Gunsalus RP (1992). Biosynthetic pathways of the osmolytes Nepsilon-acetyl-beta-lysine, beta-glutamine, and betaine in Methanohalophilus strain FDF1 suggested by nuclear magnetic resonance analyses. J. Bacteriol. 174: 6688-6693 Robertson DE, Noll D and Roberts MF (1992). Free amino acid dynamics in marine methanogens. β-Amino acids as compatible solutes. J. Biol. Chem. 267: 14893-14901 Robertson DE, Noll D, Roberts MF, Menaia JA and Boon DR (1990). Detection of the osmoregulatorbetaine in methanogens. Appl. Environ. Microbiol. 56: 563-565 Roessler M and Muller V (2001). Osmoadaptation in bacteria and archaea: Common principles and differences. Environ. Microbiol. 3: 743-754 Rothschild LJ and Mancinelli RL (2001). Life in extreme environments. Nature. 409: 10921101 Ruzicka FJ, Lieder KW and Frey PA (2000). Lysine 2, 3-aminomutase from Clostridium subterminale SB4: mass spectral characterization of cyanogen bromide-treated peptides and cloning, sequencing, and expression of the gene kamA in Escherichia coli. J. Bacteriol. 182: 469-476 Saum SH and Muller V (2007). Salinity-dependent switching of osmolyte strategies in a moderately halophilic bacterium: Glutamate induces proline biosynthesis in Halobacillus halophilus. J. Bacteriol. 189: 6968-6975 Saum SH and Muller V (2008). Growth phase-dependent switch in osmolyte strategy in a moderate halophile: Ectoine is a minor osmolyte but major stationary phase solute in Halobacillus halophilus. Environ. Microbiol. 10: 716-726 Saum SH, Pfeiffer F, Palm P, Rampp M, Schuster S, Muller V and Oesterhelt D (2012). Chloride and organic osmolytes: A hybrid strategy to cope with elevated salinities by the moderately halophilic, chloride-dependent bacterium Halobacillus halophilus. Environ. Microbiol.1462-2920 Saum SH, Sydow JF, Palm P, Pfeiffer F, Oesterhelt D and Muller V (2006). Biochemical and molecular characterization of the biosynthesis of glutamine and glutamate, two major compatible solutes in the moderately halophilic bacterium Halobacillus halophilus. J. Bacteriol. 188: 6808- 6815 Schluepmann H, van Dijken A, Aghdasi M, Wobbes B, Paul M and Smeekens S (2004). Trehalose mediated growth inhibition of Arabidopsis seedlings is due to trehalose-6phosphate accumulation. Plant Physiol. 135(2): 879-890 Schobert B and Lanyi JK (1982). Halorhodopsin is a light-driven chloride pump. J. Biol. Chem. 257: 10306-10313 Shivanand P and Mugeraya G (2011). Halophilic bacteria and their compatible solutes osmoregulation and potential applications. Curr. Sci. 100: 1516-1521 Sowers KR and Gunsalus RP (1995). Halotolerance in Methanosarcina spp.: role of Nε-acetyl-βlysine, β-glutamate, glycine betaine and K+ as compatible solutes for osmotic adaptation. Appl. Environ. Microbiol.61: 4382-4388.

Microbial Osmoadaptation

107

Sowers KR, Robertson DE, Noll D, Gunsalus RP and Roberts MF (1990). Nε- acetyl-β-lysine: an osmolyte synthesized by methanogenic bacteria. Proc. Natl. Acad. Sci. USA.87: 90839087 Sugawara M, Cytryn EJ and Sadowsky MJ (2010). Functional role of Bradyrhizobium japonicum trehalose biosynthesis and metabolism genes during physiological stressand nodulation. Appl. Environ. Microbiol.76(4): 1071-1081 Ventosa A (2006). Unusual microorganisms from unusual habitats: hypersaline environments. In Prokaryotic Diversity-Mechanism and Significance; Logan NA, Lppin-Scott HM, Oyston PCF, Eds., Cambridge University Press: Cambridge, UK.pp. 223-253 Ventosa A, Nieto JJ and Oren A (1998). Biology of moderately halophilic aerobic bacteria. Microbiol. Mol. Biol. Rev. 62,504-544 Wagner G, Hartmann R and Oesterhelt D (1978). Potassium uniport and ATP synthesis in alobacterium halobium. Eur. J. Biochem. 89:169-179 Widderich N, Hoppner A, Pittelkow M, Heider J and Smits SHJ (2014). Biochemical Properties of Ectoine Hydroxylases from Extremophiles and Their Wider Taxonomic Distribution among Microorganisms. PLoS ONE 9(4) Widderich N, Pittelkow M, Hoppner A, Mulnaes D and Buckel W (2013). Molecular dynamics simulations and structure-guided mutagenesis provide insight into the architecture of the catalytic core of the ectoine hydroxylase. J. Mol. Biol. 426: 586-600

CHAPTER 7 Phytoremediation: A Plant Microbe Based Heavy Metal Removal System Debjani Mukherjee, Mohit Kumar and Yashika Thakur Department of Biotechnology, School of Biotechnology and Bioscience, Lovely Professional University, Phagwara, Punjab – 144411 India Corresponding author: [emailprotected]

INTRODUCTION The word's etymology comes from the Greek (phyto) = plant, and Latin (remedium) = restoring balance, or remediating. The technique of utilization of biological agents for degradation of pollutants is known as bioremediation. Phytoremediation is a branch of bioremediation wherein plants are employed for the purpose of removal of pollutants from a specific area. Plants aid in phytoremediation by absorption, assimilation of compounds, vaporization of pollutants, metabolic digestion, or by microbial degradation by plant associated microbes. The plants which can accumulate and degrade the contaminants are known as 'hyperaccumulaters' which play a major role in phytoremediation. INTRODUCTION Contamination of soil and water with organic or inorganic waste poses major environmental and human health problems. Over the last two decades, plantbased environmental remediation (i.e. phytoremediation) has been widely pursued as a favorable clean-up technology, and is an area of intensive scientific investigation. Phytoremediation is defined as the use of green plants to remediate selected contaminants in contaminated soil, sludge, sediment, ground water, surface water, and waste water from the environment, or to render them harmless. Phytoremediation has also been called green remediation, botanoremediation, agro remediation, and vegetative remediation. Phytoremediation is a continuum of processes, with the different processes occurring to differing degrees for different conditions, media, contaminants, and plants. Phytoremediation encompasses a number of different methods that can lead to contaminant degradation, removal (through accumulation or dissipation), or immobilization: 1. Degradation (for destruction or alteration of organic contaminants). a) Rhizodegradation: enhancement of biodegradation in the below-ground root zone by microorganisms.

110

Microbes: In Action

b) Phytodegradation: contaminant uptake and metabolism above or below ground, within the root, stem, or leaves. 2. Accumulation (for containment or removal of organic and/ or metal contaminants). a) Phytoextraction: contaminant uptake and accumulation for removal. b) Rhizofiltration: contaminant adsorption on roots for containment and/or removal. 3. Dissipation (for removal of organic and/or inorganic contaminants into the atmosphere). a) Phytovolatilization: contaminant uptake and volatilization. 4. Immobilization (for containment of organic and/or inorganic contaminants). a) Hydraulic Control: control of ground-water flow by plant uptake of water. b) Phytostabilization: contaminant immobilization in the soil. TABLE 1: Phytoremediation includes the following processes and mechanisms of contaminant removal Process

Mechanism

Contaminant

Rhizofiltration Phytostabilisation Phytoextraction Phytovolatilization Phytotransformation

Rhizosphere accumulation Complexation Hyper-accumulation Volatilization by leaves Degradation in plants

Organics/Inorganics Inorganics Inorganics Organics/Inorganics Organics

Phytoremediation may be carried out by using hyperaccumulators. These are plants that can absorb high levels of contaminants with their roots. In general, plants are involved in the uptake, translocation, sequestration, and degradation of pollutants. Subsequently, the plants can be harvested, and processed by drying, ashing or composting. The hyperaccumulators can accumulate 50 ~ 100 times more metals that normal plants The degree of accumulation of metals in these plants often reaches 1 ~ 5% of the dry weight. Examples include species of Thlaspi, which can accumulate more than 3% Zn, 0.5% Pb, and 0.1% Cd in their shoots. The best hyperaccumulators should have the following traits: an ability to accumulate high levels of contaminants; a fast growth rate; high biomass production; and resistance to diseases and pests. An alternative to the use of hyperaccumulators, is the use of normal plants together with the manipulation of soil conditions, by increaseing the bioavailability. Phytoremediation requires more effort than simply planting vegetation and, with minimal maintenance, assuming that the contaminant will disappear. Phytoremediation requires an understanding of the processes that need to occur, the plants selected, and what needs to be done to ensure plant growth. Verification of the applicability and efficacy of phytoremediation is likely to be required on a site-specific basis, at least until the technology becomes firmly proven and established. Phytoremediation requires a commitment of resources and time, but has the potential to provide a lower-cost, environmentally acceptable alternative to conventional remedial technologies at appropriate sites.

Phytoremediation

111

DIFFERENT MODES OF PHYTOREMEDIATION Depending on the technique applied phytoremediation can be subdivided into many kinds: 1. Phytoextraction: it refers to a process in which plants breakdown contaminants and adsorbs the same into its tissues. After adsorption, plants can be removed from site and disposed or incinerated. Different plant types have different ability of phytoextraction and the plants with most effectiveness are chosen usually. This process is mostly used for treatment of metal pollutants in soil. 2. Rhizofiltrtion: in this process the pollutants gets adsorbed and deposited, not on the shoot tissues but in this case, in the root or rather in the rhizosphere of plants. This technique is specifically employed for waste removal from contaminated water sources. 3. Phytostabilisation: this concept involves immobilization of the pollutants following absorption and adsorption of it by plant roots and finally precipitation of the pollutant in the root so that it does not migrate from soil into air or other sources. 4. Phytotransformation: it deals with transformation or degradation of pollutants as a result of various metabolic processes by plants. Thus it is also known as phytodegradation. 5. Phytovolatilization: the contaminants are absorbed by plants, undergo many changes and finally gets volatized from leaf surface during transpiration process of plants. 6. Phytostimulation: the microbial population near the root system of plants gets induced by the presence of rhizosphere which initiates them to break down the pollutants. This process is also known as rhizosphere degradation.

FIG 1: Phytoremediation processes of contaminated soils (Kokyo Oh et al.,2014)

112

Microbes: In Action

ROLE OF BIOTECHNOLOGY IN PHYTOREMEDIATION Offlate, biotechnology has been found to increase its wide spectrum of applications into phytoremediation as well. Plants adopted for phytoremediation are usually found to exhibit the specific property due to the presence the special genes coding for it. These plants are usually seen in area where metal ores exist. The genes responsible for this resistance by such plants are isolated and expressed in wide variety of transgenic plants so that they can be made resistant aswell. Thisincreases the number of plant species that can be used for such purpose. It is also possible with the help of biotechnology to increase the gene expression for maximum resistance. Certain plants are seen to show increased resistance under the presence of certain microbes. Biotechnology makes it possible to isolate such microbes and enrich the soil so as to enhance the phytoremediation by respective plants. EXAMPLES OF APPLICATION OF BIOTECHNOLOGICAL ASPECTS IN PHYTOREMEDIATION Selenium: The micronutrient selenium is known to induce toxicity in the soil where the concentration of the same is found to be high. It is found that methylation of amino acids at specific site can result in volatilization of selenium compound. Thus a transgenic plant is constructed which has the ability to volatize the same by following the guidelines of genetic engineering and utilizing the information obtained by studying hyperaccumulators of selenium. Mercury: Mercury can be degraded by certain bacterium due to the presence of merA and merBgenes. Thus integration of these genes into certain plant genomes has seen effective mercury degradation by such transgenic plants. The genes are targeted to be expressed in chloroplasts so that after degradation into relatively less toxic form, it is volatized. Thus transgenic tobacco produced by this phenomenon was shown to exhibit mercuric resistance. Arsenic: Certain bacterial genes present in E. coli, such as ArsC is responsible for reduction of arsenic and formation of a complex in the presence of glutathione (GSH). An increased amount of GSH can be produced by expression of glutamyl cysteine synthetase enzyme. These genes are isolated and transferred to form a transgenic plant which can effectively absorb arsenic and accumulate the same in its vacuoles resulting in phytoremediation. Thus it can be concluded that biotechnological tools can be utilized to improvise many existing phytoremediation systems yielding more effective and faster results. PHYTOREMEDIATION IN REAL LIFE EXAMPLES A mustard green (Brassica juncea) is used to decrease the amount of lead in the children's park in Boston. Plants were removed and safely disposed after they absorbed 45% of the lead from the ground. Pumpkin vine (Cucurbitapepo maxima) is used for cleaning the old Magic Marker factory in New Jersey. After Chernobyl nuclear catastrophe, sunflowers (Helianthus annuus) were used to absorb radioactive waste. Large plant species are used when big amount of water (and associated

Phytoremediation

113

contaminants) need to be absorbed from the ground. Single willow tree (Salix alba) can transpire 5,000 gallons of water in a summer day. One hectare of salt water cordgrass (Spartina alterniflora) will evapo-transpirate (sum of evaporation and transpiration) 21,000 gallons of water per day. All heavy metals and various pollutants will be absorbed with the water and metabolized (or accumulated) in the plant. Halophytes are interesting group of plants that could be used in phytoremediation as well. These plants could tolerate high level of the salt in the ground. In 2 years long project of phytoremediation of the gas and oil contaminated soil in Oklahoma, they managed to reduce the level of salt for 65%. After excess salt was removed, ground was colonized by the plants that lived there before "ecological disaster". List of pollutants that could be easily removed from the ground using phytoremediation: heavy metals, petroleum hydrocarbons, polycyclic aromatic hydrocarbons, chlorinated pesticides, polychlorinated biphenyls, trichloroethylene, explosives (TNT, DNT), organophosphate insecticides (diazanon and parathion), surfactants. LIST OF PLANTS USED IN PHYTOREMEDIATION Alfalfa is living in symbiosis with hydrocarbon-degrading bacteria. Arabidopsis can transform Hg into a gaseous state thanks to inserted bacterial gene. Bamboo family can accumulate silica in its stalk and N in its leaves. Bladder campion can accumulate Zn and Cu. Brassica juncea can accumulate Se, S, Pb, Cr, Cd, Ni, Zn, and Cu. Buxaceae and Euphorbiaceae can accumulate Ni. Compositae family is living in symbiosis with Arthrobacter bacteria and accumulates Cs and Sr. Ordinary tomato and alpine pennycress can accumulate Pb, Zn and Cd. Poplar is used for the absorption of the atrazine (pesticide). PLANT-MICROBE RELATIONSHIP IN PHYTOREMEDIATION Potential for phytoremediation depends upon the interactions among soil, heavy metals, bacteria, and plants. These complex interactions are affected by a variety of factors, such as characteristics and activity of plant and rhizobateria, climatic conditions, soil properties, etc. Rhizosphere, as an important interface of soil and plant, plays a significant role in phytoremediation of contaminated soil by heavy metals, in which, microbial populations are known to affect heavy metal mobility and availability to the plant through release of chelating agents, acidification, phosphate solubilization and redox changes, and therefore, have potential to enhance phytoremediation processes. Phytoremediation strategies with appropriate heavy metal-adapted rhizobacteria have received more and more attention. Especially, some plant growth-promoting bacteria associated with plant roots also may exert some beneficial effects on plant growth and nutrition through a number of mechanisms such as N2 fixation, production of phytohormone sandsiderophores, and transformation of nutrient elements when they are either applied to seeds or incorporated into the soil. The use of rhizobacteria in combination with plants is expected to provide high efficiency for phytoremediation. Therefore, the potential and the exact mechanism of rhizobacteria to enhance phytoremediation of soil heavy metals pollution have

114

Microbes: In Action

recently received some attention. The roots of plants interact with a large number of different microorganisms, with these interactions being major determinants of the extent of phytoremediation. The functioning of associative plant-bacterial symbioses in heavy-metal-polluted soil can be affected from the side of both the micropartner (plant-associated bacteria) and the host plant. Soil microbes play significant roles in recycling of plant nutrients, maintenance of soil structure, detoxification of noxious chemicals, and control of plant pests and plant growth. Thus, bacteria can augment the remediation capacity of plants or reduce the phytotoxicity of the contaminated soil. In addition, plants and bacteria can form specific associations in which the plant provides the bacteria with a specific carbon source that induces the bacteria to reduce the phytotoxicity of the contaminated soil. Alternatively, plants and bacteria can form nonspecific associations in which normal plant processes stimulate the microbial community, which in the course of normal metabolic activity degrades contaminants in soil. Plants roots can provide root exudate, as well as increase ion solubility. These biochemical mechanisms increase the remediation activity of bacteria associated with plant roots. To sum up, the adaptation capabilities of both partners of the associative symbiosis as well as the bioremediation potential of the microsymbiont are of importance in minimizing the detrimental effect of heavy-metal pollution. Rhizobacteria and Phytoremediation Rhizosphere microorganisms, which are closely associated with roots, have been termed plant growth promoting rhizobacteria (PGPR). Plant growth-promoting rhizobacteria include a diverse group of free-living soil bacteria that can improve host plant growth and development in heavy metal contaminated soils by mitigating toxic effects of heavy metals on the plants. It is wellknown that heavy metals can even be toxic for metal-accumulating and metal-tolerant plants, if the concentration of metals in the environment is sufficiently high. This is partly attributable to iron deficiency in a range of different plant species in heavy metal contamination soil. Furthermore, the low iron content of plants that are grown in the presence of high levels ofheavy metals generally results in these plants becoming chlorotic, since iron deficiency inhibits both chloroplast development and chlorophyll biosynthesis. However, microbial iron-siderophore complexes can be taken up by plants, and thereby serve as an iron source for plants. It was therefore reasoned that the best way to prevent plants from becoming chlorotic in the presence of high levels of heavy metals was to provide them with an associated siderophore-producing bacterium. This suggests that some plant growth-promoting bacteria can significantly increase the growth of plants in the presence of heavy metals including nickel, lead and zinc, thus allowing plants to develop longer roots and get better established during early stages of growth. Once the seedling is established, the bacterium can also help the plant acquire sufficient iron for optimal plant growth. Similarly, chromium-resistant pseudomonades, isolated from paint industry effluents, were able to stimulate seed germination and growth of Triticumaestivus in the presence of potassium dichromate. In this case, the bacterial enhancement of seedling growth was associated with reduced chromium uptake. The effect of adding K. ascorbata

Phytoremediation

115

SUD165, a plant growth-promoting bacterium, to canola or tomato seeds before the seeds germinate, was also examined in the presence of inhibitory concentrations of Ni2+. The results of these experiments showed that at all concentrations of nickel tested (1 to 6 mmol/L Ni), using both a low level and a high-level bacterial cell treatment (cell suspension absorbance of 0.025 or 0.50, respectively), with both canola and tomato plants, with both roots and shoots, and in both pouches and pots, the addition of K. ascorbata SUD165 significantly decreased the toxicity of the added nickel. Bacteria in the rhizosphere are involved in the accumulation of potentially toxic trace elements into plant tissues. It was found that axenic saltmarsh bulrush plants supplied with different rhizosphere bacteria accumulated (70±80)% higher Se concentrations in their roots and (40±60)% higher Se concentrations in shoots than plants grown under axenic conditions. Four out of the six bacterial strains tested significantly enhanced Se accumulation in roots and shoots of axenic plants when they were added as pure cultures. A mixture of the six bacterial strains tested also enhanced Se accumulation in axenic bulrush plants. However, there were some opposite view points that the presence of ectomycorrhizal or vesicular-arbuscular fungi on the roots of plants decreased the uptake of metals by the plants and thereby increased plant biomass. The reason might be that some plants involve the use of plant growth-promoting bacteria or mycorrhizal fungi to lessen the deleterious effects of heavy metals. Mechanisms of Rhizobacteria Influencing Heavy Metal Accumulation Rhziobacteria Secretion Rhziobacteria secretion may play a major role among mechanisms of phytoremediation assisted by rhziobacteria. Indirect mechanisms include preventing phytopathogens from inhibiting plant growth and development while direct mechanisms include: nitrogen fixation; synthesis of siderophores which can solubilize and sequester iron from the soil; production of phytohormones such as auxins and cytokinins, which can enhance plant growth; and solubilization of minerals such as phosphorus. Rhizobacteria produce metal-chelating agents called siderophores, which have an important role in the acquisition of several heavy metals. These organic substances have the effect of scavenging Fe3+ and significantly enhancing the bioavailability of soil bound iron. It has also been recognized that plants grown in metal-contaminated soils are often iron deficient, the production of siderophores by plant growthpromoting bacteria may help plants obtain sufficient iron. Microbial siderophores are used as iron chelating agents that can regulate the availability of iron in the plant rhizosphere. It has been assumed that competition for iron in the rhizosphere is controlled by the affinity of the siderophore for iron and ultimately decides the rhizosphere population structure. The important factors, which participate, are concentration of various types of siderophore, kinetics of exchange, and availability of Fe-complexes to microbes as well as plants. Interestingly, binding affinity of phytosiderophores for iron is less than the affinity of microbial siderophores, but plants require a lower iron concentration for normal growth than do microbes. A number of PGPR (Polyglycerolpolyricinoleate), which stimulate root growth of different plant

116

Microbes: In Action

species including Indian mustard contain the enzyme ACC deaminase (1aminocyclopropane-1-carboxylate deaminase), which hydrolyses and decreases the amount of ACC, an ethylene precursor of the plant hormone ethylene, in plants and, as a result, to decrease ethylene biosynthesis by plants. In some of the plants, ACC is exuded from roots or seeds and then taken up by the bacterium and cleaved by ACC deaminase to ammonia and α-ketobutyrate. The bacteria utilize the ammonia evolved from ACC as a nitrogen source and thereby decrease ACC within the plant with the concomitant reduction of plant ethylene and promoting root elongation. To maintain the gradient between internal and external ACC levels, the plant must exude increasing amounts of ACC. The lowering of ACC levels within the plant results in a reduction in the amount of plant ethylene and a decreased extent of ethylene inhibition of plant seedling root elongation. In addition, depending on the conditions, plant root growth may also be stimulated by IAA (Indole-3-acetic acid) produced by PGPR bound to the seeds or roots. As a matter of fact, low levels of IAA produced by rhizobacteria promote primary root elongation, whereas high levels of IAA stimulate lateral and adventitious root formation butinhibit primary root growth. Thus, plant growth-promoting bacteria can facilitate plant growth byaltering the hormonal balance within the affected plant. Similarly, although an ethylene pulse is important in breaking seed dormancy, too much ethylene can inhibit plant seed germination. As just described above, a significant portion of the damage to plants from infection with fungal phytopathogens may occur as a direct result of the response of the plant to the increased level of stress ethylene. In the presence of fungal pathogens, not only does exogenous ethylene increase the severity of a fungal infection but also inhibitors of ethylene synthesis can significantly decrease the severity of infection. Since the enzyme ACC deaminase, when present in plant growth-promoting bacteria, can act to modulate the level of ethylene in a plant, lower the stress placed on plants by the presence of heavy metals and therefore ameliorate some of the apparent toxicity of heavy metals to plants. High Surface Area-to-Volume Ratio Soil rhizobacteria, with activity and a high surface area-to-volume ratio because of their small size and therefore providing a large contact area, may have the potential to act as microbial chelates associated with phytoremediation. Indian mustard plants germinated on Se-containing media from axenic seeds coated with bacteria produced more root hairs and accumulated more Se than plants grown from axenic seeds. However, increased root surface area caused by bacteria cannot solely account for the increased heavy metals accumulation, because bacteria were not involved in the accumulation of other heavy metals. Transform Toxic Heavy Metals The efficiency of phytoremediation is also influenced by the bioavailability of metals to plants in soil. Bacteria may transform toxic heavy metals to forms that are more readily taken up into roots. For example, bacteria could enhance Se accumulation in plants by reducing selenate to organic Se, and organoselenium forms are known to be taken up at faster rates into roots than inorganic forms.

Phytoremediation

117

Soil rhizobateria can also directly influence metal bioavailability by altering their chemical properties, such as pH, organic matter content, redox state, etc. This can aid in the leaching of these contaminants from soils. The bioavailability of heavy metals in soils is a function of its solubility with pH and organic matter content being the main controlling factors. For example, a strain of Pseudomonas maltophilia was shown to reduce the mobile and toxic Cr to nontoxic and immobile Cr, and also to minimize environmental mobility of other toxic ions such as Hg, Pb, and Cd. Stimulation of Transport Protein Bacterial survival and proliferation in the environment as well as within various hosts are critically dependent on the uptake and sequestration of transition metals such as manganese, zinc, and iron. For example, cells may stringently regulate intracellular zinc levels, since high concentrations of zinc are toxic to cellular functions and have evolved several types of proteins involved in binding and transport of zinc. Bacteria may also stimulate the sulfate transport protein, located in the root plasma membrane, which also transports selenate. Inorganic Hg uptake in higher plants has not been well investigated, but has been linked to the passive uptake of lipophilic chloride complexes in phytoplankton. BIOREMEDIATION BY GENETICALLY ENGINEERED MICROBES Mechanisms of Bioremediation by Genetically Engineered Microbes Microbes can develop biological resistance to any toxic substance in the environment due to specialized jumping genes. There are two methods, ex situ and in situ, which are employed for the bioremediation of contaminated soils. In situ is the treatment of contaminated sites while ex situ refers the removal of contaminants from soil and water. The ex situ method is expensive and gives low metal extraction efficiency; this method has been applied for the decontamination of groundwater and the excavation of soil. In situ is an environmentally sound and inexpensive method that has been used for indirect reduction by biologically produced H2S by sulphate-reducing bacteria to reduce and precipitate metal. This technology harnesses naturally occurring biogeochemical processes for bioremediation. It can immobilize or to varying degrees destroy contaminants rather than transfer them from one environmental media to another. Natural attenuation occurs when physical, chemical and biological processes act to reduce the toxicity and mobility of subsurface contamination. There are some microbial processes that can influence bioremediation. Biosorption is a microbial process that can influence bioremediation and can remove positively charged metal ions as a result of their attraction to negatively charged microbial cell membranes. Heavy metals, such as Pb and Cd, have been removed from aqueous solutions through the biosorption of microbes. Biostimulation is another strategy for bioremediation which involves the enhancement of the growth and development of microorganisms by adjusting the pH, as well as levels of nutrients and oxygen in order to promote the bioremediation of contaminated sites. Bioaugmentation can contribute to bioremediation by adding genetically modified microbes to augment the activity of insufficient, indigenous microbes in order to promote

118

Microbes: In Action

the bioremediation of contaminated sites. Most bacteria secrete polysaccharides onto their outer surface in slime and capsule formation. Bacteria can reduce the metal and oxide minerals in contaminated sites under proper conditions. Microorganisms do not degrade inorganic metals but they can change oxidation states. A microbial reduction system can be used to detoxify metals from an inorganic to an organic form and vice versa. Microbes can convert toxic substances into an energy source. They can consequently grow geometrically and produce a huge biomass after decomposition. Microbes can be used for bioremediation under aerobic and anaerobic conditions. They can break down complex hydrocarbons through aerobic and anaerobic respiration. The aerobic process is a more rapid and complete system but requires an adequate supply of oxygen. It does not give rise to problematic end products, such as methane and hydrogen sulphide. The anaerobic process is a biological process in which complex hydrocarbons are converted into simpler molecules. Anaerobic microbes are important to ensure higher rates of destruction of waste molecules and are relatively cost effective and use little energy. Genetically Engineered (GE) Microbes for Remediation Environmental biotechnology indicates that microbes such as bacteria, yeast and filamentous fungi can remove heavy metals from aqueous solutions. The use of microbial metabolic potential is a safe and cost-effective method for the elimination of contaminants from contaminated sites. GE microbes, recombinant DNA and RNA technologies have all been used for successful bioremediation. Microbial genes have been tailored to create new metabolic pathways in order to enhance bioremediative processes. GE microbes may be the preferred technology due to the special attributes of their metabolic pathways. GE bacteria are an advanced technology that has attracted public attention when employed in cleaning up toxic waste and heavy metals from contaminated sites. It has also contributed to the detoxification of heavy metals and other recalcitrant compounds. The metal regulatory genes of bacteria can help them to convert toxic forms of heavy metals to less toxic forms. GE bacteria expressing metallothioneins (MT) can accelerate the accumulation of heavy metal. Types of GE bacteria involved in the bioremediation of heavy metals from contaminated sites are shown in Table 2. TABLE 2: Genetically engineered (GE) bacteria involved in the bioremediation of heavy metals (Azad MAK et al., 2014) Genetically engineered bacteria species

Targeted heavy metal

Talstonia eutropha CH43 Deinococcus radiodurans strains Escherichia Coli and Moraxella sp. E. Coli strain P. flurorescens 4F39 Mesorhizobium huakuii B3 P. putida strain E. coli SE5000

Cd2+ Hg Cd and Hg Hg Ni Cd2+ Cr Ni

Phytoremediation

119

Genetically engineered bacteria species

Targeted heavy metal

E. coli JM109 Acidithiobacillus ferrooxidans strain Pesudomonas K-62 Pseudomonas flurescens OS8; Escherichia coli MC1061; Bacillus subtilis BR151; Staphylococcus aureus RN4220 P. putida 06909 Achromobacter sp. AO22 Methylococcus capsulatus (Bath) Caulobacter crescentus JS4022/p723-6H Sphingomonas desiccabilis and Bacillus idriensis strains B. subtulis BR151(pT0024)

Hg Hg Hg Cd, Zn, Hg and Pb Cd Hg Cr Cd As Cd

Mercury is the most toxic heavy metal which can bereleased into the environment. GE Escherichia coli strainJM109 has the ability to remove mercury from contaminated water, soil or sediment. GE bacteria containing the MerA gene can remove mercury from a contaminatedsite. Transgenic bacteria expressing metallothioneins and polyphosphate kinase can promote effective mercury bioremediation. GE Deinococcus radiodurans and Pseudomonas putidia are capable of degrading organic pollutants in contaminated sites. The use oforganophosphates in agriculture, as pesticides, has beenshown to cause serious environmental pollution. GE bacteriaare capable of metabolizing chlorinated organic compounds such as lindane and trichloroethylene. Lindane (c-hexachlorocyclohexane) is extremely toxic tohumans and is deleterious for the environment. Chaurasia et al. (2013) reported that the recombinant Anabaena wasable to degrade more than 98% of the Lindane from paddy fields within 6–10 days. GE E. coli and P. putida have been found to degrade trichloroethylene, via their transformationthrough the insertion of a range of phenol catabolic genes (pheA, pheB, pheC, pheD and pheR). Marconi et al. (1997) reported that GE P. putida S12 can degrade naphthalene, toluene and biphenyl following insertion of theplasmids encoding genes for the catabolism of thesecontaminants. Chromium (Cr) is a powerfully carcinogenic metal thatcan be present in industrial wastewater. Genetically engineeredmicrobes such as Ralston metallidurans can be used for the treatment of industrial wastewater in order to removeCr. Recombinant Caulobacter spp. strain JS4022/p723-6H can remove cadmium (Cd) from industrial wastewater. Arsenic (As) is a very toxic metal which can be found in nature. GE bacteria expressing the ArsM gene has been demonstrated to remove As, through volatilization, from contaminated soil. E. coli expressing the ArsR gene can promote the bioaccumulation of as when present in contaminated soil. Nickel (Ni) is possibly the mostrecalcitrant pollutant and can be accumulated by the GEE. coli SE5000 strain from an aqueous solution. ThusGE microbes can enhance the bioremediation of heavymetals from contaminated sites. Recombinant DNA technology is a promising method for the preparation of Genetic engineered organisms (GEO) able to combat environmental pollutants for successful bioremediation. The first DNA technology for the bioremediation of petroleumrelated pollution was reported by Chakrabarty (1985). This

120

Microbes: In Action

technology can be employed for the remediation of pollution by heavy metals, chlorinated hydrocarbons, pesticides, petroleum hydrocarbons and explosives from contaminated sites. DNA shuffling is a powerful mutagenesis techniquethat can create new enzymatic activity and biocatalysts with higher degradation rates for chlorinated ethane and polyaromatic hydrocarbons. Horizontal gene transfer, a component of bacterial evolution, has played an important role in this area and has been demonstrated in many studies. The horizontal transfer of recombinant DNA, in the overall context of horizontal gene transfer among bacteria, is considered natural and is presumably a widespread phenomenon. Horizontal gene transfer is dependent on microbial density. Although there is a reasonable probability of genetic exchange between recombinant microbes and indigenous microbes the possible hazards of such genetic exchange will depend upon the traits involved. The introduction of GEO can have an indirect effect on the native flora and fauna. Horizontal gene transfer to other existing microbes could be prevented by incorporating plasmid addition systems into the cells such as antisense RNA-regulated plasmid addition and protein plasmid addition. Additionally, Davision (2002) reported that GEO do not survive well when released to the environment and are degraded before any effects on environment have occurred. Horizontal gene transfer rates in experiments in the laboratory may be greater than what actually occurs in nature. The frequency of gene transfer seems to be lower in the natural environment due to large populations of native microbial species and their inherent selective advantages, in their native environments. Pollutant-degrading microbes which have been modified through recombinant DNA technology have contributed to the bioremediation of contaminated sites. Recombinant DNA technology can facilitate the development of multiple degradative pathways, for partial or complete degradation of toxic pollutants. This aspect of recombinant DNA may be the preferred route for the degradation of xenobioticpollution. The development of bioremediation through recombinant technology is shown in Table 3. TABLE 3: Development of recombinant DNA technology for bioremediation (Azad MAK et al., 2014) Gene modification

Bioremediation strategy

Mercury biosensor Coal tar waste container detection by FISH (fluroscent in in situ hybridization Suicidal GEMs (genetically engineered microorganism) Organophosphate and carbamate pesticide degrading GEM On-line in situ biosensor Safe vectors for filed release

Mercury-inducuble mer promoter fusion with luc gene mRNA transcripts related to naphthalene dioxygenase and tyramide signal amplification Killer-anti-Killer genes susceptible to apoptosis Methyl parathion hydrolase-encoding gene (mpd) and cognate regulator Whole cell and electrochemical biosensor Pseudo wild-type bacteria having no heterologous DNA other than genes of interest

The DNA techniques have been applied to evolve dioxygenases and monooxygenases for bioremediation. This technology can improve catabolic pathways toovercome the toxic effects of particular pollutants. The

Phytoremediation

121

environmental transcriptomic procedure may be apromising method for microbial communities. Proetsky et al. developed an RNA technology for bioremediation processes such as sulphur oxidation, assimilation of C1compounds and the acquisition of nitrogen. RNA technologyis used in groundwater remediation for cDNA synthesis. Microbial communities with 16SrRNAsequences can degrade the solvent trichloroethene (TCE). Phylogenetic oligonucelotide is the most important technology for reducing sulphates on contaminated sites. In fact, 16SrRNA genes can provide the phylogeneticcharacterization of microbes which can be usedfor bioremediation of contaminated sites. Microorganismswith the 16SrRNA sequence, such as the Geobacter species, are capable of oxidizing organiccontaminants with the reduction of Fe3+. BIOREMEDIATION BY GENETICALLY ENGINEERED PLANTS Mechanisms of Bioremediation by Genetically Engineered Plants Different plant species can clean up soil and water in acost-effective and environmentally-friendly way. Plantshave some potential cellular and molecular mechanismswhich can be employed in the detoxification of heavymetals. Phytoremediation involves either removal ofcompounds or their conversion to biologically inert forms. The concept of using metal accumulating plants to removeheavy metals and other compounds was introduced in 1983. Plants can degrade pollutants on contaminated sites ina way that is economically viable and less destructive tothe environment. Plants have the ability to solubilizemetals from the soil and absorb them into their roots finally translocating them to the shoots. Some plantsrelease chelating compounds into root zones that can assist in the solubilization and uptake of metals. Manyhyperaccumulator plants excrete organic acids that canfacilitate metal uptake. Plant roots can extract metalsor radioactive contaminants from soil, polluted water and wastewater can be translocated and accumulated in differentparts of the plants. Heavy metals such as Pb and Cd from contaminated soil can be removed through phytoextraction systems; excessive selenium (Se) can also be removed using this technology. Phytostabilization is a stabilizing process that can reduce the bioavailability ofharmful contaminants in the soil through the control of As, Zn, Cd and U in contaminated sites. Manygenes are responsible for bioremediation capacities throughmetal uptake, removal and translocation. Transgenic plantshave MT genes encoding peptides, which consist of 60– 80amino acids and have 9–16 cysteine residues which can betransported to remove heavy metals from contaminated sites. Specific mechanisms should be developedfor uptake, translocation and sequestration for each metal. Transgenic plants have been developed after incorporatingmetal transporter genes such as ZAT and CAX-2 genes forenhancing the accumulation of Zn, Ca, Cd and Mn. Genetically Engineered Plants for Remediation There are crucial problems in the removal of hazardous substance from contaminated sites using physical and chemical remediation methods; due to high costs and themultifaceted nature of these approaches. Phytoremediation has advantages over other methods due to its low cost, and because it is highly

122

Microbes: In Action

efficient and environmentally friendly. Transgenic plants can exploit molecular mechanisms of detoxification via genetic engineering approaches. Many genes have been identified which are involved in metal uptake, removal, translocation and bioaccumulation. Transgenic plants have been developed by transferring these genes for metal uptake and accumulation. Transgenic plants can degrade xenobiotics as they are able to metabolize pollutants in contaminated sites. Transgenic plants expressing bacterial or mammalian genes can be used in xenobiotic metabolism for efficient phytoremediation]. Transgenic plants expressingcytochrome P450 enzymes have the potential to remove the pollutants from soil and water. The transgenic plants, such as Arabidopsis thaliana, Nicotianatabaccum, Brassica juncea, Brassica oleraceaevar botrytis, and Lycopersiconesculentum, have been used for bioremediation (Table 4). TABLE 4: development of transgenic plants for bioremediation (Azad MAK et al., 2014) Name of genes

Enzymes

Source of genes

Target plants

Biphenyl diozygenase gene bphC CYP71A10

Biphenyl dioxygenase

B. xenoborans

N. tabacum

Biphenyl catabolic enzyme Cytochrome P450 monoxygenase Peroxidase Peroxidase Cytochrome P450 monoxygenase Pentaerythritol tetranitrate reductase

Pandoraea pnomenusa Glycine max

N. tabacum N. tabacum

C. versicolor L. esculentum Rhodococcus rhodochrous

N. tabacum L. esculentum A. thaliana

Enterobacter cloacae

N. tabacum

Mn peroxidase tpxl Xpla and xplb onr

Many researchers have reported that transgenic plants can degrade chlorinated solvents, explosives, and phenol substances. After the introduction of the yeast CUP1 gene a transgenic cauliflower showed a 16-fold higher accumulation of cadmium. Mercuric ion reductase was introduced into the roots of A. thaliana which allowed the absorption of this toxic ion and the reduction of volatile mercury. After the introduction of foreign genes transgenic B. juncea demonstrated higher accumulation of Cd, Cr, Cu, Pb and Zn than wildtypeplants. Transgenic rice plants expressing human cytochrome P450 genes showed resistance to herbicides and cleaned up agrochemicals from the soil. Transgenic potato plants expressing human CYP1A1 showed more tolerance towards atrazine, chlorotoluron and pyriminobac methyl. Transgenic tobacco plants expressing maize glutathione S-transferase1 have been utilized for phytoremediation of chloroacetanilide herbicide. Transgenic tobacco plants expressing type I nitroreductase gene removed high amounts of trinitrotoluene (TNT). Macek et al. (2007) reported that transgenic plants can reduce the accumulation of agrochemicals in the environment and might play a role in the prevention and reduction of chemical contamination. This may result in the conversion of contaminated sites into safe agricultural land. Amongst the different enzymatic groups, cytochrome P450 and glutathione S-transferase play major roles in the enhanced degradation of herbicides. Transgenic trees can

Phytoremediation

123

enhance the metabolism of organic pollutants and can achieve a rapid rate of uptake of compounds. They might be suitable for bioremediation due to their robust growth, extensive root systems and large biomass. Poplar hybrids expressing rabbit CYP2E1 have been used for removing volatile hydrocarbons while TNTuptake by transgenic aspen trees was higher than that of unmodified aspen trees. Transgenic plants such as A. thaliana removed 100% of the RDX (hexahydro-1,3,5-trinitro- 1,3,5 triazine) from the selected contaminated sites while levels in areas planted with the control plant remained unchanged. Transgenic plants expressing merA and merB genes can remove mercury and transport to it to the shoot. The genetically engineered tobacco plants expressing the human cytochrome P4502E1 enhanced the metabolic degradation of TCE from contaminated sites. Transgenic plants developed through the insertion of xenobiotic degradation genes into their root systems can degrade pollutants in the environment. Transgenic plants expressing ACC deaminase genes can reduce ethylene levels. ADVANTAGES AND DISADVANTAGES OF PHYTOREMEDIATION Phytoremediation has several advantages, compared to conventional physicochemical methods, as can be seenBelow: 1. It is an aesthetically pleasing, environmentally-friendly technology. 2. It is an inexpensive technology (50 ~ 80% of the cost of current methods, or even less). In most cases, engineering costs are minimal and this technology can be applied both in situ and ex situ. 3. It is useful for treating a broad range of environmental contaminants. 4. There is minimal disruption of the environment. 5. There is the possibility of the recovery and re-use of valuable metals after harvesting processes. The harvested biomass can be reduced in volume and/or weight, by thermal, microbial, or chemical means. 6. Even if the plants are contaminated and unusable, the resulting ash is approximately 20-30 tons per 5000 tons soil. 7. Planting vegetation on a site also reduces erosion by wind and water. 8. Can leave usable topsoil intact with minimal environmental disturbance. 9. Eliminates secondary air or water-borne wastes. On the other hand, phytoremediation has a number of limitations. The disadvantages of phytoremediation are: 1. Phytoremediation is most effective only at sites with shallow contaminated soils and water (< 5 m depth). 2. It is a time-consuming process, and climate or seasonal conditions may interfere with or inhibit plant growth. 3. Organic and inorganic contaminants may be toxic to plants, and thus the survival of the plants may be affected by the toxicity of the contaminants. 4. Plants that absorb toxic contaminants may pose potential risks of transferring contaminants to the food chain. 5. Volatization of compounds may transform a groundwater pollution problem to an air pollution problem. 6. Less efficient for hydrophobic contaminants, which bind tightly to the soil.

124

Microbes: In Action

Although phytoremediation has the limitations described above, phytoremediation is increasingly recognized as a developing technology that promises effective and inexpensive cleanup of contaminated sites. APPLICATIONS OF PHYTOREMEDIATION Tata Energy Research Institute India, applies Phytoremedietion to control problems caused by Flyash. Flyash is a mixture of various heavy metals. It is generated in huge quantities by thermal power and coal energy driven industries. This flyash then becomes airborne and spreads everywhere around the production area, with the heavy metals present in it contaminating the ground water. To overcome this, seedlings of Eucalyptus and Melia are grown in abandoned flyash ponds. Appropriate amount of compost and arbuscicularmyccorhizal fungi (AFM) cultures are added to the soil which enhances establishment of the plants. AFM increases the effective root zones of plants and helps them to absorb large quantities of water and nutrients leading to better survival and growth of plants. As the plants grow, their roots hold the flyash making it less prone to become airborne. Also the AFM, which is in symbiotic association with the plant roots accumulate the heavy metal from Flyash into their mycelial network. This way, it decreases the risk of the heavy metal contaminating the ground water. FUTURE OF PHYTOREMEDIATION One of the key aspects to the acceptance of phytoextraction pertains to the measurement of its performance, ultimate utilization of by-products and its overall economic viability. To date, commercial phytoextraction has been constrained by the expectation that site remediation should be achieved in a time comparable to other clean-up technologies. So far, most of the phytoremediation experiments have taken place in the lab scale, where plants grown in hydroponic setting are fed heavy metal diets. While these results are promising, scientists are ready to admit that solution culture is quite different from that of soil. In real soil, many metals are tied up in insoluble forms, and they are less available and that is the biggest problem, said Kochian. The future of phytoremediation is still in research and development phase, and there are many technical barriers which need to be addressed. Both agronomic management practices and plant genetic abilities need to be optimised to develop commercially useful practices. Many hyperaccumulator plants remain to be discovered, and there is a need to know more about their physiology. Optimisationof the process, proper understanding of plant heavy metal uptake and proper disposal of biomass produced is still needed. CONCLUSION Phytoremediation is a fast developing field, since last ten years lot of field application were initiated all over the world, it includes Phytoremediation of Organic, Inorganic and Radionuclides. This sustainable and inexpensive process is fast emerging as a viable alternative to conventional remediation methods, and will be most suitable for a developing country like India. Most of the studies have been done in developed countries and knowledge of suitable plants is

Phytoremediation

125

particularly limited in India. In India commercial application of Phytoremediation of soil Heavy metal or Organic compounds is in its earliest phase. Fast growing plants with high biomass and good metal uptake ability are needed. In most of the contaminated sites hardy, tolerant, weed species exist and phytoremediation through these and other non-edible species can restrict the contaminant from being introduced into the food web. However, several methods of plant disposal have been described but data regarding these methods are scarce. Composting and compaction can be treated as pre-treatment steps for volume reduction, but care should be taken to collect leachate resulting from compaction. Between the two methods that significantly reduce the contaminated biomass, incineration seems to be least time consuming and environmentally sound than direct burning or ashing. REFERENCES Azad MAK, Amin L and Sidik NM (2014). Genetically engineered organisms for bioremediation of pollutants in contaminated sites. Chin Sci. Bull. 59(8):703-714 Chakrabarty AM (1985). Genetically manipulated microorganisms and their products in the oil service industries. Trends Biotechnol. 3:32-38 Chaney RL, Malik M, Li YM, Brown SL, Brewer EP, Angle JS and Baker AJ (1997). Phytoremediation of soil metals. Curr. Opinion Biotechnol. 8:279-284 Chaurasia AK, Adhya TK and Apte SK (2013). Engineering bacteria for bioremediation of persistent organochlorine pesticide lindane (c-hexachlorocyclohexane). Bioresour Technol. 149:439-445 Cunningham SD (1996). Promises and prospects of phytoremediation. Plant Physiol. 110:715719 Cunningham SD, Berti WR and Huang JW (1995). Phytoremediation of contaminated soils. Trends Biotechnol. 13:393-397 Davison J (2002). Towards safer vectors for the field release of recombinant bacteria. Environ Biosafety Res. 1:9-18 Kochian L (1996). In International Phytoremediation Conference, Southborough, MA. May 810 Kokyo O, Tiehua C, Tao L and Hongyan C (2014). Study on Application of Phytoremediation Technology in Management and Remediation of Contaminated Soils. J Clean Energy Technol. 2:1-5 Macek T, Kotrba P and Svatos A (2007). Novel roles for genetically modified plants in environmental protection. Trends Biotechnol. 26:146-152 Marconi AM, Kieboom J and Bont JAM (1997). Improving the catabolic functions in the toluene-resistant strain Pseudomonas putida S12. Biotechnol Lett. 19:603-606 Poretsky RS, Bano N and Buchan A (2005). Analysis of microbial gene transcripts in environmental samples. Appl Environ Microbiol. 71:4121-4126 Pulford ID and Watson C (2003). Phytoremediation of heavy metal-contaminated land by trees - A review. Environ Int. 29: 529-540 Raskin I, Kumar PBAN, Dushenkov S and Salt D (1994). Bioconcentration of heavy metals by plants. Curr. Opinion Biotechnol.5:285-290 Rugh C (2004). Genetically engineered phytoremediation: One man's trash is another man's transgene. Trends Biotechnol. 22:496-498 Salt DE, Blaylock M, Kumar PBAN, Dushenkov V, Ensley BD, Chet I and Raskin I (1995). Phytoremediation: a novel strategy for the removal of toxic metals from the environment using plants. Biotechnology. 13:468-474 Salt DE, Smith RD and Raskin I (1998). Phytoremediation. Annual Review Plant Physiol. 49: 643-668

126

Microbes: In Action

Scragg A (2006). Environmental Biotechnology. 2nd ed.,. Oxford University Press, Oxford, UK. pp. 204-216 Watanabe ME (1997). Phytoremediation on the brink of commercialization. Environ Sci Technol News. 31: 182-186 Yan-de J, Zhen-li H and Xiao-e Y (2007). Role of soil rhizobacteria in phytoremediation of heavy metal contaminated soils. J Zhejiang Univ Sci B. 8(3): 192-207

CHAPTER 8 A Beneficial Combination of Bioaugmentation and Phytoremediation: Rhizoremediation Jasmine Shrivastav1, Shiwani Chahal2, Abhineet Goyal3 1

Department of biotechnology, CT group of institutions, Phagwara, Punjab – 144411 India School of Agriculture Sciences, 3Division of Research and Development, Lovely Professional University, Jalandhar-144411, India. Corresponding author: [emailprotected] 2

INTRODUCTION One of the major threats to the environment and human health is pollution of soil and ground water due to extensive industrialization, extraction of natural resources and/or presence of pesticides and petroleum products. The estimated costs for cleanup of polluted sites by means of conservative methods such as burning and land filling are huge, approximately $1.7 in the United States alone. Moreover, the conservative techniques are not proven to be efficient (Dixon 1996). When wastes reduced to ashes by burning, can cause air pollution, waste from land fillings can reach ground water contaminating ground water as well as soil. Therefore, eco friendly, cost-effective and safer methods are critical to clean up the polluted areas e.g. rhizoremediation is an approach encircling desired features. Recently, bioremediation and phytoremediation has become a general operation to treat polluted areas especially for the treatment of petroleum polluted soil (Gerhardta et al., 2009) and pesticides (Fulekar, 2005). Rhizoremediation can be explained as a type of phytoremediation that implicate plants in association with rhizospheric microbes. The process can be natural or artificial by adding distinguished endophytic microbes (Gerhardta et al., 2009). Without microbial assistance, phytoremediation solely may not be an efficient method for organic hydrophobic pollutants (Chaudhry et al., 2005). This term describes both stimulation and rhizodegradation thus there is significant role of both plants and the microbes in mutualistic association. Studies have shown that microbes utilized for Rhizoremediation produce pesticide degradation enzymes which have an efficient property for the degradation of different groups of pesticides and their metabolites. Eventually Phytoremediation, Bioremediation and Rhizoremediation can be applied to the complete clean up of hazardous wastes and toxic compounds from the biosphere (Ma et al., 2011, Schroeder and Schwitzguebel 2004)

128

Microbes: In Action

Bioaugmentation The process of introducing natural microbial strains or a genetically modified variant to treat contaminated water or soil is known as Bioaugmentation. It is generally used in municipal wastewater treatment. Land, soil and groundwater which are polluted with chlorinated ethenes, for instance tetrachloroethylene and trichloroethylene, the process of bioaugmentation is used to completely degrade these contaminants into non-toxic compounds, which are ethylene and chloride (Niu et al., 2009). Phytoremediation Phytoremediation can be explained as the use of plants for counteracting pollutants present in soil structure. Such process is safe for environment and able to maintain efficiency of soil (Khan et al., 2000). Elemental pollutants as well as the organic pollutants have the tendency for phytoremediation method (Meagher, 2000). The pollutants which contains toxic heavy metals and radio nuclides are known as Elemental pollutants while organic pollutants are those which possess hydrocarbons or petroleum (Clemens et al., 2002; Cobbett and Goldsborough, 2002; Khan et al., 2000). For such types of pollutants, phytoremediation method is considered the most efficient method for cleaning up. The principle behind is extraction, collection and conversion. 1. Pollutant are extracted as well as transferred from soil to aerial tissues, 2. To inhibit spreading and leaching into ground water and/or soil, collection of the pollutant in the rhizosphere is done, and 3. Transformation of chemicals with less toxicity. Squaring above mentioned type of phytoremediation, various plant species e.g. mustard, sunflower, maize and tobacco are used on the basis of their ability to absorb or hyper accumulate the pollutants (Meagher 2000). The ability to hyper accumulate or to absorb the pollutants were found in plants which are naturally laden with heavy metals in their rhizosphere, and this was thought to form a protecting mechanism against herbivores (Gleba et al., 1999). Due to inadequacy of such plants, specificity of the hyper accumulation ability is seen. Genetic modifications of plants can provide better results of phytoremediation for instance, 104 % more lead was extracted from soil with an Indian mustard cell line as compared with the wild type. Organic pollutants. The other group of pollutants which can be treated with phytoremediation is organic pollutants, such as, polycyclic aromatic compounds, polychlorinated biphenyls, nitro aromatics, or linear halogenated hydrocarbons. This kind of pollutants can be treated completely using popular trees: alfalfa, willow, and other different varieties of grass. The knowledge of the degeneration of pollutants by metabolic system of plants is still finite with comparison to use of bacteria. Rhizoremediation Degradation of pollutants in phytoremediation occurs due to plant enzymes; whereas, in bioaugmentation cleaning of pollutants is done by microbes. In studies it's proved that, an important involvement can be micro-organisms

Rhizoremediation

129

present in the roots of plants. This involvement of the rhizo-microbes is called Rhizoremediation (Anderson et al., 1993; Schwab and Banks, 1994). Herbicides and pesticides are the main targets for degradation from soil. (Hoagland et al., 1994; Jacobsen, 1997; Zablotowicz et al., 1994). These studies imply that plants are sheltered beside these compounds by the degrading microbes. Certain plants along with various degraded pollutants are shown in Table 1. There are many advantages of using combination of plants (phytoremediation) and microbes (bioaugmentation) collectively in rhizosphere (rhizoremediation) as this causes increase in microbial load, increase in their metabolic activity, upgrading of physio-chemical properties of impure soil and foremost rise in the association between microbes in the rhizosphere and contaminated soil. (Aprill and Sims 1990; Kingsley et al., 1994; Kuiper et al., 2001; Nichols et al., 1997; Schwab et al., 1995). TABLE 1: Rhizoremediation of various environmental pollutants Plant

pollutant

microbes

reference

Prairie grasses

Polycyclic aromatic hydrocarbons Pyrene, anthracene, phenanthrene Polychlorinated biphenyls 1,4-dioxane

Not identified

Aprill and Sims 1990 Schwab et al., 1995

Grasses and alfalfa Sugar beet Poplar (Populous deltoids nigra) Wheat Oat, lupin, rape, pepper, radish, pine Fem (Azolla pinnata) Corn (Zea mays)

Not identified

Trichloroethylene Pyrene

P. fluorescens Actinomycete amycolata sp. CB1190 P. fluorescens Not identified

Diesel fuel 3-methylbenzoate

Not identified P. putida

Brazil et al., 1995 Kelley et al., 2001 Yee et al., 1998 Liste and Alexander 2000 Cohen et al., 2002 Ronchel et al., 2001

Mechanism of Rhizoremediation Rhizodegradation/Rhizoremediation is the degradation of a pollutant by raising the bioactivity of microbial populations using the rhizosphere environment of the plant. By this improved bioactivity, organic pollutants can be treated which includes transformation of harmful products into food and energy for the plants as well as for microbes. Enzymes or definite proteins produced either by the soil organism or by plants causes the breakdown of the contaminant. Basic principle on which this remediation depends is the roots which dump huge amount of photo synthetically derived hydrocarbons into the rhizosphere. Annually, the percentage of the net fixed carbon is 40-90% which plants transfer as primary and secondary metabolites, known as secretions or mucigels to roots. These metabolites have significant role in interacting with plants and their environment and therefore in the encouragement of microbial degeneration of soil pollutants by plants. Basically these metabolites encourage the expansion of microorganisms in the rhizosphere of plants, leading to loads of fungi and bacteria. Rhizosphere microorganisms, are in close association with roots, are known as Plant Growth Promoting Rhizobacteria (PGPR) and Arbuscular Mycorrhizal Fungi (AMF) (Ma et al., 2011). They live in mutual association with

130

Microbes: In Action

roots and according to mutualism both get benefited, so in this way rhizospheric microbes causes nutrient regeneration of plants, control of plant parasites, soil composition maintenance, and neutralization of toxic chemicals, (Rajkumar 2009, Mackova et al., 2006) while the plant root provide nutrition to microbes of rhizosphere, thus enhancing microbes activity and their load in the rhizosphere, which in turn, encourages growth of the plant and decreases the toxicity of metals in plants. According to the nature and properties of contaminant organisms such as bacteria, protozoa, moulds and fungi selected naturally as a source of food and energy. In nut shell, Plants supplies nutrients required for the growth of microbes, while the microbes provide a healthier soil environment for the plant growth. The rate of degeneration, metabolization, or neutralization of the contaminant in the soil depends on the performance of proteins and enzymes derived from soil organisms. Though, breakdown of pollutant is generally restricted by the availability of electron donors or acceptors, co-metabolites, inorganic nutrients, pH or water, plant vitamins and hormones. Applications of Rhizoremediation Rhizoremediation of Petroleum-Contaminated Soil Two types of degradative methods are available for the clearance of petroleum contaminated soilmicrobial remediation and phytoremediation. Phytoremediation is a method that employs plants to degrade, stabilize, and/or remove soil pollutants. Phytoremediation has been proved an effective technology for hydrocarbons in the agricultural field (Gurska et al., 2009). Recently, Rhizoremediation and phytoremediation which involves both plants and their associated rhizosphere microbes has been proved an effective method for degradation of petroleum. This process can be applied by introduction of specific microbes and also can occur naturally (Gerhardta et al., 2009). Naturally it is observed in few cases that contamination of crude oil leading in sudden change in the bacterial community structure, an elevating abundance of hydrocarbon-degrading microorganisms and fast rate of oil degradation and sufficient supply of nutrients to soil (Coulon et al., 2006; Hamamura et al., 2006). The microbial remediation and phytoremediation greatly differs on the basis of degradation rates, depending on several conditions. Different species of microorganisms that are both inhabitant to the soil and added as effective degrading strains can enhance microbial degradation. Higher than 40% microbial degradation is generally observed within 1 year of disposal and 70% in some cases (Sathishkumar et al., 2008). There are many enhancing factors for microbial remediation which includes soil moisture content, oxygen supply, nutrients, soil temperature, soil pH, soil texture, oxidation-reduction potential and soil structure (Riser-Roberts, 1998). However, the rate of degradation is generally low in phytoremediation; it ranges from 9.1% to 20% higher than the control soil (Brandt et al., 2006; Euliss et al., 2008). Accordingly, bioaugmentation is necessary to improve the efficiency of Rhizoremediation by introducing effective microorganisms. Rhizoremediation showed a higher rate of degradation of petroleum pollutants than phytoremediation and microbial remediation (Gurska et al., 2009; Xin et al., 2008; Escalante-Espinosa et al.,

Rhizoremediation

131

2005). To understand the mechanisms of remediation and the effectiveness of remediation technique, a number of rhizoremediation experiments were conducted and compared to further understand that how rhizoremediation process is affected by different factors and how the remediation process can be utilized for better disposal of petroleum-contaminated soil. Rhizoremediation of Pesticides Pesticides are such harmful substance which exists in the environment and causing problems to human health. Pesticides waste generated through chemical processing in pesticide industry and their commercial, agricultural and domestic usages have enhanced the level of hazardous environmental contaminants. Pesticides wastes find their ways in soil-water causing environmental pollution. Pesticides contamination in soils, surface water and ground water poses major environmental problem worldwide. Environmental management of the pesticides has become a major concern to the environmentalists. Herbicides and pesticides were first compounds studied for their degeneration of compounds in the rhizosphere. (Hoagland et al., 1994; Jacobsen, 1997; Zablotowicz et al., 1994). Recent studies have demonstrated that pesticide-degrading enzymes are produced by plants and rhizosphere associated microbes which neutralize different types of pesticides and their metabolites with significant efficiency. Thus, rhizoremediation appears to be a novel technology for exterminate of pesticides from the polluted soil. Pesticides are degraded into safe compounds by bacteria, fungi, and other microbes which utilize pesticides as a source of energy and carbon. Plant species which shows microbial degradation of pesticides in the rhizosphere mentioned in table 2. The butachlor degradation can be done effectively in rhizosphere of Wheat plant and especially in the rhizosphere with bacterial community and is capable of butachlor degradation. One recent study suggested that the coordinated use of forbearing plant species and rhizospheric microbial inoculation can increase the degradation rate and can be utilized for the practical applications like in situ remediation of contaminated soils (Abhilash et al., 2011). TABLE 2: Plant

Pesticide

Summary

Reference

Rice

Benthiocarb

Sato 1989

Corn

Atrazine

Eightfold increase in heterotrophic bacteria in the rhizosphere Increase population of atrazine degradation Increased mineralization compared to non rhizosphere soils Pseudomonas fluorescens and Chrysobacterium indologenes Increased degradation in rhizo-sphere soils Selective enrichment of degraders in rhizosphere soil

Kochia

Atrazine, Metalachlor and Trifluralin Zinnia anguistifolia Mefenoxam Rye grass

Chlorpyrifos

Pennisetum pedicellatum

Chlorpyrifos Cypermethrin Fenvalerate

Seibert et al., 1981 Anderson et al. (1994) Pai et al. (2001) Korade and Fulekar (2010) Dubey and Fulekar 2011

132

Microbes: In Action

CONCLUSION Soil is the necessity of living beings. It is being polluted by various organic and inorganic pollutants due to rapid industrialization and use of agrochemicals in open environment. Restrictive and effective clean up measures to avoid hazards from contaminated soil belong to the health-giving soil protection. The method of rhizoremediation could solve some of the major problems encountered during the application of bioaugmentation and phytoremediation. Many studies have shown that polluted sites can be reutilized and re-established by employing rhizoremediation method. REFERENCES Abhilash PC, Srivastava S, Srivastava P, Singh B, Jafri A and Singh S (2011). Influence of rhizospheric microbial inoculation and tolerant plant species on the rhizoremediation of lindane Environmental and Experimental Botany, Elsevier. Anderson TA, Guthrie EA and Walton BT (1993). Bioremediation in the rhizosphere. Environ. Sci. Technol. 27:2630-2636 Aprill W and Sims RC (1990). Evaluation of the use of prairie grasses for stimulating polycyclic aromatic hydrocarbon treatment in soil. Chemosphere 20:253-265 Brandt R, Merkl N, Schultz-Kraft R, Infante C and Broll G (2006). Potential of vetiver (Vetiveria zizanioides (L.) Nash) for phytoremediation of petroleum hydrocarboncontaminated soils in Venezuela, Int. J. Phytoremediation. 8: 273-284 Chaudhry Q, Blom-Zandstra M, Gupta S and Joner EJ (2005). Utilising the synergy between plants and rhizosphere microorganisms to enhance breakdown of organic pollutants in the environment. Environmental Science Pollution Res. 12: 34-48 Clemens S, Palmgren MG and Kramer U (2002). A long way ahead: understanding and engineering plant metal accumulation. Trends Plant Sci. 7: 309-315 Cobbett C and Goldsborough P (2002). Phytochelatins and metallothioneins: roles in heavy metal detoxification and homeostasis. Annu. Rev. Plant. Biol. 53:159-182 Coulon F, McKew BA, Osborn AM, McGenity TJ and Timmis KN (2006). Effects of temperature and biostimulation on oil degrading microbial communities in temperate estuarine waters. Environ Microbiology. 9: 177-186 Dixon B (1996). Bioremediation is here to stay. ASM News. 62:527-528 Dua M, Sethunathan N and Johri AK (2002). Biotechnology and bioremediation: successes and limitations. Appl Microbiology Biotechnol. 59:143-152 Escalante-Espinosa E, Gallegos-Martinez ME, Favela-Torres E and Gutierrez-Rojas M (2005). Improvement of the hydrocarbon phytoremediation rate by Cyperus laxus Lam. inoculated with a microbial consortium in a model system. Chemosphere. 59: 405-413 Euliss K, Ho CH, Schwab AP, Rock S and Banks AK (2008): Greenhouse and field assessment of phytoremediation for petroleum contaminants in a riparian zone. Bioresource Technol. 99:1961-1971 Fulekar MH (2005). Bioremediation technologies for environment. Indian Journal for Environmental Protection. 25: 358-364 Gerhardta KE, Huang XD, Glicka BR and Greenberg BM (2009). Phytoremediation and rhizoremediation of organic soil contaminants: Potential and challenges. Plant Sci. 176: 20-30 Gleba D, Borisjuk NV, Borisjuk LG, Kneer R, Poulev A, Skarzhinskaya M, Dushenkov S, Logendra S, Gleba Y and Raskin I (1999). Use of plants roots for phytoremediation and molecular farming. Proc. Natl. Acad. Sci. USA. 96: 5973-5977 Gurska J, Wang WX, Gerhardt KE, Khalid AM, Isherwood M, Huang XD, Glick BR and Greenberg BM (2009). Three year field test of a plant growth promoting rhizobacteria enhanced phytoremediation system at a land farm for treatment of hydrocarbon waste. Environ. Sci. Technol. 43(12): 4472-4479

Rhizoremediation

133

Hamamura N, Olson SH, Ward DM and Inskeep WP (2006). Microbial Population Dynamics Associated with Crude-Oil Biodegradation in Diverse Soils. Appl. Environ. Microbiol. 72: 6316-6324 Hoagland RE, Zablotowicz RM and Locke MA (1994). Prop nil metabolism by rhizosphere micro flora. In: Bioremediation through Rhizosphere Technology. TA Anderson and JR Coats, eds. American Chemical Society, Washington, DC Pages. pp. 160-183 Jacobsen CS (1997). Plant protection and rhizosphere colonization of barley by seed inoculated herbicide degrading Burkholderia (Pseudomonas) cepacia DB01 (pR0101 ) in 2, 4 D contaminated soil. Plant and Soil. 189:139-144 Khan AG, Kuek C, Chaudhry TM, Khoo CS and Hayes WJ (2000). Role of plants, mycorrhizae and phytochelators in heavy metal contaminated land remediation. Chemosphere. 41:197207 Kingsley MT, Fredrickson JK, Metting FB and Seidler RJ (1994). Environmental restoration using plant-microbe bioaugmentation. In: Bioremediation of Chlorinated and Polyaromatic Hydrocarbon Compounds. Hinchee RE, Leeson A, Semprini L and Ong SK, eds. Lewis Publishers, Boca Raton, FL, USA. pp. 287-292 Kuiper I, Bloemberg GV and Lautenberg BJJ (2001). Selection of a plant-bacterium pair as a novel tool for rhizostimulation of polycyclic aromatic hydrocarbon-degrading bacteria. Mol. Plant-Microbe Interact. 14:1197-1205 Mackova M, Dowling D and Macek T (2006). Phytoremediation Rhizoremediation Springer pp. 300 Meagher RB (2000). Phytoremediation of toxic elemental organic pollutants. Curr. Opin. Plant Biol. 3:162-163 Nichols TD, Wolf DC, Rogers HB, Beyrouty CA and Reynolds CM (1997). Rhizosphere microbial populations in contaminated soils. Water Air Soil Pollute. 95:165-178 Nie M, Zhang XD, Wang JQ, Jiang LF, Yang J, Quan ZX, Cui XH, Fang CM and Li B (2009). Rhizosphere effects on soil bacterial abundance and diversity in the Yellow River Deltaic ecosystem as influenced by petroleum contamination and soil salinization. Soil Biol. Biochem. 41(12): 2535-2542 Rajkumar M, Ae N, Prasad MNV and Freitas H (2010). Potential of siderophore producing bacteria for improving heavy-metal phytoextraction. Trends in Biotechnology. 28(3): 142149 Rajkumar M, Prasad MNV, Freitas H and Ae N (2009). Biotechnological Applications of Serpentine Soil Bacteria for Phytoremediation of Trace metals. Critical Reviews in Biotechnology. 29(2): 120-130 Riser-Roberts E (1998). Remediation of Petroleum Contaminated Soils: Biological, Physical, and Chemical Processes, St. Lucie Press, Boca Raton, FL. Sathishkumar M, Binupriya AR, Baik SH and Yun SE (2008). Biodegradation of crude oil by individual bacterial strains and a mixed bacterial consortium isolated from hydrocarbon contaminated areas, Clean-Soil Air Water. 36: 92-96 Schroeder P and Schwitzguebel JP (2004). New cost action launched: Phytotechnologies to promote sustainable land use and improve food safety. Journal of Soils and Sediments. 4(3): 205-206 Schwab AP and Banks MK (1994). Biologically mediated dissipation of Polyaromatic hydrocarbons in the root zone. In: Bioremediation Through Rhizosphere Technology. Anderson TA and Coats JR, eds. American Chemical Society, Washington, DC. pp. 132141 Schwab AP, Banks MK and Arunachalam M (1995). Biodegradation of polycyclic aromatic hydrocarbons in rhizosphere soil. In: Bioremediation of Recalcitrant Organics. Hinchee RE, Anderson DB, and Hoeppel RE, eds. Battelle Memorial Institute, Columbus, OH, USA. pp. 23-29 Xin L, Li XJ, Li PJ, Li F, Lei Z and Zhou QX (2008). Evaluation of plant-microorganism synergy for the remediation of diesel fuel contaminated soil. Bull Environ Contam Toxicol. 81: 1924

134

Microbes: In Action

Yu YL, Chen YX, Luo YM, Pan XD, He YF and Wong MH (2003). Rapid degradation of butachlor in wheat rhizosphere soil. Chemosphere. 50(6): 771-774 Zablotowicz RM, Hoagland RE and Locke MA (1994). Glutathione S-transferase activity in rhizosphere bacteria and the potential for herbicide detoxification. In: Bioremediation Through Rhizosphere Technology. TA Anderson and JR Coats, eds. American Chemical Society, Washington,DC.pp.184-198

CHAPTER 9 Factors Affecting Diversity of Rhizospheric Fungal Population Sangeeta Singh, Sunil Choudhary, Bindu Nirwan, Kuldeep Sharma, Shiwani Bhatnagar and K K Shrivastava Forest Protection Division, Arid Forest Research Institute, Jodhpur-342001 India Corresponding author: [emailprotected]

INTRODUCTION The soil is considered as the land surface of the earth which provides the substratum for plant and animal life. The soil represents a favourable habitat for microorganisms and is inhabited by a wide range of microorganisms, including bacteria, fungi, algae, viruses and protozoa. In the numerous interactions between plants and soil, microorganisms also play a key role (Lambers et al., 2009). The rhizosphere is the zone of influence of plant roots on the associated microbiota and soil constituents and represents one of the most complex ecosystems on Earth (Jones and Hinsinger, 2008). The supply of photosynthates, as substrates to soil micro-biota, is a key fact in rhizosphere formation. More than hundreds of different fungal species inhabit the soil in an aerobic condition. The important functions of fungi are nutrient cycling, disease suppression and water dynamics, which help plants become healthier and more vigorous. Fungi can exist in both the mycelial and spore stage. Soil fungi are microscopic cells that grow in long threadlike structures or hyphae and forms mycelium. The mycelium may survive as parasite or saprophyte or remain in soil as resting structure. The vast differences in the composition of soils, together with differences in their physical characteristics and the agricultural practices by which they are cultivated, result in corresponding large differences in the microbial population, both in total numbers and in kinds. The great diversity of the microbial flora makes it extremely difficult to determine accurately the total number of microorganisms present. Knowledge about fungal diversity scaling relationships relative to that of plants is important to understand ecosystem functioning (Zachow et al., 2009). There is a strong positive relationship between plant diversity and above-ground plant biomass, although in fungicide-treated assemblages this relationship disappears (Maron et al., 2011). Fungal diversity studies have traditionally relied on morphologic and other phenotypic characteristics, and these were for many years the main criteria for fungal classification (Bartnicki-Garcia, 1987). However, due to the instability of morphological traits, the existence of intermediate forms and the phenotypic

136

Microbes: In Action

overlap between different taxa (Photita et al., 2005), these methods alone do not enable a reliable identification of fungi at lower taxonomic levels (Feau et al., 2009), even at the light of modern techniques (Chapela, 1991). Molecular taxonomy has partially solved this problem, allowing for better species classification of fungi (Guarro et al., 2011). Soils are among the most diverse and densely populated microbial habitats on Earth, harboring high taxonomic and functional fungal diversity (Fierer et al., 2012). Studies focused on soil mycobiome have revealed fungal diversity to be influenced by soil stratification and vegetation coverage (Baldrian et al., 2012). Analysis of litter and organic horizons from spruce (Picea abies) forest in Central Europe and plantations from the Morvan Mountains in France identified Basidiomycota and Ascomycota as the prevalent fungal sequences. Basidiomycota accounted for 65% and 28% of OTUs in soils from oak plantations and spruce plots, respectively (Buee et al., 2009). Sequences assigned to the Glomeromycota were identified in a low proportion (2.24%) in the first environment and were not found in the second (Buee et al., 2009). This spatial heterogeneity seems to be determined by the host tree and soil organic matter composition. The ITS region amplification in this study was designed for Dikarya, and this fact may explain the low occurrence of Glomeromycota in these datasets. In another study, Ascomycota was the most prevalent fungal kingdom, accounting for 36.7 to 93% of all OTUs, for most samples from different ecosystems across Italy and France (Orgiazzi et al., 2013). Uroz et al. (2013) evaluating the microbial communities in soil of a spruce plantation (France) using a combined 454 and illumina sequencing approach, reported that only 0.2% of the annotated reads have a significant match to fungi, and these are more abundant in the organic horizon than in the mineral horizon of the soil. Arfi et al. (2012) used internal transcribed spacer (ITS) rDNA pyrotag sequencing to evaluate the fungal diversity in anoxic-sulfidic sediments in mangrove soil and found that 50% of the reads belong to Basidiomycota, mainly to the Agaricomycete class. Sistotremastrum, a saprobe fungus usually found in association to rotten wood (Norden and Paltto 2001) is the dominant fungal genera in this environment. Moreover, many ubiquitous plant pathogens and degraders, such as Alternaria, Galactomyces, and Penicillium, were detected. Through the use of a metagenomic approach, it has been shown that agricultural practices affect fungal diversity in soil (Lienhard et al., 2013). Rascovan et al. (2013) used 454-FLX Titanium chemistry to perform a deep sequencing of the Argentinean Pampean soil metagenome (36 shotgun libraries totaling 17.8 million reads or 7.7 GB). In this study, only 1% of the reads were identified as Eukarya, and among these, 27% are of fungal origin. This high quality metagenomic dataset (PAMPA datasets) has per-sample associated metadata and is publicly available. METHODS OF STUDYING SOIL MICROBIAL DIVERSITY Microbial diversity can be assessed in two different ways 1. Culture dependent method: using serial dilution method on specific media. 2. Sieving method: as for mycorrhizal fungi. 3. Culture independent Method: by direct amplification, cloning restriction digestion and sequencing of internal transcribed spacers (ITS).

Diversity of Rhizospheric Fungal

137

CULTURE DEPENDENT METHOD The total numbers of culturable fungi are determined as colony forming units (CFUs) using dilution plate method. The manure treatment had the largest CFUs for fungus. Compared with culture-independent approaches, traditionally used culture-dependent methods have a limited capacity to characterize microbiota. Nevertheless, for almost a century the latter have been optimized to detect and quantify relevant bacteria. A pertinent question is if culture-independent diversity surveys give merely an extended perspective of the bacterial diversity or if, even with a higher coverage, focus on a different set of organisms. Soil bacteria comprise a largely untapped resource for improvements in environmental and biomedical sciences, yet only 1-10% is culturable in the laboratory (Hirsch and Valdes, 2009). This poor representation has been attributed to the stringent growth demands and low growth rate of some species (Torsvik et al., 1990). Developing culture-dependent protocols that identify unique bacterial operational taxonomic units (OTUs) is an important research topic in soil bacterial ecology. Establishing new OTUs in culture will permit the study of their morphology and physiology that may advance agriculture and pharmacology. Culturability may be improved by employing different media to satisfy inherent preferences of growth substrate utilization. Therefore, soil extract agar, R-2A agar and 1% nutrient agar were used in this study. Soil bacteria were isolated in the winter from Abernathy Field Station, a Marcellus shale temperate forest in Washington, Pennsylvania. Monitoring bacterial diversity in this ecosystem can be used to assess the early environmental consequences of anthropological factors, such as hydraulic fracturing in the Marcellus shale region. For long term monitoring, this sample collection was analyzed in conjunction with previous years' assessments. Isolates were analyzed taxonomically and phylogenetically. Unique OTUs were identified through comparative analysis of 16S rDNA. The Shannon-Weaver and Simpson's diversity indices ranked isolates on soil-extract agar highest for species richness. Rarefaction analysis suggested that sampling saturation of OTUs identified on soil-extract agar had not yet been reached. Each medium studied supported isolates of four common phyla: Actinobacteria, Bacteroidetes, Firmicutes, and Proteobacteria. Soil-extract agar supported the greatest proportion of pigmented colonies including a cyanobacterium with intra-16S rDNA polymorphism. Each medium supported the growth of unique OTUs and genera with Bacillus, Flavobacterium, Pseudomonas, Rhizobium, and Streptomyces found on each. This study suggests that utilizing different media can increase the culturability of soil bacteria, giving a wider representation of soil bacterial communities. SIEVING METHOD Sieving method of isolation of fungi is usually done for isolation of VAM. The process involves wet sieving, centrifugation and decanting (Gupta and Mukerji, 2002; Ianson and Allen, 1986; Parkinson and Williams, 1960; Smith and Skipper, 1979; Yamato et al., 2008; Rillig et al., 2002). During 1963 also Gerdemann and Nicolson had isolated Spores of mycorrhizal Endogone species extracted from soil by wet sieving and decanting.

138

Microbes: In Action

CULTURE INDEPENDENT METHOD Un-culturability is a broad sense condition that includes: (i) organisms for which the specific growth requirements (nutritional, temperature, aeration, etc.) are not available; (ii) slow-growing organisms, out-competed in the presence of fast-growing microorganisms and (iii) injured organisms, which cannot stand the stressful conditions imposed by cultivation. These categories, which are not necessarily related with specific taxonomic groups (Amann et al., 1995; Vartoukian et al., 2010). Based on the analysis of the total DNA of the community, culture independent methods are supposed to detect a considerable fraction of the uncultivable organisms, eventually in addition to those that can be cultured. Nevertheless it is not self evident that culture dependent and culture-independent methods overlap on the detection of culturable organisms. For studies related with risk assessment and public health issues, as for example, the search of virulence or antibiotic resistance traits, often measured in cultivable organisms, it would be important to use culture-independent approaches in complement of culture-dependent methods, as a way to infer the significance of a specific taxonomic group in the whole community. Culture independent methods included DGGE and 454 pyrosequencing. DGGE based on the analysis of the 16S rRNA gene sequence has become one of the most popular methods to assess bacterial diversity in environmental samples (Muyzer and Smalla 1998; Fromin et al., 2002; Haack et al., 2004; de Figueiredo et al., 2007). Even though, some studies demonstrated that soil microbial populations revealed by DGGE can represent less than 1% of the total community (Muyzer et al., 1993; Murray et al., 1996). The 454 pyrosequencing is a timely DNA sequencing technique that allows the generation of short reads rapidly and inexpensively, with accuracy and avoiding cloning bias (Ronaghi and Elahi 2002; Krause et al., 2008). The culture-independent methods revealed the immense diversity of uncultured organisms, and thus, highlighted the need to implement complementary approaches for the analysis of microbial diversity (Amann et al., 1995; Palleroni 1997; Hugenholtz 2002; Kemp and Aller 2004; Venter et al., 2004; Alain and Querellou 2009). Metagenome sequencing is very informative with regard to the microbial community composition and it is becoming increasingly useful in the new field of quantitative metagenomics (Frank and Sorensen 2011). The use of the ribosomal RNA gene and its variable regions as taxonomic markers for the classification of prokaryotes is well established (Ferrer, et al. 2013) and the advantages and disadvantages of using them in the taxonomic profiling of metagenomes have been discussed (Tringe and Hugenholtz 2008; and Kampfer and Glaeser 2012). A considerable effort has also been made to establish similar universal molecular markers for fungal taxa (Feofilova, 2001; Schoch et al. 2009). Fungal molecular taxonomic studies were intensified in the early 1990s and have relied heavily on the analysis of the nuclear ribosomal gene cluster, which comprises the 18S or small subunit (SSU), the 5.8S subunit, and the 28S or large subunit (LSU) genes (Hibbett et al., 2007). However, while the SSU and LSU are very efficient in the differentiation of high taxonomic levels, they are not as good for intraspecific resolution. The ITS1 and ITS2 regions were shown to be more suitable markers for fungal phylogenetic studies due to their high degree of

Diversity of Rhizospheric Fungal

139

interspecific variability, conserved primer sites, and multicopy nature in the genome. The utilization of the ITS regions as universal DNA barcode markers for fungi was formalized by Schoch and collaborators (Schoch et al., 2012). This study tested the potential of four markers (ITS, LSU, SSU, and rpb1), with ITS having superior species resolution for a broad range of taxonomic groups. The ITS region was also shown to be useful for intra-specific differentiation. Vialle et al., (2009) also tested the potential of 14 mitochondrial genes encoding subunits of the respiratory chain complexes for Basidiomycota DNA barcodes. They observed that some candidate genes have the in silico potential for barcoding. EFFECT OF ROOT EXUDATED ON SOIL FUNGAL COMPOSITION AND DIVERSITY Plants are in constant contact with a community of soil biota that contains fungi ranging from pathogenic to symbiotic. It was observed that plant species can maintain resident soil fungal populations but cannot maintain nonresident soil fungal populations. The effects of adding in vitro-generated root exudates to the soil fungal community were qualitatively and quantitatively similar to the results observed for plants grown in those same soils. A net increase in fungal biomass was observed when nonresident root exudates were added to resident plant treatments, suggesting that increases in specific carbon substrates and/or signaling compounds support an increased soil fungal population load (Broeckling et. al., 2008). Soil fungi are involved in various biological processes and control transformation of organic matter and nutrient availability (Falkowski et al., 2008; Singh et al., 2010). The network of fungal hyphae is essential for the conservation of the soil structure (Rillig and Mummey 2006). Mycorrhizal fungi colonize plant roots and enhance plant productivity by facilitating plant nutrient uptake (Wardle et al., 2004; van der Heijden et al., 2008), as well as conferring plant resistance or tolerance to biotic and abiotic stresses (root pathogens, heavy metals, drought) (Clark and Zeto 2000; Turnau and Haselwandter 2002). Pathogenic fungi may nevertheless have negative effects on ecosystem functioning by reducing plant productivity (van der Heijden et al., 2008). Because of this importance of fungi for ecosystem processes, a number of studies have sought to identify and quantify the key factors that regulate the structure and diversity of soil fungal communities. Among these, it has been shown that plant species identity influences the composition and the abundance of soil fungal communities. For example, studies conducted by Costa et al. (2006) using molecular fingerprints have shown the effect of plant species on fungal rhizosphere communities of strawberry and oilseed. Similarly, Arfi et al. (2012) demonstrated in a mangrove ecosystem that the distribution of fungal communities was influenced by plant host specificity. More generally, numerous studies have indicated the effects of plant species on soil fungal communities (Grayston et al., 1998; Bardgett et al., 1999; Innes et al., 2004). In general the ability of plant species to influence soil fungal communities may be related to their ecophysiological traits (Wardle et al., 1998) or to their response to stress (Bouasria et al., 2012). Plants may influence soil fungi through species-specific interactions (van der Heijden et al., 2008) and through their production of litter and root exudates (Bais et al., 2006; Millard

140

Microbes: In Action

and Singh, 2010), which vary quantitatively and qualitatively between plant species (Gransee and Wittenmayer, 2000), resulting in a unique and singular environment for soil microorganisms (Bertin et al., 2003; Berg and Smalla, 2009). The array of root-derived substances is diverse and includes signal molecules such as flavonoids that directly or indirectly influence fungi and bacteria (Akiyama and Hayashi, 2006; Standing and Killham, 2007; Steinkellner et al., 2007; Cesco et al., 2012). The degree of plant-derived effects on fungal communities, however, is strongly linked to soil organic matter content (Zinger et al., 2011), to management (fertilization or tillage), and to local climate conditions (Lekberg et al., 2007; Millard and Singh, 2010; Lekberg et al., 2011; Schnoor et al., 2011). For example, Bezemer et al. (2006) demonstrated that effects of plant species on microbial communities significantly differed when they were grown in different soil types. Hence, it is very difficult to dissociate specific plant effects from soil effects and to conclude that plant effects are modulated by soil properties. In addition to plant species, N fertilization has also been postulated as a factor that influences microbial communities by promoting the relative abundance of bacteria over fungi, as well as affecting the diversity within bacterial and fungal functional groups (Bardgett et al., 1999; Allison et al., 2007). Nitrogen fertilization could directly modify soil microorganisms by affecting mycorrhizal fungi and decomposers through the repression of enzyme activity (Fog 1988; Donnison et al., 2000; Frey et al., 2004). Moreover, because fertility alters plant traits and thereby ecosystem functioning (Wardle et al., 1998; Lavorel et al., 2011; Pakeman 2011), fertilization effects on soil microorganism communities may also be mediated by plant trait effects on soil microorganisms (De Deyn et al., 2011). EFFECT OF TILLAGE OPERATIONS Tillage operations also play a role in qualitative as well as quantitative diversity of soil fungi. In a study conducted on three tillage treatments, conventional tillage, reduced tillage and no tillage, with and without grazing. No tillage without grazing and reduced tillage with grazing had the highest densities of filamentous fungi. The mycological survey showed the presence of six genera of filamentous fungi (Nesci et al., 2006). DIVERSITY DUE TO ORGANIC FARMING Organic farming is becoming a major tool for sustaining the soil quality degraded by intensive use of synthetic chemicals for increasing crop production and therefore, use of bio-agents as biofertilizers or biopesticides is an integral part of organic farming especially in vegetable cultivation. Shrivastava et al.(2007) studied the effect of arbuscular mycorrhizal fungi (AMF) and pseudomonads as the microbial inoculants in vegetable based cropping systems under organic farming practices. They concluded that culturable microbial diversity was increased compared with the start of the experiment. EFFECT OF SOIL POLLUTION ON SOIL FUNGAL DIVERSITY The effects of Cd, Cu, Zn, and Pb on soil microorganisms and microbially mediated soil processes are reviewed. The emphasis is placed on temperate forest

Diversity of Rhizospheric Fungal

141

soils. The sensitivity of different measurements is discussed, and data compiled to compare relative toxicity of different metals. On the whole the relative toxicity of the metals (on a μg g−1 soil basis) decreased in the order Cd > Cu > Zn > Pb, but differences between different investigations were found. The influence of abiotic factors on metal toxicity is briefly discussed and especially examplified by different soil organic matter content. Evidence of tolerance and adaptation in the soil environment and the time scale involved in the evolution of a metaltolerant microbial community after metal exposure are also considered. (Baath,1989). High concentrations of heavy metals have been shown to adversely affect the size, diversity, and activity of microbial populations in soil (Val et al., 1999). High Cr contents adversely affected the size, diversity, and species richness of AMF as measured by Shannon–Weiner index (Khan, 2001). As compared to bacteria the fungal part of the microbial biomass is found to be more sensitive to heavy metals (Pennanen et al., 1996). Tardioli et al. (1997) studied the effect of olive mill waste water (OMW) on soil fungal population. They observed that S. brevicaulis and C. cladosporioides did not grow at OMW concentration higher than 50%, while at concentrations lower than 50% a growth decrease was observed. Instead, P. cyclopium was able to actively grow at all concentrations of OMW tested. Therefore, it could be concluded that the OMW can influence and modify the soil fungal homeostasis. FUTURE NEED The functioning and stability of terrestrial ecosystems are determined by plant biodiversity and species composition. However, the ecological mechanisms by which plant biodiversity and species composition are regulated and maintained are not well understood. These mechanisms need to be identified to ensure successful management for conservation and restoration of diverse natural ecosystems. Moreover, since the major limitation of molecular methods in soil microbial studies is the lack of discrimination between the living and dead, or active and dormant microorganisms, both culture-dependent and cultureindependent methods should be used to appropriately characterize soil microbial diversity. REFERENCES Baath E (1989). Effects of heavy metals in soil on microbial processes and populations (a review). Water, Air, and Soil Pollution. 47(3-4): 335-379 Baldrian P, Kolarik M, Stursova M, Kopecky J, Valaskova V, et al. (2012). Active and total microbial communities in forest soil are largely different and highly stratified during decomposition. ISME J. 6: 248-258 Bartnicki-Garcia S (1987). The cell wall in fungal evolution. In: Rayner ADM, Brasier CM, Moore D Evolutionary biology of the fungi. Cambridge University, Press, New York, NY, USA. Berg B, Ekbohm G, Soderstrom, Ekbohm G and Staaf H (1991). Reduction of decomposition rates of scots pine needle litter due to heavy-metal pollution. Water, Air, and Soil Pollution. 59(1-2): 165-177 Blaalid R, Kumar S, Nilsson RH, Abarenkov K, Kirk PM, et al. (2013) ITS1 versus ITS2 as DNA metabarcodes for fungi. Mol Ecol Resour. 13: 218-224

142

Microbes: In Action

Broeckling CD, Broz AK Bergelson J, Manter DK and Vivanco JM (2008). Root Exudates Regulate Soil Fungal Community Composition and Diversity. Appl. Environ. Microbiol. 74(3): 738-744 Brookes PC (1995). The use of microbial parameters in monitoring soil pollution by heavy metals. Biology and Fertility of Soils. 19(4): 269-279 Buee M, Reich M, Murat C, Morin E, Nilsson RH, et al. (2009) 454 Pyrosequencing analyses of forest soils reveal an unexpectedly high fungal diversity. New Phytol. 184: 449-456 Chapela IH (1991). Spore size revisited: analysis of spore populations using automated particle size. Sydowia. 43: 1-14 Edwards RA, Rodriguez-Brito B, Wegley L, Haynes M, Breitbart M, et al. (2006). Using pyrosequencing to shed light on deep mine microbial ecology. BMC Genomics 7: 57-67 Edwards RA and Rohwer F (2005). Viral metagenomics. Nat Rev Microbiol. 3: 504-510 Favaro LC, de Melo FL, Aguilar-Vildoso CI and Araujo WL (2011). Polyphasic analysis of intraspecific diversity in Epicoccum nigrum warrants reclassification into separate species. PLoS One 6: e14828 Feau N, Vialle A, Allaire M, Tanguay P, Joly DL, et al. (2009) Fungal pathogen (mis-) identifications: a case study with DNA barcodes on Melampsora rusts of aspen and white poplar. Mycol Res. 113: 713-724 Feofilova EP (2001). The Kingdom Fungi: heterogeneity of physiological and biochemical properties and relationships with Plants, Animals, and Prokaryotes. Appl Biochem Microbiol. 37: 124-137 Ferrer M, Ruiz A, Lanza F, Haange S, Oberbach A, et al. (2013). Microbiota from the distal guts of lean and obese adolescents exhibit partial functional redundancy besides clear differences in community structure. Environ Microbiol. 15: 211-226 Fierer N, Leff JW, Adams BJ, Nielsen UN, Bates ST, et al. (2012). Cross-biome metagenomic analyses of soil microbial communities and their functional attributes. Proc Natl Acad Sci USA. 109: 21390-21395 Frank JA, Sorensen SJ (2011). Quantitative metagenomic analyses based on average genome size normalization. Appl Environ Microbiol.77: 2513-2521 Gerdemann JW and Nicolson TH (1963). Spores of mycorrhizal Endogone species extracted from soil by wet sieving and decanting. Transactions of the British Mycological Society. 46(2): 235-244 Gilbert JA and Dupont CL (2011) Microbial metagenomics: beyond the genome. Ann Rev Mar Sci. 3: 347-371 Guarro J, Gene J and Stchigel AM (1999). Developments in fungal taxonomy. Clin Microbiol Rev. 12: 454-500 Gupta R and Mukerji KG (2002). Techniques for the Isolation of VAM/AM Fungi in Soil. Techniques in Mycorrhizal Studies. Eds. KG. Mukerji, C Manoharachary and BP Chamola. pp 201-216 Hibbett DS, Binder M, Bischoff JF, Blackwell M, Cannon PF, et al. (2007). A higher-level phylogenetic classification of the Fungi. Mycol Res. 111: 509-547 Hooper LV and Gordon JI (2001). Commensal host-bacterial relationships in the gut. Science. 292: 1115-1118 Ianson DC and Allen MF (1986). The Effects of Soil Texture on Extraction of VesicularArbuscular Mycorrhizal Fungal Spores from Arid Sites. Mycologia. 78(2):164-168 Kampfer P and Glaeser SP (2012). Prokaryotic taxonomy in the sequencing era-the polyphasic approach revisited. Environ Microbiol. 14: 291-317 Khan AG (2001). Relationships between chromium biomagnification ratio, accumulation factor, and mycorrhizae in plants growing on tannery effluent-polluted soil. Environment International. 26(5-6): 417-423 Maron JL, Marler M, Klironomos JN and Cleveland CC (2011). Soil fungal pathogens and the relationship between plant diversity and productivity. Ecol Lett. 14(1): 36-41 Mueller GM, Schmit JP, Leaco*ck PR, Buyck B, Cifuentes J, et al. (2007). Global diversity and distribution of macrofungi. Biodivers Conser. 16: 37-48

Diversity of Rhizospheric Fungal

143

Nesci A, Barros G, Castillo C and Etcheverry M (2006). Soil fungal population in preharvest maize ecosystem in different tillage practices in Argentina. Soil and Tillage Research. 91(12):143-149 Norden B and Paltto H (2001) Wood-decay fungi in hazel wood: species richness correlated to stand age and dead wood features. Biol Conserv. 101:1-8 Orgiazzi A, Bianciotto V, Bonfante P, Daghino S, Ghignone S, et al. (2013). Pyrosequencing analysis of fungal assemblages from geographically distant, disparate soils reveals spatial patterning and a core mycobiome. Diversity. 5: 73-98 Parkinson D and Williams ST (1960). A method for isolating fungi from soil microhabitats. Plant and Soil. 13(4): 347-355 Pennanen T, Frostegard A, Fritze H and Baath E (1996). Phospholipid Fatty Acid Composition and Heavy Metal Tolerance of Soil Microbial Communities along Two Heavy MetalPolluted Gradients in Coniferous Forests. Appl. Environ. Microbiol. 62(2):420-428 Photita W, Taylor PWJ, Ford R, Hyde KD and Lumyong S (2005). Morphological and molecular characterization of Colletotrichum species from herbaceous plants in Thailand. Fungal Divers. 18: 117-133 Rascovan N, Carbonetto B, Revale S, Alvarez R, Vazquez MP, et al. (2013). The PAMPA datasets: a metagenomic survey of microbial communities in Argentinean pampean soils. Microbiome. 1: 21 Riesenfeld CS, Schloss PD and Handelsman J (2004). Metagenomics: genomic analysis of microbial communities. Annu Rev Genet. 38: 525-552 Rillig MC, Wright SF and Eviner VT (2002). The role of arbuscular mycorrhizal fungi and glomalin in soil aggregation: comparing effects of five plant species. Plant and Soil. 238(2): 325-333 Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, et al. (2012) Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proc Natl Acad Sci USA. 109: 6241-6246 Schoch CL, Sung GH, Lopez-Giraldez F, Townsend JP, Miadlikowska J, et al. (2009). The Ascomycota tree of life: a phylum-wide phylogeny clarifies the origin and evolution of fundamental reproductive and ecological traits. Syst Biol. 58: 224-239 Shah V, Zakrzewski M, Wibberg D, Eikmeyer F, Schluter A, et al. (2013). Taxonomic profiling and metagenome analysis of a microbial community from a habitat contaminated with industrial Discharges. Microb Ecol. Smith GW and Skipper HD (1979). Comparison of Methods to Extract Spores of VesicularArbuscular Mycorrhizal Fungi. Soil Science Society of America Journal. 43(4):722-725 Srivastava R, Roseti D and Sharma AK (2007). The evaluation of microbial diversity in a vegetable based cropping system under organic farming practices. Applied Soil Ecology. 36 (2-3):116-123 Suenaga H (2012). Targeted metagenomics: a high-resolution metagenomics approach for specific gene clusters in complex microbial communities. Environ Microbiol. 14: 13-22 Tardioli S, Bann ETG and Santori F (1997). Species-specific selection on soil fungal population after olive mill waste-water treatment. Chemosphere. 34(11): 2329-2336 Tringe SG and Hugenholtz P (2008). A renaissance for the pioneering 16S rRNA gene. Curr Opin Microbiol. 11: 442-446 Uroz S, Ioannidis P, Lengelle J, Cebron A, Morin E, et al. (2013) Functional assays and metagenomic analyses reveals differences between the microbial communities inhabiting the soil horizons of a Norway spruce plantation. PLoS One 8: e55929 Val CD, Barea JM and Aguilar CA (1999). Diversity of Arbuscular Mycorrhizal Fungus Populations in Heavy-Metal-Contaminated Soils. Appl. Environ. Microbiol. 65(2):718-723 Vialle A, Feau N, Allaire M, Didukh M, Martin F, et al. (2009) Evaluation of mitochondrial genes as DNA barcode for Basidiomycota. Mol Ecol Resour. 9: 99-113 Viaud M, Pasquier A and Brygoo Y (2000). Diversity of soil fungi studied by PCR–RFLP of ITS. Mycological Research. 104 (9):1027-1032

144

Microbes: In Action

Yamato M, Ikeda S and Iwase K (2008). Community of arbuscular mycorrhizal fungi in a coastal vegetation on Okinawa island and effect of the isolated fungi on growth of sorghum under salt-treated conditions. Mycorrhiza. 18(5):241-249 Zachow C, Berg C, Muller H, Meincke R, Komon-Zelazowska M, Druzhinina IS, Kubicek CP and Berg G (2009). Fungal diversity in the rhizosphere of endemic plant species of Tenerife (Canary Islands): relationship to vegetation zones and environmental factors. The ISME Journal. 3: 79-92

CHAPTER 10 Biodegradation of Polycyclic Aromatic Hydrocarbons with Special Reference to Naphthalene Abhishek Vashishtha and Gautam Kumar Meghwanshi Department of Microbiology, Maharaja Ganga Singh University, Bikaner-334004 India Corresponding author: [emailprotected]

INTRODUCTION Environmental pollution caused by the release of a wide range of compounds, as a consequence of civilian progress, has now assumed serious proportions. Nowa-days, the elimination of pollutants and wastes from the environment has become anabsolute requirement to promote a sustainable development of our society with low environmental impact. The organic pollutants entering the environment, chiefly through oil spills and incomplete combustion of fossil fuels, contaminate both groundwater (Schwarzenbach and Westall, 1981) and agricultural lands (Jones et al., 1989). The accumulation of xenobiotics in soil and water over the years has resulted in generation of thousands of hazardous waste sites. Nitroaromatic compounds (NACs), polycyclic aromatics hydrocarbons (PAH's), NSO (nitrogen, sulfur and oxygen) compounds, constituents of crude oil, creosote discharges and many otherstogether constitute alarge and diverse group of chemicals responsible for producing widespread environmental pollution. Some larger Petroleum hydrocarbon compounds (PHC's) have long term persistence (because of their stability and hydrophobicity) in the environment with half-lives extending over many years (Eriksson et al., 2000; Kanaly, 2000). Longerpersistence results in bioaccumulation of these hydrocarbon pollutants. Many PAH's and their epoxides are highly toxic, mutagenic and/or carcinogenic to almost all living forms. Naphthalene, an aromatic compound is a bicyclic aromatic hydrocarbon commonly found in the environment and is often used as a model compound to study PAH degradation (Habe and Omori, 2003). Naphthalene, the first member of the PAH group, is a common micro-pollutant in potable water. It is produced from coal tar (coal tar contains 10% naphthalene by weight) or petroleum, condensation distillation and fractionation of coal tar or from petroleum by dealkylation of methylnaphthalenes in the presence of hydrogen (ASTDR, 2005). Naphthalene is used as a chemical intermediate in the production of phthalic anhydride, naphthol and chlorinated naphthalene.

146

Microbes: In Action

Naphthalene enters into the atmosphere through emissions and exhaust of naphthalene containing fuel oil and gasoline. Aluminum smelting industry is another major contributor of naphthalene in the atmosphere. The toxic release inventory database reports thegeneration of about 39,024,998 pounds of naphthalene related wastes and total of 2,659,941 pounds of naphthalene waste per year in United States. Naphthalene is a recalcitrant compound and because of its potential toxicity to higher organisms it is considered to be a primary irritant and the US environmental protection agency (EPA) has classified it as a priority toxic pollutant (Vandermuulen, 1981). Despite low solubility in water naphthalene is frequently encountered in effluents of complex mixtures like petroleum fractions, wood creosote and wastes of pharmaceutical companies (Mueller et al., 1987). Many of the constituents of crude oil have a negative impact on the environment and on human health and hence effective methods continue to be sought to remediate these high-volume wastes. Although a number of physicochemical methods have been used to remove these compounds from our environment, theyare not fully reliable and have many limitations. Petroleum hydrocarbons represent high-volume of global materials, most of which can be degraded or otherwise transformed by microorganisms. In fact microbial degradation represents the major route responsible for the ecological recovery of PAH's contaminated soil and water (Cerniglia, 1992). Most of the contaminants arising from industrial activities like PHC's (petroleum hydrocarbons) including naphthalene, are perhaps the best suited for bioremediation. Bioremediation is a biodegradation process in which sites contaminated with xenobiotics are cleaned up by means of bacterial bio-geochemical processes, preferably in situ. This process exploits the ability of microorganisms to reduce the concentration and/or toxicity of a large number of pollutants. Enzymatic pathways for the degradation of PHC's, which include alkanes, single-ring aromatics and polycyclic-aromatic hydrocarbons (PAH) including naphthalene, are found in an array of bacterial and fungal taxa and reports of newly discovered catabolic pathways are still common (Stauffert et al., 2013; Katsnelson et al., 2014). Biological remediation is an economically sound, versatile, environmentally acceptable and efficient treatment strategy. Presently, it has emerged as a rapidly developing field of environmental restoration. Effectiveness of naturally occurring microorganisms for field bioremediation could be enhanced significantly by optimizing certain factors like mass transfer, bioavailability and adsorption coefficient. Chemotaxis could also have an important role in enhancing biodegradation of pollutants (Samanta et al., 2002). Some microorganisms mainly from the genera Pseudomonas and Mycobacteriumare known for their capability to transform and remove a number of pollutants belonging to PHC category (Mrozik et al., 2003). High molecular weight (HMW) PAH's (four or more rings) sorbs strongly to soils and sediments and are more resistant to microbial degradation; however bicyclic compounds like naphthalene can be degraded more easily (Mrozik et al., 2003; Stauffert et al., 2013). However, while taking about bioremediation, variousfactors like production of toxic and/or dead-end metabolites, metabolite

Biodegradation of Polycyclic Aromatic Hydrocarbons

147

repression, the presence of favored substratesand the lack of inducer substratesetc, are necessary to be consideredwhen PAH persistence is evident. The low water solubility and high sorption capacity of PAH'sis often found to greatly influence their biological degradation. GENERAL PROPERTIES Polycyclic aromatic hydrocarbons (PAH's) are a group of compounds of carbon, hydrogen and sometimes nitrogen, sulfur and oxygen. They are composed of two or more fused aromatic rings in linear, angular and cluster arrangements with many structural configurations (Juhasz and Naidu, 2000). PAH are important constituent of petroleum where they may be complexed with some organometallic-constituents most notably complexing vanadium and nickel. These are thermodynamically inert molecules mainly due to the large (negative) resonance energy (Gibson and Subramanian, 1984). Many of them contain a "bay- region" and a "k- region" (Sikkema et al., 1995). The bay and kregion epoxides, which can be formed metabolically, are highly reactive, chemically as well as biologically (Sikkema et al., 1995). Phenanthrene is the simplest aromatic hydrocarbon, which contains these regions. PAH's are usually divided into two groups (on the basis of their molecular weights) - low molecular weight compounds which comprise of two to three fused benzene rings, and the high molecular weight compounds which are comprised of four or more fused benzene rings (Law et al., 2002). The chemical properties and hence the environmental fate of a PAH molecule is dependent in part upon both molecular size, i.e. the number of aromatic rings and molecular topology or the pattern of ring linkage. Ring linkage patterns in PAH's may occur such that the tertiary carbon atoms are centers of two or three interlinked rings. However, most PAH's occur as hybrids encompassing various structural components such as in the PAH benzo [a] pyrene (BaP). Generally, an increase in the size and angularity of a PAH molecule results in a concomitant increase in hydrophobicity and electrochemical stability (Harvey, 1997). The low solubility of these chemicals and their high affinity towards solid surfaces and organic liquids may cause a low availability to microbial ecosystems present in soil and sediment capable of dissipating these pollutants (Calvo et al., 2003). Melting point and boiling points of different PAH's are enlisted in table 1. Dibenz (a,h) anthracene has highest melting and boiling points whilenaphthalene has minimum. Naphthalene, the smallest of the PAH's, contains two rings, shares almost all the above said properties. It is a white, crystalline solid that can be found in the form of scales, balls, powder or cakes and has strong aromatic odor. Naphthalene is insoluble in water but is strongly soluble in benzene, ethyl alcohol, di ethyl ether, carbon tetrachloride, carbon disulfide, hydronaphthalenes and in volatile oils. Naphthalene has aromatic character and can get associated with benzene and its derivatives. It shows substitution reactions, basically substitution of hydrogen atoms by nitro groups, halogen atoms, alkyl groups and sulfonic acid. A bulk of naphthalene is converted to naphthylamines and naphthols for use as dyestuff intermediates. Like benzene,

148

Microbes: In Action

they can undergo electrophilic substitutionreactions; however itrequires milder conditions than benzene. Depending upon the substitution at an alpha or beta position, mono-substituted naphthalene's can form two isomers. Generally, naphthalene undergoes electrophiles attack at the alpha position. The preference for alphasubstitution over beta substitution can be understood in terms of resonance structures of the differentintermediates. TABLE 1: Physical and chemical properties of PAH's (Mrozik et al., 2003) PAH Phenanthrene Anthracene Fluoranthene Benz[a]anthracene Pyrene Chrysene Benzo (a) pyrene Dibenz (a,h) anthracene Naphthalene

Rings

mp1(°C)

bp2(°C)

Sol3(mg l-1)

3 3 4 4 4 4 5 5 2

101 216 111 158 149 255 179 262 80.2

340 340 250 400 360 488 496 524 218.0

1.29 0.07 0.26 0.014 0.14 0.002 0.0038 0.0005 30.6

Associated Toxicology Many PAH's are known to exert acutely toxic effects and/or possess mutagenic, or carcinogenic properties (Phillips, 1983). PAH's are highly lipid-soluble and thus readily absorbed from the gastrointestinal tract of mammals (Cerniglia, 1984). They are rapidly distributed in a wide variety of tissues with a marked tendency for localization in body fat. Metabolism of PAH's occurs via the cytochrome P450 mediated mixed oxidase system (Stegeman et al., 2001). The epoxides or phenols thus formed might get detoxified in a reaction to produce glucuronides, sulfates or glutathione conjugates. Some might metabolize into dihydrodiols, which in turncan form soluble detoxification products or get oxidized to diol-epoxides. PAH's which contains 'bay' and 'K' regions, allow metabolic formation of bay-and K-region epoxides, which are highly reactive. Carcinogenicity has been demonstrated by some of these epoxides (Goldman, 2001). Therefore, many PAH'swhich are considered to be environmental pollutants can be detrimental for the flora and fauna of affected habitats and results in the adulteration of the food chains. In some instances, they may result in serious health problems and/or genetic defects in human. They can have a negative impact on reproduction also. Consequently the US Environmental Protection Agency has listed 16 PAH's (including naphthalene) as priority pollutants for remediation (Liu et al., 2001). PAH's like phenanthreneacts as a photo sensitizer of human skin. It is a mild allergen and is mutagenic under specific conditions (Mastrangela et al., 1997). Some PAH's areweak inducer of sister chromatid exchanges and potent inhibitor of gap junction intercellular communications. Phenanthrenebeing the smallest PAH to have a bay and a k-region, is often used as a model substrate for studies on the metabolism of carcinogenic PAH's.

Biodegradation of Polycyclic Aromatic Hydrocarbons

149

Systematic exposure to naphthalene and its derivatives has been shown to cause several diseases and disturbances in human metabolism. Naphthalene gets readily absorbed into the systemic circulation following either inhalation or ingestion or dermal contact and may result in systemic toxicity. An acute inhalation exposure to naphthalene can cause signs and symptoms such as nausea, vomiting, abdominal pain, diarrhea, tachypnea, confusion, profuse sweating, tachycardia, fever, headache and agitation. In some cases this may lead to spasms and coma. The most characteristic sign of naphthalene toxicity is acute intravascular hemolysis, particularly in individuals with a deficiency of glucose 6-phosphate dehydrogenase (G6-PD) which can cause acute anemia, leukocytosis, fever, haematuria, jaundice and liver and kidney dysfunction(s). If ingested by a pregnant mother, naphthalene can cross the placenta and reach to the fetus, resulting in neonatal haemolyticanemia (ATSDR-2005). Naphthalene ingestion though not a common route of exposure, causes similar effects as are seen following acute inhalation (IPCS,2000; ATSDR, 2005). Dermal exposure of naphthalene may give rise to irritation and dermatitis and if exposed for a longer time it may result in systemic toxicity. Generally Infants are at more risk towards naphthalene-induced haemolysis. Probable reason for greater risks is- new born children are less effective in metabolizing naphthalene than the adults (IPCS-2000). Children exposed to naphthalene are susceptible to kernicterus (permanent neurological damage). This is due to the increased levels of bilirubin from the associated jaundice. This may lead to convulsions and in some cases may be fatal (ATSDR-2005). Naphthalene binds covalently to molecules present in liver, kidney and lung tissues, thereby results in toxicity; it is also an inhibitor of mitochondrial respiration (Falahatpisheh et al., 2001). Based upon the evidence came from various studies onexperimental animals, naphthalene has been anticipated to be highly carcinogenic. It causes olfactory epithelial adenoma (an uncommon nasals tumor). There are evidences which show that naphthalene has also got some carcinogenic effects on animals (Katsnelson et al., 2014). MICROBIAL DEGRADATION The persistence of these toxic pollutants in the environment can be attributed to their various physical and chemical properties. They are hydrophobic and hence sparingly water soluble (Miller et al., 2004). There high solid to water distribution ratio indicates that the PAH's tends to remain in the solid soil phase (Miller et al., 2004). With increase in number of fused benzene rings of these compounds, hydrophobicity increases but the solubility and volatility decreases (Taketani et al., 2010). Bioremediation using microbial populations or in situ attenuation seems to be the most promising method for the removal of these toxic pollutants (Miller et al., 2004). This is because this method is cost effective, exploits naturally prevailing diverse microbial communities for degradation and produces harmless end products (Juhasz and Naidu, 2000). The success of bioremediation is more for low molecular weight compounds. The high molecular weight compounds show resistance to biodegradation for many reasons. One reason may be the structural stability arising from the dense cloud of Π (pi) electrons on

150

Microbes: In Action

either side of the fused benzene rings (Johnsen et al., 2005). Moreover owing to their low solubility and a high predisposition to interact in non-aqueous phases, the high molecular weight PAH's become potentially unavailable for degradation by microbes that tend to favorably degrade compounds dissolved in water (Miller et al., 2004). In certain cases, where intrinsic bacteria are unable to meet the required demand, specific microbial degraders that have been previously selected for degrading various hydrocarbons are used. This process is called bioaugmentation. Moreover, in cases where intrinsic bacterial population is unable to grow at sustainable rates, nutrient supplements could be added to the soil so as to stimulate their persistent growth. This process is called Biostimulation. The combination of bioaugmentation and biostimulationcould result in efficient bioremediation of polluted sites (Nayak et al., 2009; Jasmine and Mukherji, 2014). A few genetically engineered microbes have also been used for bioremediation purposes. Many bacterial species possessing biodegradation potential showchemotaxis as a potential mean to achieve this goal. From the biodegradation perspective in natural environment, microorganisms having degradation capability and also show chemotaxis towards a compound would be more efficient for bioremediation than non-chemotactic microorganisms. Chemotaxis is a complex process in which bacterial cells detect temporal changes in the concentrations of specific chemicals and respond behaviorally to these changes and adapt to the new concentration of the chemical stimuli. The chemotaxis of Pseudomonas putida towards naphthalene and salicylate is a plasmid-encoded phenomenon, encoded by the catabolic plasmid NAH7 (Grimm and Harwood, 1999). Law et al., 2003 reported that bacterial chemotaxis has the potential to increase the rate of degradation of chemo attractants. They studied the effect of chemotaxis by Pseudomonas putida G7 on naphthalene mass transfer and degradation in a system in which naphthalene was dissolved in a model non-aqueous-phase liquid (NAPL). Chemotaxis by wild-type P. putida G7 increased the rates of naphthalene desorption and degradation relative to rates observed with nonchemotactic and nonmotile mutant strains. Microorganisms Involved Microorganisms play an important role in the biodegradation of hydrocarbons and their compounds. Many genera of microorganism are found to degrade aromatic compounds, with Pseudomonas and Bacillus being most extensively studied. Most of the degrader organisms degrade these compounds to remove the toxin pressure and use them as the sole source of carbon and energy (Taketani et al., 2010). Many different species of bacteria with the ability to degrade naphthalene and other PAH'shave been isolated, mostly from soil environments. P. paucimobilis, Alcaligenes denitrificans, Pseudomonas putida, Mycobacterium sp., P. fluorescens, P. vesicularis, P. cepacia, P. testosterone, Corynebacterium venale, Rhodoccus sp., Moraxella sp., Bacillus cerrus, Streptomyces sp., Vibrio sp., Cuclotrophicus sp. (Table 2) are among the bacteria which have been isolated and

Biodegradation of Polycyclic Aromatic Hydrocarbons

151

examined for the mineralization ability of naphthalene and other PAH's (Samanta et al., 2002). Acosta-González et al. (2013) reported the presence of a number of anaerobic bacterial communities having capacity to degrade aromatic compounds, in oil-polluted sub-tidal sediments. The majority of the PAH-degrading bacteria were previously found to belong to the genus Pseudomonas and the PAH-degradative gene clusters in these bacteria were highly hom*ologous to the naphthalene gene (nah gene) cluster from the NAH7 plasmid in Pseudomonas putida strain G7 (Cerniglia, 1993). Heitkamp et al. (1988) and Mueller et al. (1997) reported biodegradation of some high-molecular weight polycyclic aromatic hydrocarbons. Mueller et al. (1997), for the first time, demonstrated the microbial utilization of PAH's containing four or more aromatic rings as a sole source of carbon and energy. They reported a seven-member bacterial consortia (isolated from creosotecontaminated soil) capable of consuming fluoranthene. This consortia was also capable of co-metabolically biotransforming other high molecular weight (HMW) PAH's (Hedlund and James, 2001). Subsequently, there have been many reports of phenanthrene degradation by different bacteria including Alcaligenes faecalis, Aeromonas sp, Arthrobacter polychromogenes, A. denitrificans, Beijerinckia sp, Mycobacterium sp, Micrococcus, Pseudomonas sp etc. Kelley and Cerniigilia (1995) have isolated and characterized variety of microorganisms and elucidated new pathways for PAH degradation. Juhasz and Naidu, (2000) studied the biodegradation of four-ring PAH's namely pyrene, chrysene, fluoranthene and benz[a]anthracene. A diverse group of fungi, including Phanerochaete chrysosporium, Saccharomyces cerevisiaz, Aspergillus ochraceus, Cunninghamell aelegans and Syncephalastrum racemosum, have been reported to oxidize PAH's (Sutherland, 1992). Marine ecosystem is also known to degrade various hydrocarbons. The marine microbial communities with biodegradation potential are generally dominated by Gram-negative bacteria (Dyksterhouse et al., 1995; Cravo-Laureau and Duran, 2014). Many PAH-degrading bacteria belonging to the Grampositive nocardioforms and spore-forming Paenibacillus groups have been isolated from the rhizosphere of some salt marsh plants (Daane et al., 2001). However, there is little information on the presence of Gram-positive naphthalene-degrading bacteria in marine environments. Annweiler et al. (2000) reported a thermophilic aerobic bacterium Bacillus thermoleovorans to grow at 60°C on naphthalene as the sole source of carbon and energy. Zhuang et al. (2003) isolated three Gram-positive naphthalene-degrading bacteria namely B. naphthovorans strain MN-003, Micrococcus sp. strain MN-006 and Staphylococcus sp. strain MN-005, from oil-contaminated tropical marine sediments. The effect of microorganisms on bioavailability and biodegradation of crystalline naphthalene was studied by Volkering et al. (1993). They found bacterial growth on crystalline naphthalene. Later, Jeon et al. (2006) found that Polaromonas naphthalenivorans CJ2 is able to grow on mineral salt agar media with naphthalene as the sole carbon source and can degrade naphthalene in situ at a coal tar waste contaminated site. Many archaebacteria have also been reported to be involved in the biodegradation processes (Stauffert et al., 2014). Miralles et al. (2010) isolated a number of archaeal anoxic bacteria from coastal

152

Microbes: In Action

marine sediments. TABLE 2: Predominant bacteria involved in degradation polycyclic aromatic hydrocarbons compounds (Kumar et al., 2011) S. No.

Bacterial species/ strain

PAH's

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19

Carbazole Naphthalene Fluoranthene Phenanthrene, Naphthalene Fluorene 3hydroxy 2 formyl benzothiophene Phenanthrene, Carbazole, Dibenzothiophene Dibenzofuran Phenanthrene Chlorinated dibenzopdioxin, Carbazole Phenanthrene Fluorene, Dibenzofuran, Dibenzothiophene Pyrene Fluorene Benzo[a]pyrene Phenanthrene Phenanthrene Fluorene Phenanthrene

21 22 23 24 25 26 27 28 29 30 31 32 33 34 35

Achromobacter sp. NCW Polaromonas naphthalenivorans CJ2 Alcaligenes denitrificans Pseudomonas sp. C18, PP2, DLCP11 Arthrobacter sp. F101 Pseudomonas sp. BT1d Arthrobacter sp. P11 Pseudomonas sp. HH69 Arthrobacter sulphureus RKJ4 Pseudomonas sp. CA10 Acidovorax delafieldii P41 Pseudomonas sp. NCIB 98164 Bacillus cereus P21 Pseudomonas sp. F274 Bacillus subtilis BMT4i (MTCC9447) Pseudomonas paucimobilis Brevibacterium sp. HL4 Pseudomonas vesicularis OUS82 Burkholderia sp. S3702, RP007, 2A12TNFYE5, BS3770 Pseudomonas putida P16, BS3701, BS3750, BS590P, BS202P1 Geobacillus stearothermophilus "AAP7919" Pseudomonas saccharophilia Burkholderia cepacia BU3 Pseudomonas stutzeri P15 Burkholderi axenovorans LB400 Benzoate, Pseudomonas fluorescens BS3760 Chryseobacterium sp. NCY Pseudomonas aeruginosa Cycloclasticus sp. P1 Ralstonia sp. SBUG 290, U2 Geobacillus sp. Rhodanobacter sp. BPC1 Burkholderia sp. C3 Rhodococcus sp. Janibacter sp. YY1

36 37

Mycobacterium sp. PYR1, LB501T Marinobacter NCE312

Phenanthrene, Naphthalene Anthracene Pyrene Phenanthrene, Pyrene, Naphthalene Pyrene Biphenyl Phenanthrene, Benz[a]anthracene, Chrysene Carbazole Phenanthrene Pyrene Naphthalene, Dibenzofuran Napthalene, Phenanthrene, Fluorene Benzo[a]pyrene Phenanthrene Pyrene, Phenanthrene, Fluorene, Anthracene, Dibenzofuran Pyrene, Phenanthrene, Fluoranthene, Anthracene Naphthalene

Biodegradation of Polycyclic Aromatic Hydrocarbons

153

S. No.

Bacterial species/ strain

PAH's

38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53

Rhodococcus erythropolis I19 Mycobacterium sp. PYR, Rhodococcus erythropolis D1 Mycobacterium sp. JS14 Staphylococcus sp. PN/Y Mycobacterium sp. 6PY1, KR2, AP1 Stenotrophom*onas maltophilia VUN 10,010 Mycobacterium sp. RJGII135 Stenotrophom*onas maltophilia VUN 10,003 Rhodococcus sp. WUK2R Sphingomonas yanoikuyae R1 Mycobacterium sp. CH1, BG1, BB1, KR20 Sphingomonas yanoikuyae JAR02 Mycobacterium flavescens Sphingomonas sp. P2, LB126 Mycobacterium vanbaalenii PYR1

54 55 56 57 58 59 60 61

Sphingomonas sp. Mycobacterium sp. KMS Xanthamonas sp. Nocardioides aromaticivorans IC177 Sphingomonas wittichii RW1 Pasteurella sp. IFA Sphingomonas sp. KS14 Terrabacter sp. DBF63 ne

Sphingomonas paucimobilis EPA505

Alkylated dibenzothiophene Benzo[a]pyrene Dibenzothiophene Fluoranthene Phenanthrene Pyrene Benzo[a]pyrene, Pyrene, Fluoranthene Benzo[a]pyrene, Benz[a]anthracene, Pyrene Pyrene, Fluoranthene, Benz[a]anthracene Benzothiophene, Naphthothiophene Pyrene Pyrene, Phenanthrene, Fluorene Benzo[a]pyrene Pyrene, Fluoranthene Phenanthrene, Fluoranthene, Phenanthrene, Pyrene, Dimethylbenz[a]anthracene Dibenzofuran, Carbazole, Dibenzothiophene Pyrene Benzo[a]pyrene, Pyrene, Carbazole Carbazole Chlorinated dibenzopdioxin Fluoranthene Phenanthrene, Naphthalene Fluorene, Dibenzofuran, Chlorinated dibenzopdioxin, Chlorinated Phenanthrene, Fluoranthene, Anthracene, Naphthalene

At times, the adverse environmental conditions might not permit the survival of an efficient natural degrader in a natural ecosystem. Consequently, under natural conditions, a bio-degrader organism shows less efficiency in comparison with laboratory conditions (Timmis et al., 1994). It is possible that by enhancing the enzymatic activity of biochemical pathway(s) using genetic engineering (resulting in higher expression of necessary enzymes), enhanced degradation of many persistent compounds that are abundant in the environment, could be achieved (Timmis et al., 1994). Several genetic engineering tools such as transposition, geneduplication, gene conversion and bio-vehicles (plasmids and transposons) have provided an adequate strategy to develop GEMs (genetically engineered micro-organisms). GEMs might be constructed in such a way that they could be used as an efficient tool for bioremediation process (Ripp et al., 2000). Mechanism of Degradation Two types of metabolic pathways could be utilized by hydrocarbon-degrading

154

Microbes: In Action

heterotrophs: (a) aerobic (utilize oxygen as the primary acceptor of electrons) or (b) anaerobic (utilize an alternative electron acceptor such as sulfate or nitrate). Generally aerobic biodegradation proceeds more rapidly and is considered to be more efficient than anaerobic biodegradation; this is probably because aerobic reactions require less free energy for initiation and yield more energy per reaction (Malatova, 2005). The aromatic hydrocarbon compounds are ubiquitous in the environment and contain benzene ring in their structure (Dagley and Gibson, 1990; Paissé et al., 2012). Aromatic hydrocarbons being derivatives of benzene are quite stable and as a result they are relatively inert among the hydrocarbons and hence have different fate processes (Kastner, 1991; Suenaga et al., 2009). The roles of bacteria that participate in these processes under anoxic/anaerobic conditions during biodegradation are not completely understood. It is becoming increasingly evident that a vast array of microbial species (fungi, bacteria, algae and cyanobacteria) employ a range of tools to use both low (up to three rings or fewer) and high-molecular-weight (four or more rings) PAH's such as naphthalene, acenaphthene, pyrene, anthracene, fluoranthene and chrysene as sole source of carbon and energy (Paissé et al., 2012). Only a very few bacterial strains could utilize PAH's with more than four rings, such as benzo[a]pyrene as a source of carbon and energy, however their cometabolic transformations have been characterized (Cerniglia, 1997: Juhasz and Naidu, 2000). Aerobic Biodegradation Gibson and Subramaniam (1984) described about biochemical pathways of biodegradation of high molecular weight (HMW) aromatic compounds. It is understood that the initial step in the aerobic catabolism of a PAH molecule by bacteria occursvia oxidation of the PAH to a dihydrodiolusing a multicompotent enzyme system. These dihydrodiol intermediates may then be processed through either an ortho cleavage pathway or a meta cleavage pathway, leading to catechols. Catechols are further converted to tricarboxylic acid cycle intermediates (Fig. 1) (Sharma et al., 2012). The aerobic metabolism of aromatic compounds is characterized by the extensive use of molecular oxygen as co-substrate for oxygenases, an enzyme that introduces hydroxyl group and further cleaves the aromatic ring (Annweiler et al., 2000; Moody et al., 2001; Vila et al., 2001). The dioxygenase/ monooxygenase mediates the process of aerobic PAH catabolism. These oxygenases incorporate atoms of molecular oxygen into the aromatic nucleus and as a result aromatic ring gets oxidized (Auger et al., 1995; Sharma et al., 2012). On the basis of the substituents on the original molecule, two hydroxyl groups may be positioned either ortho (catechol and protocatechuate) or parato each other (gentisate and hom*ogentisate). The cis -dihydrodiols that are formed in this reaction are further oxidized to the aromatic di-hydroxy compounds (catechols) followed by further oxidation through the ortho or meta cleavage pathways (Baboshin et al., 2008). Finally, the reactions terminates into synthesis of the precursors of tricarboxylic acid (TCA) cycle) intermediates (Fig. 1). The degradation of most of the PAH's is carried out by this common way. However, it is the presence of number of aromatic rings which govern the kinetic efficiency

Biodegradation of Polycyclic Aromatic Hydrocarbons

155

and production of reaction intermediates of the pathway. In addition, classic dioxygenase enzymes like multicomponent naphthalene dioxygenase can catalyze desaturation, O- and N-dealkylation, monohydroxylation, dihydroxylation and sulfoxidation reactions for a wide variety of monocyclic and heterocyclic compounds (Resnick and Gibson, 1996; Paissé et al., 2012). These reactions are necessary for degradation of many compounds like dibenzop-dioxin, dibenzofurans and carbazole. The archetype carbazole 1, 9dioxygenase, obtained from Pseudomonas resinovorans CA10, has been studied in detail (Pieper et al., 2004). Researchers have given special attention on other dioxygenases associated with the biodegradation of polycyclic aromatic hydrocarbons (PAH's).

FIG. 1: Main principle of aerobic degradation of hydrocarbons: growth associated processes.

A variety of new isofunctional gene sequences have been found in various bacterial species, most notably in Rhodococcus, Mycobacterium spp. And Nocardia (Moody et al., 2001). Many novel gene sequences and gene orders, working for the PAH metabolism have been observed in a variety of strains, including Nocardiodes sp. strain KP 7- phdABCD (Sato et al., 1997), Pseudomonas sp. Strain U2 - nagAaGHAbAcAdBF (Fuenmayor et al., 1998), Burkholderia sp. strain RP007- phnFECDAcAdB (LaurieandLloyd-Jones, 1999), Rhodococcus sp. strain I24- nidABCD (Treadway et al.,1999) and Mycobacterium sp. strain PYR1, nidDBA (Khan et al., 2001). In addition to the genes known to contribute directly in PAH metabolism, some genes which provides important support functions are also known.

156

Microbes: In Action

Sphingomonas paucimobilis var. EPA500, a strain able to utilize phenanthrene, fluoranthene and naphthalene as sole carbon and energy sources, has pbhD, a gene which codes for pyruvate phosphate dikinase. The gene is supposed to be involved in the uptake of fluoranthene catabolites leaking from the cell (Story et al., 2000). Another example is the katGgene found in Mycobacterium sp. strain PYR-1. This gene encodes an 81-KDa catalase-peroxidase (Wang et al., 2000), which is thought to protect dioxygenase from inactivation by different exogenous oxidation processes and from endogenously generated H2O2which is produced during PAH metabolism (Wang et al., 2000). In addition to new gene sequences found for PAH metabolism, many strains possessing multiple genes for similar enzymes have been detected. Bosch et al. (2000) reported presence of two different genes (present on the chromosome of P. stutzeriAN10) responsible for the synthesis of salicylate 1-hydroxylase, a flavoprotein monooxygenase which converts salicylate to catechol. This was the first example of two isofunctional salicylate hydroxylases present in one strain. Ferrero et al. (2002), shown that single strain of Pseudomonas spp. can have two distinct nahAc-like genes. The degradation of naphthalene has been extensively studied in two Pseudomonas species which carry the archetypal catabolic plasmids, NAH7 (in P. putida G7) and pDTG1 (in P. putida NCIB9816-4) (Cane and Williams,1986; Khan et al., 2001). Grimm and Harwood (1997, 1999) found nahY gene on the NAH7 catabolic plasmid of P. putida G7 (Fig. 2). This gene encodes a membrane protein that may act as chemoreceptor for naphthalene or naphthalene metabolites. In fact the majority of information on PAH metabolism and associated genetics has come from studying these plasmids. This is a well characterized system in which the first operon (nahAaAbAcAdBFCED) encodes the pathway for naphthalene conversion to salicylate (upper pathway) (Fig. 2) and the second (nahGTHINLOMKJ) codes for the conversion of salicylate via catechol meta-cleavage to acetaldehyde and pyruvate (lower pathway, Fig. 2) (Platt et al., 1995). Here, naphthalene dioxygenase enzyme, which is a multicomponent nonheme iron oxygenase enzyme system, consistingof a reductase, a putative [2Fe-2S] iron sulfur centerin ferredoxin and an iron-sulfur flavoprotein, introduces molecular oxygen into aromatic nucleus. The initial reaction results in the formation of cis-naphthalene dihydrodiol. The initial product is converted to salicylate and subsequently to tri-carboxylic acid intermediates (Goyal and Zylstra, 1996; Abed et al., 2011). The regulator for both operons is encoded by a salicylate inducer which happens to be a third operon system containing nahR. Fuenmayor et al. (1998) studied the nag genes of Ralstonia sp. strain U2 which in contrast to the nah naphthalene catabolic pathway of Pseudomonas species, encode the alternative gentisate pathway. In this pathway naphthalene is converted to fumarate and pyruvate via salicylate and gentisate. The nag genes are organized in a single operon (Zhou et al., 2001). In spite of the contrasts in structural genes and their arrangements, both the nah and nag systems exhibit strikingly similar regulation. Transcription of both nag and nah operons is controlled by Lys-R-type regulatory protein (NagR and NahR, respectively). These proteins work as positive regulators for both the pathways and salicylate

Biodegradation of Polycyclic Aromatic Hydrocarbons

157

acts as an inducer.

FIG. 2: Structure of NAH7 catabolic gene and Naphthalene degradation pathway (Grimm and Harwood, 1999)

Diversity among the sequences and the presence of naphthalene catabolic genes on chromosome as well as on plasmids indicate that lateral gene transfer and genetic recombination may have played an important role in the development of these versatile metabolic pathways (Bosch et al.,2000). Anaerobic Pathway The anaerobic hydrocarbon metabolism has not been studied extensively and the role of bacteria which contribute in biodegradation processes under

158

Microbes: In Action

anoxic/anaerobic conditions is not fully understood. Many researcher shave investigated the question, whether or not the hydrocarbon biodegradation is possible under anoxic conditions? It was in late 1980s when the few groups of microorganisms were found to degrade hydrocarbons under strictly anoxic conditions. Investigations have confirmed that many microorganisms can decompose organic compounds by special biochemical mechanisms which differ completely from those employed in aerobic hydrocarbon metabolism (Riser-Roberts, 1992; Nayak et al., 2011). Anaerobic biodegradation is costeffective and advantageous in situ bioremediation technology that can be used for the recovery of soil, sediment, and ground water contaminated with petroleum hydrocarbons. To date, only a limited number of PAH's have been shown to get anaerobically biodegradedin situ (Meckenstock et al., 2004). These include the un-substituted PAH's like naphthalene, phenanthrene and alkyl-PAH's. However do PAH's having three or more aromatic rings can promote microbial growth or whether they are only partially oxidized through co-metabolism with growth substrates, is still a matter of debate (Safinowski et al., 2006). It is only within the last few decades that cultivation of few pure cultures (Galushko et al., 1999) and stable mixed cultures have enabled the study of anaerobic degradation pathways. Work with microbial consortia in enrichment cultures, in the field and in microcosms has demonstrated that hydrocarbons like alkyl benzenes (Phelps and Young, 1999), toluene (Elshahed and McInerney, 2001), branched alkanes (Boopathy, 2004), benzene (Burlandand Edwards, 1999), naphthalene and phenanthrene (Meckenstock et al., 2004), methylnaphthalene and tetralin (Annweiler et al., 2002) and hydrocarbon mixtures (Grishchenkov et al., 2000) can be metabolized under anaerobic conditions. In fact, the biological degradation of these compounds depends on the terminal electron acceptor. These reactions normally take place under sulfate-reducing, Fe(III)-reducingand denitrifying conditions (Table 3) (Boopathy, 2004; Abed et al., 2011). Organisms involved are anoxygenic photosynthetic bacteria or syntrophic consortia of proton-reducing and methanogenic bacteria including members of the β and δ subclasses of the proteobacteria. Some other terminal electron acceptors are also used during anaerobic hydrocarbon metabolism including manganese oxides (Langenhoff et al., 1997), soil humic acids and the humic acid model compound anthraquinone -2, 6- disulfonate (Cervantes et al., 2001) and fumarate in fermentative oxidation processes (Meckenstock et al., 2004). Toluene biodegradation is one of the most studied anoxic biodegradation process with respect to the characterization of enzymes used and genes involvedin the denitrifying bacteria like Thauera aromatic, Azoarcussp. strain T strain K172 and Thauerasp. strain T1 (Achong et al., 2001: Hermuth et al., 2002). In this degradation pathway, fumarate is added to toluene, a reaction mediated by benzyl succinate synthase (Fig. 3). This results in the formation of benzyl succinate followed by a series of modified - oxidation reactions (Fig. 3) (Beller and Spormann, 1998). The process of anaerobic degradation of m-xylene is in hom*ology with toluene degradation and proceeds via m-methyl benzyl succinate to m-methyl benzoyl-CoA (Widdel and Rabus, 2001). The Benzoyl-CoA so formed undergoes reductive dearomatization and ring cleavage. This is followed

Biodegradation of Polycyclic Aromatic Hydrocarbons

159

by a series of reactions which resemble those in the β-oxidation reactions of fatty acids (Widdel and Rabus, 2001).

FIG. 3: Toluene anaerobic degradation pathway. The initial reaction of anaerobic toluene degradation involves the addition of fumarate to the methyl group (Young and Phelps, 2005).

A significant work has been done on anaerobic degradation of ethyl benzene which oxidizes under the denitrifying conditions to produce 1-phenylethanol and ultimately to produce acetophenone. Acetophenone undergoes carboxylation, yielding 3-oxo-3 phenylpropionyl-COA which on thiolytic cleavage leads to the formation of acetyl COA and benzyl COA (Widdel and Rabus, 2001). Researchers used mixed-cultures to enhance the process of bioremediation (Roy and Greer, 2000) and in the process described many new metabolites (Elshahed and McInerney,2001; Meckenstock et al., 2004). TABLE 3: Anaerobic bacteria degrading different petroleum hydrocarbons under various conditions. S. No

Organism

Hydrocarbon(s) used

Anoxygenic photoheterotrophic bacteria 1. Blastochloris sulfoviridisTo P1 Denitrifying bacteria

Toluene

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12.

Toluene Ethylbenzene Toluene, m-xylene Toluene, m-xylene Toluene Benzene, toluene Benzene, toluene Naphthalene Naphthalene Toluene Toluene Naphthalene

Blastochloris sulfoviridis ToP1 Azoarcus sp. strain EB1 Azoarcus sp. strain T Azoarcus tolulyticusTd15 Azoarcus tolulyticusTo14 Dechloromonas sp. strain JJ Dechloromonas sp. strain RCB Pseudomonas sp. strain NAP Pseudomonas sp. strain NAP-3 Thauera aromatic K 172 Thauera aromaticaT1 Vibrio sp. strain NAP-4

160

S. No

Microbes: In Action

Organism

Hydrocarbon(s) used

Fe(III)-reducing bacteria 13. 14. 15.

Geobacter grbiciaeTACP-2T Geobacter grbiciaeTACP-5 Geobacter metallireducens GS15

Toluene Toluene Toluene

Sulfate-reducing bacteria 16. 17.

Desulfobacula toluolicaTo12 Desulfobacterium cetonicum

Toluene Toluene

FIG. 4A,B,C AND D: Pathways showing anaerobic degradation of naphthalene (as per Safinowski and Meckenstock, 2006).

For the first time loss of naphthalene from soil enrichments incubated with nitrate as the electron acceptor was reported by Mihelcic and Luthy (1988). In their studies, Bregnard et al. (1996) confirmed anaerobic degradation of naphthalene. In their further studies, Bedessem et al. (1997) observed mineralization of 14C-naphthalene incubated with nine various enrichment cultures under sulfate- reducing conditions. They observed variations among the lag times and degradation rates between enrichments. Langenhoff et al. (1996) reported partial degradation of naphthalene in columns of sediments under manganese, nitrate and sulfate-reducing as well as methanogenic conditions. Researchers have proposed two pathways for the initial anaerobic attack on naphthalene: 1) carboxylation to form 2-naphthoic acid and/or its CoA ester

Biodegradation of Polycyclic Aromatic Hydrocarbons

161

(Fig. 4a) (Zhang et al., 2001) and 2) methylation (Fig. 4b) followed by addition of fumarate to form naphthyl-2-methylsuccinate (Fig. 4c) (Safinowski and Meckenstock, 2006). Naphthalene is first alkylated followed by oxidation through the 2- methylnaphthalene pathway. The methyl group used is generated from bicarbonate by a reverse CO-dehydrogenase reaction (Fig. 3d). Both the pathways meet at 2- naphthoic acid. Afterwards the aromatic rings are serially reduced; first the un-substituted ring is produced followed by production of octahydronaphthoic acid (Annweiler et al., 2002; Phelps et al., 2002). Ultimately, ring cleavage takes place and results in the production of the deadend product decahydronaphthoate. Phenanthrene is the only PAH other than naphthalene, tetralinand methylnaphthalene whichhas-been investigated more closely with respect to anaerobic degradation (Zhang and Young, 1997). The initial activating reaction suggested for this substance was a carboxylation reaction, as phenanthroic acid was observed as a metabolite in culture supernatants. A similar reaction may be of importance for anaerobic biodegradation of benzothiophene. It was found that the naphthalene degrading, sulfate-reducing freshwater culture N47 was able to degrade benzothiophene to 2-carboxybenzothiophene, 5-carboxy benzothiophene and the reduced derivative dihydrocarboxy benzothiophene in a cometabolic reaction with naphthalene as the auxiliary substrate (Annweiler et al., 2001). Rockne and Strand (2001) reported naphthalene and phenanthrene degradation with denitrifying enrichment culture which they obtained from creosote-contaminated soil. They detected the incorporation of carbon from a radio labeled 14C-hydrocarbon into the biomass. The detection of 14CO2 confirmed the metabolism of labeled hydrocarbons. The degree of mineralization, however, varied considerably among substrates. They obtained partial mineralization of naphthalene (17%) while almost complete (96%) mineralization of phenanthrene. The proportion of PAH carbon incorporated into biomass also varied between substrates with naphthalene absorbing the maximum. REFERENCES Abed RMM, Musat N, Musat F and Mubmann M (2011). Structure of microbial communities and hydrocarbon-dependent sulfate reduction in the anoxic layer of a polluted microbial mat. Mar. Pollut. Bull. 62:539-546 Achong GR, Rodriguez AM and Spormann AM (2001). Benzylsuccinate synthase of Azoarcussp. strain T: cloning, sequencing, transcriptional organization, and its role in anaerobic toluene and m-xylene mineralization. J. Bacteriol. 183:6763-6770 Acosta-Gonzalez A, Rossello-Mora R and Marques S (2013). Characterization of the anaerobic microbial community in oil-polluted subtidal sediments: aromatic biodegradation potential after the Prestige oil spill. Environ. Microbiol. 15:77-92 Annweiler E, Materna A, Safinowski M, Kappler A, Richnow HH, Michaelis W and Meckenstock RU (2000). Anaerobic degradation of 2-methylnaphthalene by a sulfatereducing enrichment culture. Appl. Environ. Microbiol. 66:5329-5333 Annweiler E, Michaelis W and Meckenstock RU (2001). Anaerobic cometabolic conversion of benzothiophene by a sulfate-reducing enrichment culture and in a tar-oil-contaminated aquifer. Appl. Environ. Microbiol. 67: 5077-5083

162

Microbes: In Action

Annweiler E, Michaelis W and Meckenstock RU (2002). Identical ring cleavage products during anaerobic degradation of naphthalene, 2-methyl-naphthalene, and tetralin indicate a new metabolic pathway. Appl. Environ. Microbiol. 68:852-858 ATSDR (Agency for Toxic Substances and Disease Registry) (2005). Toxicological profile fornaphthalene, 1-methylnaphthalene and 2-methylnaphthalene. US Department. www.atsdr.cdc.gov/toxprofiles/tp67-c5.pdf Auger RL, Jacobson AM and Domach MM (1995). Effect of nonionic surfactant addition on bacterial metoabolism of Naphthalene: Assessment of toxicity and overflow metabolism potential. J. Hazrdous Materials. 43: 263-272 Baboshin M, Akimov V, Baskunov B, Born TL, Khan SU and Golovleva L (2008). Conversion of polycyclic aromatic hydrocarbons by Sphingomonas sp. VKM B-2434. Biodegradation. 19:567-576 Bedessem ME, Swoboda-Colberg NG and Colberg PJS (1997). Naphthalene mineralization coupled to sulfate reduction in aquifer-derived enrichments. FEMS Microbiol Lett. 152: 213-218 Beller HR and Spormann AM (1999). Substrate range of benzyl succinate synthase from Azoarcus sp. strain T. FEMS Microbiol. Lett. 178:147153 Boopathy R (2004). Anaerobic biodegradation of No. 2 diesel fuel in soil: a soil column study. Bioresource Technology. 94:143-151 Bosch R, Garcia-Valdez E and Moore ERB (2000). Complete nucleotide sequence and evolutionary significance of a chromosomally encoded naphthalene-degradation lower pathway from Pseudomonas stutzeri AN10. Gene. 65: 245-49 Bregnard TP, Hohener P, Haner A and Zeyer J (1996). Degradation of weathered diesel fuel by microorganisms from a contaminated aquifer in aerobic and anaerobic microcosms. Environ. Toxicol. Chem. 15: 299-307 Burland S and Edwards E (1999). Anaerobic benzene biodegradation linked to nitrate reduction. Appl. Environ. Microbiol. 65:529-533 Calvo C, Toledo FL and Gonzalez-Lopez J (2003). Surfactant activity of a naphthalene degrading Bacillus pumilus strain isolated from oil sludge. J. Biotech. 109: 255-262. Cane PA and Williams PA (1986). A restriction map of the catabolic plasmid pWW60-1 and the location of some of its catabolic genes. J. Gen. Microbiol. 132: 2919-2929 Cerniglia CE (1984). Microbial metabolism of polycyclic aromatic hydrocarbons. Adv. Appl. Microbiol. 30: 31-71 Cerniglia CE (1992). Biodegradation of polycyclic aromatic hydrocarbons. Biodegradation. 3: 351-368 Cerniglia CE (1993). Biodegradation of polycyclic aromatic hydrocarbons. Curr. Opin. Biotechnol. 4: 331- 338 Cerniglia CE (1997). Fungal metabolism of polycyclic aromatic hydrocarbons: past, present and future applications in bioremediation. J. Ind. Microbiol. Biotechnol. 19: 324-333 Cervantes FJ, Dijksma W, Duong-Dac T, Ivanova A, Lettinga G and Field JA (2001). Anaerobic mineralization of toluene by enriched sediments with quinones and humus as terminal electron acceptors. Appl. Environ. Microbiol. 67:4471-4478 Cravo-Laureau C and Duran R (2014). Marine coastal sediments microbial hydrocarbon degradation processes: contribution of experimental ecology in the omics 'era. Front Microbiol. 5:39 Daane LL, Harjono I, Zylstra GJ and Haggblom MM (2001). Isolation and characterization of polycyclic aromatic hydrocarbon-degrading bacteria associated with the rhizosphere of salt marsh plants. Appl. Environ. Microbiol. 67(6):2683-2691 Dagley S and Gibson DT (1965). The bacterial degrafation of catechol. J. Biochem. 95: 466 Dyksterhouse SE, Gray JP, Herwig RP, Lara JC and Staley JT (1995). Cycloclasticuspugetii gen. nov., sp. nov., and aromatic hydrocarbon-degrading bacterium from marine sediments. Int. J. Syst. Bacteriol. 45: 116-123 Elshahed MS and McInerney MJ (2001) Is interspecies hydrogen transfer needed for toluene degradation under sulfate-reducing conditions? FEMS Microbiol. Ecol. 35:163-169

Biodegradation of Polycyclic Aromatic Hydrocarbons

163

Eriksson M, Dalhammar G and Borg-Karlson AK (2000). Biological degradation of selected hydrocarbons in an old PAH/creosote contaminated soil from a gas work site. Appl. Microbiol. Biotechnol. 53(5): 619-626 Falahatpisheh MH, Donnelly KC and Ramos KS (2001). Antagonistic interactions among nephrotoxic polycyclic aromatic hydrocarbons. J. Toxicol. Environ. Health. 62: 543-560 Ferrero M, Llobet-Brossa E, Lalucat J, Garcia-Valdes E, Rossello-Mora and Bosch R (2002). Coexistence of two distinct copies of naphthalene degradation genes in Pseudomonas strains isolated from the western Mediterranean region. Appl. Environ. Microbiol. 68:957962 Fuenmayor SL, Wild M, Boyes AL and Williams PA (1998). A gene cluster encoding steps in conversion of naphthalene to gentisate in Pseudomonas sp. strain U2. J. Bacteriol. 180:2522-2530 Galushko AS, Minz D, Schink B and Widdel F (1999). Anaerobic degradation of naphthalene by a pure culture of a novel type of marine sulphate-reducing bacterium. Environ. Microbiol. 1: 415-420 Gibson DT and Subramanian (1984). Microbial degradation of aromatic hydrocarbons. In: Gibson, DT (ed) Microbial degradation of organic compounds. Marcel Dekker, New York, 181-252 Goldman R, Enewold L, Pellizzari E, Beach JB, Bowman ED, Krishnan SS and Shields PG (2001). Smoking increases carcinogenic polycyclic aromatic hydrocarbons in human lung tissue. Cancer Res. 61: 6367-6371 Goyal AK and Zylstra GJ (1996). Molecular cloning of novel genes for polycyclic aromatic hydrocarbon degradation from Comamonas testosteroni GZ39. Appl. Environ. Microbiol. 62:230-236 Grimm AC and Harwood CS (1997). Chemotaxis of Pseudomonas sp. to the polyaromatic hydrocarbon naphthalene. Appl. Environ. Microbiol. 63: 4111-4115 Grimm AC and Harwood CS (1999). NahY, a catabolic plasmid-encoded receptor required for chemotaxis of Pseudomonas putida to the aromatic hydrocarbon naphthalene. J. Bacteriol. 181: 3310-3316 Grishchenkov VG, Townsend RT, McDonald TJ, Autenrieth RL, Bonner JS and Boronin AM (2000). Degradation of petroleum hydrocarbons by facultative anaerobic bacteria under aerobic and anaerobic conditions. Process Biochem. 35:889-896 Habe H and Omori T (2003). Genetics of Polycyclic Aromatic Hydrocarbon Metabolism in Diverse Aerobic Bacteria. 67: 225-243 Harvey RG (1997). Polycyclic aromatic hydrocarbons. Wiley-VCH, New York, NY. Heitkamp MA, Franklin W and Cerniglia CE (1988). Microbial metabolism of polycyclic aromatic hydrocarbons by a bacterium isolated from sediments below an oil field. Appl. Environ. Microbiol. 54: 1612-1614 Hermuth K, Leuthner B and Heider J (2002). Operon structure and expression of the genes for benzylsuccinate synthase in Thaueraaromatica strain K172. Arch. Microbiol. 177:132-138 IPCS (International Programme on Chemical Safety) (2000). Naphthalene. Poisons Information Monograph. PIM 363. WHO: Geneva. Jasmine J and Mukherji S (2014). Evaluation of bioaugmentation and biostimulation effects on the treatment of refinery oily sludge using 2n full factorial design. Environ. Sci.: Processes Impacts. 16: 1889-1896 Jeon CO, Minjeong P, HyunSu RO, Woojun P and Eugene LM (2006). The naphthalene catabolic (nag) Genes of Polaromonasnaphthalenivorans CJ2: Evolutionary Implications for Two Gene clusters and Novel Regulatory Control. Appl Environ Microbiol. 72: 10861095 Johnsen AR, Wick LY and Harms H (2005). Principles of microbial PAH degradation in soil. Environ Pollut. 133:71-84 Jones KC, Stratford JA, Tidridge P, Waterhouse KS and Johnston AE (1989). Polynuclear aromatic hydrocarbons in an agricultural soil: long-term changes in profile distribution. Environ. Poll. 56: 337-351

164

Microbes: In Action

Juhasz AL and Naidu R (2000). Bioremediation of high-molecular-weight polycyclic aromatic hydrocarbons: a review of the microbial degradation of benzo[a]pyrene. Int. Biodet. Biodeg. 45:57-88 Kanaly R (2000). Rapid mineralization of benzo (a) pyrene by a microbial consortium growing on diesel fuel. Appl. Environ. Microbiol. 66:4205-4211 Kastner M (1991). Degradation of aromatic and polyaromatic compounds. In Biotechnology: The Science and the Business (eds Moses, V and Cape, RE), Harwood Academic Press, Switzerland, pp. 274-304 Katsnelson BA, Minigaliyeva IA, Degtyareva TD, Privalova LI and Beresneva TA (2014). Does a concomitant exposure to lead influence unfavorably the naphthalene subchronic toxicity and toxico*kinetics? Environ. Toxicol. Chem. 33(1):152-157 Kelley I and Cerniglia CE (1995). Degradation of a mixture of highmolecular-weight polycyclic aromatic hydrocarbons by a Mycobacterium strain PYR-1. J Soil Contam. 4: 7791 Khan AA, Wang RF, Cao WW, Doerge DR, Wennerstrom D and Cerniglia CE (2001). Molecular cloning, nucleotide sequence, and expression of genes encoding a polycyclic aromatic ring dioxygenase from Mycobacterium sp. strain PYR-1. Appl. Environ. Microbiol. 67: 3577-3585 Kumar A, Munjal A and Sawhney R (2011). Crude oil PAH constitution, degradation pathway and associated bioremediation microflora: an overview. Inter. J. Environ. Sci. 1(7):14201439 Langenhoff AAM, Zehnder AJB and Schraa G (1996). Behavior of toluene, benzene and naphthalene under anaerobic conditions in sediment columns. Biodegradation. 7: 267274 Langenhoff AAM, Brouwers-Ceiler DL, Engelberting JHL, Quist JJ, Wolkenfelt JGPN, Zehnder AJB and Schraa G (1997). Microbial reduction of manganese coupled to toluene oxidation. FEMS Microbiol. Ecol. 22:119-127 Laurie AD and Lloyd-Jones G (1999). Thephngenes of Burkholderia sp. strain RP007 constitute a divergent gene cluster for polycyclic aromatic hydrocarbon catabolism. J. Bacteriol. 181: 531-540 Law JR, Kelly C, Baker K, Jones J, Mclntosh AD and Moffat CF (2002). Toxic equivalency factors for PAH and their applicability in shellfish pollution monitoring studies. J Enviro. Monit. 4: 383-388 Liu K, Wenjun H, Wei-Ping P and John TR (2001). Polycyclic aromatic hydrocarbon (PAH) emissions from a coal fired pilot FBC system. J. Hazard. Mater. 84: 175-188 Malatova K (2005). Isolation and characterization of hydrocarbon degrading bacteria from Environment Habitats in Western New York State. A thesis submitted to Department of chemistry Rochester Institute of technology Rochester, NY. Mastrangela G, Fadda E and Marzia V (1997). Polycyclic aromatic hydrocarbons and cancer in man. Environ. Health Perspect. 104: 1166-1170 Meckenstock RU, Safinowski M and Griebler C (2004). Anaerobic degradation of polycyclic aromatic hydrocarbons. FEMS Microbiol. Ecol. 49: 27-36 Mihelcic JR and Luthy RG (1988). Degradation of polycyclic aromatic hydrocarbon compounds under various redox conditions in soil-water systems. Appl. Environ. Microbiol. 54:1182-1187 Miller CD, Hall K, Liang YN, Nieman K, Sorensen D, Issa B, Anderson AJ and Sims RC (2004). Isolation and characterization of polycyclic aromatic hydrocarbon-degradating Mycobacterium isolates from soil. Microb. Ecol. 48: 230-238 Miralles G, Acquaviva M, Bertrand JC and Cuny P (2010). Response of an archaeal community from anoxic coastal marine sediments to experimental petroleum contamination. Aquat. Microb. Ecol. 59: 25-31 Moody JD, Freeman JP, Doerge DR and Cerniglia CE (2001). Degradation of phenanthrene and anthracene by cell suspensions of Mycobacterium sp. strain PYR-1. Appl. Environ. Microbiol. 67:1476-1483

Biodegradation of Polycyclic Aromatic Hydrocarbons

165

Mrozik A, Piotrowska-Seget Z and Labuzek S (2003). Bacterial degradation and Bioremediation of Polycyclic aromatic hydrocarbon. Polish Journal of environment studies. 12:15-25 Mueller JG, Devereux R, Santavy DL, Lantz SE, Willis SG and Pritchard PH (1997). Phylogenetic and physiological comparisons of PAH degrading bacteria from geographically diverse soils. Antonie Van Leeuwen. 71(4):329-343 Nayak AS, Vijaykumar MH and Karegoudar TB (2009). Characterization of biosurfactant produced by Pseudoxanthom*onas sp. PNK-04 and its application in bioremediation. Int. Biodeter. Biodegr. 63: 73-79. Nayak AS, Sanganal SK, Mudde SK, Oblesha A and Karegoudar T (2011). A catabolic pathway for the degradation of chrysene by Pseudoxanthom*onas sp. PNK-04. FEMS Microbiol. Lett. 320:128-134. Paisse S, Goni-Urriza M, Stadler T, Budzinski H and Duran R (2012). Ringhydroxylatingdioxygenase (RHD) expression in a microbial community during the early response to oil pollution. FEMS Microbiol. Ecol. 80: 77-86 Phelps CD and Young LY (1999). Anaerobic biodegradation of BTEX and gasoline in various aquatic sediments. Biodegradation. 10:15-25 Phelps CD, Battistelli J and Young LY (2002). Metabolic biomarkers for monitoring anaerobic naphthalene biodegradation in situ. Environ Microbiol. 4: 532-537 Phillips DH (1983) Fifty years of benzo[a]pyrene. Nature. 303: 1717-1725 Pieper HD, Santos MVD and Golyshin NP (2004). Genomic and mechanisticin sights into the biodegradation of organic pollutants. Curr. Opi. Biotech. 15:215-224 Platt A, Shingler V, Taylor SC and Williams PA (1995). The 4-hydroxy 2-oxovalerate aldolase and acetaldehyde dehydrogenase (acylating) encoded by the nahMand nahOgenes of the naphthalene catabolic plasmid pWW60–22 provide further evidence of conservation of meta-cleavage pathway gene sequences. Microbiology. 141:2223-2233 Resnick SM and Gibson DT (1996). Regio- and stereospecific oxidation of fluorene, dibenzofuran, and dibenzothiophene by naphthalene dioxygenase from Pseudomonas sp. strain NCIB 9816–4. Appl. Environ. Microbiol. 62: 4073-4080 Ripp S, Nivens DE, Werner C and Sayler GS (2000). Bioluminescent most probable-number monitoring of a genetically engineered bacterium during a long term contained field release. Appl. Microbiol. Biotechnol. 53: 736-741 Riser-Roberts E (1992) Bioremediation of Petroleum Contaminated Sites. Bocan Raton (FL): CRC Press Inc. Boca Raton, FL. Rockne KJ, Chee-Sanford JC, Sanford RA, Hedlund BP, Staley JT and Strand SE (2000). Anaerobic naphthalene degradation by microbial pure cultures under nitrate-reducing conditions. Appl. Environ. Microbiol. 66: 1595-1601 Roy R and Greer CW (2000). Hexadecane mineralization and denitrification in two diesel fuel-contaminated soils. FEMS Microbiol. Ecol. 32:17-23 Safinowski M, Griebler C and Meckenstock RU (2006). Anaerobic cometabolic transformation of polycyclic and heterocyclic aromatic hydrocarbons: evidence from laboratory and field studies. Environ. Sci. Technol. 40: 4165-4173 Safinowski M, Meckenstock RU (2006). Methylation isthe initial reaction in anaerobic naphthalenedegradation by a sulfate-reducing enrichmentculture. Environ. Microbiol. 8:347-352 Samanta S, Singh O and Jain R (2002). Polycyclic aromatic hydrocarbons: environment pollution and bioremediation. Trends biotechnol. 20:243-247 Schwarzenbach RP and Westall J (1981). Transport of nonpolar organic compounds from surface water to groundwater. Laboratory sorption studies. Environ. Sci. Technol. 15: 13601367 Sharma NK, Philip L and Murty SB (2012). Aerobic degradation of phenolics and aromatic hydrocarbons in presence of cyanide. Bioresour. Technol. 121:263-73. Sikkema J, deBont JAM and Poolman B (1995). Mechanisms of membrane toxicity of hydrocarbons. Microbiol Rev. 59:201-222

166

Microbes: In Action

Stauffert M, Cravo-Laureau C, Je ze quel R, Barantal S and Cuny P (2013). Impact of Oil on Bacterial Community Structure in Bioturbated Sediments. PLoS ONE 8(6): e65347. doi:10.1371/journal.pone.0065347 Stauffert M, Duran R, Gassie C and Cravo-Laureau C (2014). Response of archaeal communities to oil spill in bioturbated mudflat sediments. Microb. Ecol. 67(1):108-19 Stegeman JJ, Hahn ME, Weisbrod R, Woodin BR, Joy JS, Najibi S and Cohen RA (2001). Cytochrome P450 1A expression in mid water fishes: potential effects of chemical contaminants in remote oceanic zones. Environ. Sci. Technol. 35: 54-62 Story SP, Parker, SH Kline JD, Tzeng TRJ, Mueller JG and Kline EL (2000). Identification of four structural genes and two putative promoters necessary for utilization of naphthalene, phenanthrene and fluoranthene by Sphingomonas paucimobilisvar. EPA505. Gene. 260:155169 Suenaga H, Koyama Y, Miyakoshi M, Miyazaki R and Yano H (2009). Novel organization of aromatic degradation pathway genes in a microbial community as revealed by metagenomic analysis. ISME J. 3: 1335-1348 Sutherland JB (1992). Detoxification of polycyclic aromatic hydrocarbons by fungi. Industrial Microbiol. Biotechnol. 9: 53-61 Taketani RG, Franco NO, Rosado AS and Van Elsas JD (2010). Microbial community response to a simulated hydrocarbon spill in mangrove sediments. J. Microbiol. 48:7-15 Timmis KN, Steffan RJ and Unterman R (1994). Designing microorganisms for the treatment of toxic wastes. Annu. Rev. Microbiol. 48: 525-557 Treadway SL, Yanagimachi KS, Lankenau E, Lessard PA, Stephanopoulos G and Sinskey AJ (1999). Isolation and characterization of indene bioconversion genes from Rhodococcus strain I 24. Appl. Microbiol. Biotechnol. 51:786-793 Vandermuulen JH (1981). Contamination of marine population by hydrocarbons. In: Fate and Effect of Oil Spill (Amoco Cadiz, ed.), Centre National d'EtudesOce´anographiques (CNEO), Paris, pp. 563-572 Vila J, Lopez Z, Sabate J, Minguillon C, Solanas AM and Grifoll M (2001). Identification of a novel metabolite in the degradation of pyrene by Mycobacterium sp. strain AP1: actions of the isolate on two- and three-ring polycyclic aromatic hydrocarbons. Appl. Environ. Microbiol. 67:5497-5505 Volkering F, Breure AM and van Andel JG (1993). Effect of microorganisms on the bioavailability and biodegradation of crystalline naphthalene. Appl. Microbiol. Biotecnol. 40: 535-540 Wang RF, Wennerstrom D, Cao WW, Khan AA and Cerniglia CE (2000). Cloning, expression and characterization of the katG gene, encoding catalase-peroxidase, from the polycyclic aromatic hydrocarbon-degrading bacterium Mycobacterium sp. strain PYR-1. Appl. Environ. Microbiol. 66:4300-4304 Widdle F and Rabus R (2001). Anaerobic biodegradation of saturated and aromatic hydrocarbons. Curr. Opin. Biotechnol. 12:259-276 Young LY and Phelps CD (2005). Metabolic Biomarkers for Monitoring in Situ Anaerobic Hydrocarbon Degradation. Environ. Health Perspectives. Environ Health Perspect. 113:62-67 Zhang XM and Young LY (1997). Carboxylation as initial reaction in the anaerobic metabolism of naphthalene and phenanthrene by sulfidogenic consortia. Appl. Environ. Microbiol. 63: 4759-4764 Zheng Z, Breedveld G and Aagaard P (2001). Biodegradation of soluble aromatic compounds of jet fuel under anaerobic conditions: Laboratory batch experiments. Appl. Microbiol. Biotechnol. 57: 572-578 Zhou NY, Fuenmayor SL and Williams PA (2001). nag genes of Ralstonia (formerly Pseudomonas) sp. strain U2 encoding enzymes for gentisate catabolism. J. Bacteriol. 183: 700-708 Zhuang WQ, Tay JH, Maszenan AM, Krumholz LR and Tay STL (2003). Importance of Grampositive naphthalene-degrading bacteria in oil-contaminated tropical marine sediments. Lett. App. Microbiol. 36: 251-257

CHAPTER 11 Endophytic Microorganism and their Functions Praveen Gehlot1, Naveen Bohra2 and Dharmesh Harwani3 1

Department of Botany, Jai Narain Vyas University, Jodhpur-342001 India Silviculture Division, Arid Forest Research Institute, Jodhpur-342001 India 3 Department of Microbiology, Maharaja Ganga Singh University, Bikaner-334004 India Corresponding author: [emailprotected] 2

INTRODUCTION Endophytic microbes are an intriguing group of organism associated with various tissues and organs of terrestrial and some aquatic plants, whose infections are inconspicuous and the infected host tissue are at least transiently symptomless (Stone et al., 2000). The word endophyte is derived from Greek, 'endo'/'endon' meaning within and 'phyte'/'phyton' meaning plant. In general the term includes all microorganisms that are able to colonize during some portion of their life cycle, the inner tissues of plants without causing any apparent damage to the host (Petrini, 1991). Plants are constantly involved in interaction with a wide range of microorganisms. These plant associated microorganisms first colonize the rhizosphere or phyllosphere and later a selected fraction of these may occupy the inside of plant tissues to become endophytes. The existence of different groups of organisms such as fungi, bacteria, actinomycetes and mycoplasma has been reported as endophytes of plants for over one hundred years (Bandara et al., 2006). Almost all classes of vascular plants and grasses are found to host different endophytic organisms (Zang et al., 2006). The microbe-plant interaction in the endosphere can be beneficial, neutral, variable, or deleterious for plant growth and development (Sakai et al., 2004). Endospheric microorganisms are known to compose, complex of the microbial community, which might alter depending on plant root exudates (Watt et al., 2006). The ability of endophytic microorganisms to produce and release various metabolites affecting plant growth and health is considered one of the most important factors in soil fertility (Asghar et al., 2004). Endophytes have developed intimate relationships with their host plants through co-evolutionary processes and they influence the plant physiology in ways which are yet not fully understood (Mano and Hisao, 2008). There is growing international interest in the beneficial role of endophytic microorganisms in plant health and development (Backman and Sikora 2008). Understanding endophytic microorganisms is important for their effective use for low-input sustainable agriculture and phytoremediation (Doi et al., 2006).

168

Microbes: In Action

Earlier, endophytes were assumed to be latent pathogens that did not trigger harmful reactions and provided no benefits to the host plant (Lodewyckx et al., 2002). Recently endophytes are viewed as a new potential source of novel genes, proteins, natural biochemical compounds for medicine, agriculture and industrial process and as an outstanding source of secondary metabolites and bioactive antimicrobial natural products (Lima et al., 2005). Endophytes may have an important role in the adaptation of plants to some particular environments (Rodriguez et al., 2004). In addition, they represent a group of organisms with a very good potential for applications in plant improvement and disease control. Most endophytic assemblages contain mutualistic species which help plants to cope with biotic and abiotic stresses. In spite of this, only a few plants have ever been completely studied relative to their endophytic biology and endophytic microorganisms are still quite inconspicuous in plant pathology. Hence, the opportunity to find new and beneficial endophytic microorganisms among the diversity of plants in different ecosystems is considerable. Endophytic Colonization and Association The colonization of plant tissues by endophytes involves several steps including host recognition, spore germination, penetration of the epidermal layers and tissue colonization (Petrini, 1991). When microbial endophytes colonize on the plant surface, they produce enzymes to hydrolyze plant cell walls. These enzymes have the capability of degrading cell wall of fungi and oomycetes and suppress the plant pathogen activities directly. Macagnan et al. (2008) reported that Streptomyces which produce lytic enzymes have an additional role in antagonism to cacao witches broom. After endophytes are successfully colonized in host tissue, the endophytic niche gets established. In the endophytic niche, endophytes obtain a reliable source of nutrition from plant exudates and leachates and protect host against other microorganisms. Endophytic microorganisms are sheltered from environmental stresses and microbial competition by the host plant (Kobayashi and Palumbo, 2000). Thus the inner space of plant represents an ecological niche where numerous species of bacterial and fungal endophytes live. These ubiquitous bacteria and fungi have an effect in the way plants interact with their environment. Therefore, in some ways, a plant is a plant and its endophytes. Plants may be either associated to a small or larger number of endophytic species. For instance, Neotyphodium endophytes represent a small fraction of the endophytic species associated to grasses. Some grass species are associated to more than a hundred different species of fungal endophytes (Sanchez Marquez et al., 2007) and this number can be much greater for members of other plant families (Stone et al., 2004). An average of about 50 endophytic species per plant species was found in surveys done before the year 2000 (Stone et al., 2004). When molecular methods for the identification of fungi began to be applied to endophyte research i.e. rDNA sequencing (Guo et al., 2000a) the number of fungal species identified per host plant species increased substantially as genotypic identification methods distinguished among the cultures which were sterile in laboratory.

Endophytic Microorganism

169

Bacterial and Fungal Endophytes Bacterial endophytes are the bacteria that colonize internal tissue of a plant, showing no external sign of infection or negative effect on their host. Dobereiner (1992) for the first time introduced the term endophyte in the area of bacteriology. Most bacterial endophytes appear to originate from the rhizosphere, the zone that surrounds the roots of plants, but some can be transmitted through the seed. Bacteria induced plant growth promotion is achieved either through fixation of atmospheric nitrogen, solubilization of minerals, production of iron-chelating siderophores and plant growth regulators or by a combination of these mechanisms (Kloepper, 1997). Endophytic microorganisms harbor a number of plant growth promoting (PGP) features such as fixation of atmospheric dinitrogen (N2), mineral P solubilization, production of phytohormones, siderophores and certain antagonistic compounds which are effective in controlling plant diseases (Richardson et al., 2009). Endophytic fungi are a polyphyletic group of highly diverse, primarily ascomycetous fungi defined functionally by their occurrence within asymptomatic tissues of plants. They occur in above ground tissues of liverworts, hornworts, mosses, lycopsida, equisetopsids, ferns and seed plants from the arctic to the tropics and from agricultural fields to the most biotically diverse tropical forests (Arnold, 2007). The existence of endophytic fungi has been known since a very long time. During 1977, the cattles that fed in pastures of the grass Festuca arundinacea suffered from the syndrome 'Fescue toxicosis'. It was found that the leaves and stems of F. arundinacea which was grazed upon by the cattles were systemically colonized by a fungus, Neotyphodium coenophialum (Bacon et al., 1977). It was found that infected plants contained several toxic alkaloids and that Neotyphodium species can be beneficial to their plant hosts, increasing their tolerance of biotic and abiotic stress factors (Schardl et al., 2004). Endophytic fungi, which colonize and grow asymptomatically within healthy plant tissues, may evolve from plant pathogenic fungi and become nonpathogenic (Kogel et al., 2006). A true endophyte exists once equilibrium is achieved between fungal activity and the plant reaction and is maintained over time (Gimenez et al., 2007). Fungal endophytes benefit plant by promoting plant growth (Dai et al., 2008), improving resistance to multiple stress (Lewis, 2004) and protection from diseases and insects (Vega et al., 2008). Fungal Endophytic Diversity Fungal endophytes are broadly categorized into four main classes. Class I endophytes include Clavicipitaceous, that are fastidious in culture and limited to some cool and warm season grasses (Stone et al., 2004). Class I endophytes mainly show vertical transmission (Saikkonen et al., 2002). Class II endophyte have mainly the members of Dikarya (Ascomycota or Basidiomycota). Class III endophytes are especially known for their great diversity within individual host tissues, plants and populations. This includes vascular, nonvascular plants, woody and herbaceous angiosperms in tropical forest and antarctic communities (Davis et al., 2003). Class IV endophytes are restricted to plant roots and have darkly melanized septa. They are generally Ascomycetous fungi which are conidial

170

Microbes: In Action

or sterile and that form melanized structures like inter and intracellular hyphae and microsclerotia in the roots. Specificity of Endophytes The endophytic species have some specific biological characteristics such as tissue colonization and specificity. Many endophytes locally infect plant parts, being restricted to a small tissue area. While some endophytic species systemically infect the intercellular space of leaves, reproductive stems and seeds of their hosts. These systemic endophytes can be isolated from multiple fragments of the same plant. Tissue and organ specificity also occurs, and some endophytes may be found in specific plant parts such as roots, leaves or twigs, while others may infect several of these parts (Stone et al., 2004). Based on the specificity shown by endophytes for their host plants, they are regarded as specialists (narrow host range) and generalists (wide host range). For instance, Neotyphodium endophytes have a narrow host range, where as Alternaria and Piriformosfora endophytes have wide host ranges, encompassing species within different genera or plant families (Waller et al., 2005). Transmission of Bacterial and Fungal Endophytes Common source of bacterial endophytes in case of plants are the soil surrounding roots, atmosphere and vegetatively propagated plant material (stems, seeds and cuttings). Soil bacteria can gain entry into the epidermal root tissues by two processes- passively i.e. by penetrating sites at junction of adjacent epidermal cells (Benhamou et al., 1996) and actively by production of hydrolytic enzymes (exoglucanase, endoglucanase, endopolygalactouronase etc.) involved in plant cell wall degradation. Endophytic bacterial strains can systematically colonize stem and leaf tissue along with roots (Compant et al., 2010). Although the bacterial densities in leaf and stem tissues have been found to be lower than that in the roots (Hallman et al., 1997). However, entry from the phyllosphere via stomata or hydathodes can also occur but it has gained very little attention. Fungal endophytes may infect plants by two means- horizontally or vertically. Horizontal transmission occurs when their inoculum is transported to another plant and vertical transmission occurs when they infect the seed progeny of an infected plant. Sometimes it has been found that seeds and seedlings are virtually free of endophyte but the incidence of fungal endophyte increases as leaves or seeds grow older (Gallery et al., 2007). This must be driven by horizontal transmission. In horizontal transmission endophytic inoculum has to be produced and dispersed but the question is that in an asymptomatic host, where and when is the inoculum produced? In latent saprophytes, the inoculum could be produced when infected host tissue dies. Tadych et al. (2007) reported that grasses infected by Epichloe endophytes have a microscopic layer of hyphae and conidia in their leaf surface and this inoculum might horizontally infect new hosts. Studies related to vertical transmission of fungal endophytes are rare (Gallery et al., 2007). Neotyphodium endophytes are vertically transmitted to host progeny by means of seed infection. Phytophagous insects may also take part in transmission of endophytes, by spreading the spores of endophytic fungal species present in their fecal pellets (Devarajan and Suryanarayanan, 2006).

Endophytic Microorganism

171

Role of Endophytic Microorganisms Recently, it has been demonstrated that bacterial endophytes support stimulation of plant growth, induction of resistance to plant pathogens and stimulates plant development and yield by synthesizing different plant hormones (Bai et al., 2003; Seghers et al., 2004). Moreover, several strains of endophytic bacteria can induce biotic and abiotic stress tolerance of inoculated plant (Hallman et al., 1997). Bacterial endophytes are involved in natural plant protection against bacterial, fungal and viral diseases and represent an important source of biocontrol agents by producing high amounts of compounds with antimicrobial and insecticidal activities (Strobel, 2006). Endophytic bacteria isolated from rice cultivars have shown the ability to produce siderophores under the conditions of iron starvation, where there is the production of small molecular weight compounds that have high affinity for iron followed by the capture of iron-charged siderophore by the cell (Miethk and Marahiel, 2007). According to Bent and Chanway (1998) bacterial endophytes can accelerate seedling emergence, promote plant establishment under adverse conditions and enhance plant growth. They are believed to elicit plant growth promotion in one of the two ways: either directly by producing phytohormones such as auxin/cytokinin (Madhaiyan et al., 2006) and the enzyme 1aminocyclopropane-1-carboxylate (ACC) deaminase, which lowers plant ethylene levels (Glick, 1995) or indirectly by helping plants to acquire nutrients e.g. via nitrogen fixation, phosphate solubilization (Wakelin et al., 2004) or iron chelation and siderophore production (Costa and Loper, 1994) or by preventing pathogen infections via antifungal or antibacterial agents, or by establishing the plant's systemic resistance (van Loon et al., 1998). Filamentous fungi in soil degrade organic matter and help in soil aggregation. Contrary to this, certain species of Alternaria, Cladosporium, Metarhizium, Dematium and Humicola and produce substances which have great similarity to humic substances in soil. These fungi thereby help in the maintenance of soil organic matter rather than degrading it. Fungi belonging to the genera Boletus and Lactarius are capable of forming ectotrophic associations on the root system of pine trees and help in the mobilization of soil phosphorus and nitrogen into plants. Trichoderma harzianum has been considered as a biological control organism against several soil borne pathogens since a long time and has depicted the capability of increasing plant growth and yields by reducing the occurrence of plant diseases. Phuwiawat and Soytong (1999) reported that the applications of T. harzianum reduced the use of fungicide and growth regulators which eventually lowered the production costs and environmental impact. Endophytes as Biofertilizer Biofertilizers are live formulations of beneficial microorganisms, which can mobilize the nutrients by their biological activity and improve the soil health upon application to root or soil. Microorganisms which are involved in biofertilizer formulation secrete an array of growth and health promoting substances. These microbes also mobilize N and P minerals. Ojha et al. (2008) reported that association of endophytic fungus enhanced the uptake of

172

Microbes: In Action

phosphorus and increased chlorophyll content in custard apple. The influence of five VAM fungi on growth and nutrient uptake in chickpea was studied by Kumar et al. (2002). Endophytic fungi inoculation resulted in increased dry weight, plant height, mycorrhizal colonization, nutrient content and number of pods per plant as compared to the control. Abdalla and Omar (1998) studied the ability of cellulolytic fungi and wheat straw incorporation to improve the nodulation, growth and nitrogen status of fenugreek grown in saline soils. They reported that cellulolytic fungi and wheat straw increased the concentration of Ca, Mg and K in the shoots and roots of plants. Increased dry matter and N content was reported because of improved N fixation reflected by enhanced formation and growth of nodules as well as nitrogenase activity. Similarly, the effect of phosphate solubilizing fungal strains on the yield of chickpea was studied by Mittal et al. (2008). They reported that the treatment resulted in increased shoot height, seed number and seeds weight as compared to un-inoculated plants. Nitrogen fixation Nitrogen is the key plant nutrient required for plant growth and is mostly found to be limiting in most of the environments of the world. Biological nitrogen fixation (BNF) is one way of converting elemental nitrogen into plant usable form by symbiotic associations. Identification of stably maintained diazotrophic bacterial endophytes in plant tissues is one of the best approaches to mitigate nitrogen loss and to improve the nitrogen use efficiency (Ladha et al., 1997). It is striking that the focus on several nitrogen fixing microorganisms in nonleguminous crops was paid little attention before 1990s. Yet, there is very little knowledge regarding endophytic microbiology in India. Endophytic bacteria have been proposed to be responsible for the supply of biologically fixed nitrogen to their host plant (Boddey et al., 1995). A diverse array of bacterial endophytes have been found to be diazotrophic viz., G. diazotrophicus (Sugarcane), H. seropedicae, P. ananatis, Burkholderia sp., C. crescentus (Rice), Azoarcus sp. BH72 (Kallar grass), S. lentus, B. fastidiosus (Soybean), Rahnella sp., Phyllobacterium sp., Xanthom*onas (Sweet potato), B. pumilus (Maize) in agronomically important and cereal crops. Baldani et al. (1992) isolated endophytic Herbaspirillum seropedicae from sugarcane roots, stems and leaves which was involved in nitrogen fixation. A gram negative nitrogen fixing bacteria, Azoarcus sp BH72 was isolated from Kallar grass (Hurek et al., 1993). Evidences of occurrence of bacterial diversity with potential nitrogen fixation ability have been reported in Pennisetum glaucum by Tiwari et al. (2003). Endophytic bacteria isolated from rice cultivars have shown the ability to produce siderophores under the conditions of iron starvation, where there is the production of small molecular weight compounds that have high affinity for iron followed by the capture of iron-charged siderophore by the cell (Miethke and Marahiel, 2007). Chowdhury et al. (2009) reported the occurrence of nifH sequence in Azospirillum sp. and P. pseudoalcaligens showing the possibility of supplying biologically fixed nitrogen by endophytic and root associated diazotrophs in Lasiurus sindicus. The presence of nitrogen fixing endophytic Bacillus firmus, Caulobacter crescentus, Kocuria

Endophytic Microorganism

173

palustris, Micrococcus luteus and Pantoea ananatis inside both rice seedlings and mature rice plants. Endophytic bacteria associated with Ipomoea batatas (L.) Lam were isolated, identified and tested for their ability to fix nitrogen, production of IAA and stress tolerance by Khan and Doty (2009). They identified 11 different strains belonging to the genera Rahnella, Rhodanobacter, Phyllobacterium, Xanthom*onas and Enterobacter out of which four strains produced IAA and one strain showed the ability to grow in nitrogen free medium and had nitrogenase subunit gene, nifH. Jalgaonwala and Mahajan (2011) reported that diverse array of bacterial species are endophytic in Pongamia glabra possessing antifungal and plant growth promoting activities. Ferrara et al. (2011) reported 25 putative endophytes belonging to Klebsiella and Enterobacter genera prevalently in sugarcane having the ability to synthesize IAA, plant growth promoting substances and nitrogen fixation. Many plant growth promoting endophytic bacteria produce the enzyme 1-aminocyclopropane-1-carboxylate (ACC) deaminase which can cleave ACC, thereby lowering the ethylene levels (Chernin and Glick, 2012). This result in longer roots and less inhibition of ethylenesensitive plant growth following environmental or pathogen induced stress. Phosphate Solubilization Phosphorus is major essential macronutrients for biological growth and development. It is one of the major plant growth limiting nutrients. In addition to the biological nitrogen fixation, phosphate solubilization is also very important in enhancing the soil fertility. Phosphates applied to agricultural soils are rapidly immobilized and are not accessible to plants. Microorganisms offer a biological rescue system capable of solubilising the insoluble inorganic P of soil and make it available to the plants. Phosphate solubilization is a common trait among plant-endophytic microorganisms. The most efficient phosphate solubilising endophytic bacteria belongs to the genera Bacillus, Rhizobium and Pseudomonas. Forchetti et al. (2007) showed that more endophytic bacteria were isolated from sunflower plants exposed to drought rather than irrigated sunflower plants. Endophytic bacteria mostly representing Bacillus megaterium and B. subtilis were able to solubilize calcium phosphate in strawberry (Dias et al., 2009). Endophytic bacteria capable of solubilizing iron and calcium phosphates were isolated by Puente et al., 2009 from cardon cactus, a pioneer desert plant. They also reported that the isolated endophytic bacteria were also diazotrophic along with being phosphate solubilizing there by providing the host plant with N along with P. E. coli isolated and characterized from endo-rhizosphere of sugarcane and rye grass was found to solubilize phosphate and thus is found to help in the growth of the plants. Bacterial endophytes from cactus, sunflower, soybean, maize and coffee had the ability to solubilize mineral phosphates in plate assays (Palaniappan et al., 2010). Phosphate solubilizing endophytic bacteria has also revealed other plant beneficial properties such as production of several phytohormones and growth on nitrogen free media. Among phosphate solubilizing microorganisms, fungi perform better in acidic soil conditions (Ahmed and Jha, 1968). Species of Aspergillus and

174

Microbes: In Action

Penicillium have been widely reported solubilizing various forms of inorganic phosphates (Asea et al., 1998). Nahas (1996) reported that fungi possess greater ability to solubilize insoluble phosphate than bacteria. Rajankar et al. (2007) also reported that the fungi viz., Aspergillus spp., Penicillium spp., and Fusarium spp., had more inorganic phosphate solubilizing ability than B. subtilis and B. megaterium. Medina et al. (2007) reported increased P uptake by plants due to inoculation of Aspergillus niger. The phosphate solubilization and antifungal activity of Aspergillus niger, Curvularia lunata, Rhizoctonia solani and Fusarium oxysporium is reported by Srivastav et al. (2004). The endophytic phosphate utilizing microbes could be a promising source for plant growth promoting agent in agriculture. It is concluded that application of biofertilizer prepared by phosphate solubilising bacteria and fungi should be helpful to reduce the salinity of soil by neutralization phenomenon. Their use as inoculants could increase the P uptake by plants (Igual et al., 2001). The phosphate solubilising endophytic microbial inoculation with mineral phosphorus raises the efficiency of P fertilizer and decreases the required P rate to plants. It also enhances vegetative growth and fruit quality, in addition to reduce the pollution of environment (Attia et al., 2009). Endophytic Plant Growth Promotion and Phytohormone Production There is an array of microorganisms in plant's endosphere which imparts profound effect on growth, development, health and yield of plant. These effects could be direct like asymbiotic fixation of atmospheric nitrogen, solubilization of phosphates and production of plant growth regulators like auxins, gibberellins, cytokinin and ethylene or indirect like HCN production, antibiotics, siderophores, synthesis of cell wall lysing enzymes and competitions with detrimental microorganisms for sites on plant roots (Ahmad et al., 2008). An increase in plant growth will prevent a variety of abiotic and biotic stresses, reflecting plant vigor or persistence and considered as a potential protection to pathogen challenge (Kuldau and Bacon, 2008). Along with improving the plant health status, endophytic microorganism also stimulates plant growth by directly producing phytohormones, growth regulators and enhancing photosynthetic ability. Indole acetic acid, the commonest auxin is required for plant growth, development, cell elongation, apical dominance and delaying senescence. Auxins also promote formation of lateral root system and prevent ethylene formation in low concentrations. Production of IAA is a common feature of endophytic bacteria. Such endophytes have been isolated from multiple plants including cactus, strawberry, orchids and soybean. Endophytic bacterial IAA production leads to enhanced production of lateral roots and increases root biomass (Dias et al., 2009). Most of the IAA producing endophytic bacteria are found to be the members of the genus Pseudomonas, Bacillus and Erwinia. Other beneficial traits are often associated with production of IAA. Even before IAA was identified in plants its presence was detected in culture filtrates of the fungus Rhizopus suinus (Tudzymski and Sharon, 1994). Colletotrichum sp., an endophytic fungus in A. annua produces substances like IAA to regulate plant processes (Lu et al., 2000). Shimada et al. (2000) reported

Endophytic Microorganism

175

IAA, as one of the metabolites that have been isolated from Pythium aphanidermatum. Chung and Tzeng (2004) reported the biosynthesis of IAA by Ustilago esculenta, the gall inducing fungus. Abscisic acid (ABA) and IAA concentration in Funalia trogii and Phenerochaete chrysosporium under salt stress was studied by Unyayar (2001). The results showed that, in fungi, ABA concentrations are positively and IAA concentrations negatively correlated with salt stress. Some endophytic fungi possess the ability to promote plant growth upon root colonization and are similar to the plant growth promoting endophytic bacteria. These fungi are functionally designated as 'plant growth promoting fungi' (PGPF) (Hyakumachi, 1994). Plant growth promoting fungi may belong to different genera including: Fusarium, Penicillium, Phoma and Trichoderma. Shivanna et al. (1996) reported that non-pathogenic soil inhabiting saprophytes, proved to be beneficial to several crop plants not only by promoting their growth but also by protecting them from diseases. Verma et al. (1999) described Piriformospora indica as a cultivable endophyte plant growth promoting fungi that enhanced the plant growth and yield and act as a biocontrol agent. Shoresh et al. (2005) revealed that several species of PGPF have been shown to trigger systemic resistance against various pathogens in variety of plants. SIDEROPHORE PRODUCTION Iron is an essential growth element for all living organisms. The scarcity of bioavailable iron in soil habitats and on plant surfaces foments a furious competition (Loper and Henkels, 1997). At pH 7, the freely available iron is at a concentration of no more than 10-17 M, which is far below than that required for microbial and plant growth. Shenker et al. (1995) reported that iron in an aerated environment exists in the ferric form and hence is highly insoluble in neutral or alkaline soil. To solve this problem, microorganisms are genetically observed to utilize a high affinity iron transport system. The synthesis and secretion of a low molecular weight ferric-specific chelation agent to solubilize iron is termed as Siderophore (Abdalla and Omar, 1998). Bacterial siderophores are low molecular weight compounds with high iron (III) chelating affinity (Sharma and Johri, 2003) that are responsible for the solubilization and transport of iron (III) into bacterial cells. Siderophore production confers to bacteria competitive advantages to colonize plant tissues and to exclude other microorganisms from the same ecological niche. Production of siderophores by bacterial endophytes is detected via the chrome azurol S assay, a general test for siderophores, which is independent of siderophore structure. Amplified ribosomal DNA restriction analysis (ARDRA) groups, revealed that most of the siderophore producing bacterial isolates belonged to Gram- negative bacteria corresponding to the Pseudomonas and Enterobacter genera and Bacillus and Rhodococcus genera are the Gram-positive bacteria found to produce siderophores (Tian et al., 2009). Rice endophyte metagenomes revealed a high number of genes encoding proteins potentially involved in siderophore biosynthesis, ferric siderophore membrane receptors and iron uptake transporters. As iron is fiercely competed for in soil, iron chelating bacteria can deprive putative pathogens of available

176

Microbes: In Action

iron, thereby exerting antagonistic activity. Additionally, the production of siderophores has been reported to be one of the mechanisms to outcompete pathogens (O'Sullivan and O'Gara, 1992) and may have the same function in endophytes. Acquisition of iron from siderophores produced by other microbial species has already been described for Escherichia coli, Salmonella typhimurium, Actinobacillus pleuropneumoniae and Arthrobacter flavescens. Lacava et al. (2008) analyzed the production of siderophores by endophytic bacteria Methylobacterium spp. which produced hydroxamate-type, but not catechol-type siderophores. Siderophores are produced during extreme iron-depleted conditions for the solubilization of extracellular ferric iron by most bacteria and fungi. The most significant feature of siderophores is their extremely high affinity for ferric ion. The majority of fungal siderophores are hydroxamates, apart from the carboxylate type siderophore rhizoferrin produced by Zygomycetes. Most species of the genus Aspergillus are known to produce several hydroxamate type siderophores (Dube et al., 2000). Various strains of mycorrhizal fungi produce siderophores, and siderophore production by pathogenic fungi is typically associated with virulence. Endophytes as Potent Biocontrol Agents Endophytic bacteria produce high amount of compounds with antimicrobial and insecticidal activity thereby improving plant's health (Gunatilaka, 2006). A wide variety of endophytic bacteria with antagonistic activity against bacterial, fungal and oomycete pathogens have been reported by Lodewyckx et al. (2002). Most of the endophytic bacteria belong to the genus Bacillus, Paenibacillus and Pseudomonas. Pantoea agglomerans for instance inhibits Erwinia carotovora and Cryphonectria parasitica causing chestnut blight is inhibited by some strains of Bacillus subtilis. Bacillus megaterium endophytes were found to be effective for the control of Phytophthora foot rot in black pepper. The antagonistic activity of some bacterial and fungal endophytes is listed in Table 2. Next to bacteria, fungal based biocontrol agents have gained wide acceptance because of their broader spectrum in terms of disease control and yield. Trichoderma spp. has gained the main attention of researchers (Verma et al., 2007a). This is mainly because, fungi of the genus Trichoderma are important biocontrol agents of several soil borne phytopathogens (Benitez et al., 2004). It uses different mechanisms for the control of phytopathogens which include mycoparasitism, competition for space and nutrients, secretion of antibiotics and fungal cell wall degrading enzymes (Harman et al., 2004). Trichoderma could also have a stimulatory effect on plant growth (Naseby et al., 2000) as a result of modification of soil conditions. Trichoderma harzianum is an efficient biocontrol agent that is commercially produced to prevent development of several soil born pathogenic fungi. Endophytic fungi Aspergillus clavatonanicus isolated from Torreya mairei produces clavatol. Endophytic Fusarium sp from plant Selaginella pollescens showed potent antifungal activity against Candida albicans in agar diffusion assay. Li and Strobel (2001) reported the isolation of antifungal compound Jesterone from endophytic fungus Pestalotiopsis jester. Serfling et al. (2007) reported that in field, the severity of Pseudocercosporella

Endophytic Microorganism

177

herpotrichoides disease was significantly reduced in plants colonized by the fungal endophyte, Piriformospora indica. Inhibitory effects against some species of migratory endoparasites occur in grasses infected by Neotyphodium endophytes (Kimmons et al., 1990). Neotyphodium species infect aerial tissues, not roots. Therefore, the inhibitory effects observed in infected plants were interpreted as the result of fungal alkaloids being translocated to roots. Non pathogenic strains of Fusarium oxysporum isolated from plant roots are a group of fungal endophytes known to be involved in antinematodal activity. In case of virus, the incidence of Barley yellow dwarf virus was found to be lower in Lolium pretense infected by the fungal endophyte, Neotyphodium than in endophyte free plants. In conclusion, diseases of fungal, bacterial or viral origin and in some instances even damage caused by insects and nematodes can be reduced following prior inoculation with bacterial or fungal endophytes (Strobel, 2006). Natural Products from Endophytes Most of the microorganisms are well known for their diverse range of secondary metabolic products including antibiotics, antifungal, antiviral, insecticidal agents, anti-cancerous compounds, volatile organic compounds, and immunosuppressant agents. Although, a wide range of biologically active compounds have been isolated from endophytic organisms, yet they are still an untapped source of novel natural products. Pseudomonas viridiflava, which has been isolated from the tissues of many grass species, was found to produce two novel antimicrobial compounds called ecomycins which represent novel lipopeptides made up of some unusual amino acids including hom*oserine and β-hydroxy aspartic acid (Miller et al., 1998). These compounds had the ability to inhibit the human pathogens Candida albicans and Cryptococcus neoformans. Guo et al. (2000) isolated viral inhibitors from Cytomaema sp. of fungi that inhibited human cytomegalovirus. However, isolation of antiviral compounds from bacterial endophytes has yet to be reported. Many fungal endophytes produce secondary metabolites and some of these compounds are antifungal and antibacterial which strongly inhibit the growth of other microorganisms including plant pathogens (Gunatilaka, 2006). Silva et al. (2006) isolated five cadinane sesquiterpenes derivatives from Phom*opis cassiae, which is an endophytic fungus of Cassia spectabilis and those derivatives were found to be antifungally active compound against Cladosporium sphaerospermum and C. cladsporioide. Altersetin, an alkaloid isolated from endophytic Alternaria spp., showed antibacterial activity against several pathogenic gram-positive bacteria (Hellwig et al., 2002). Volatile organic compounds like tetrohydofuran, 2-methyl furan, 2-butanone and aciphyllene which have antibiotic activities are produced by Muscodor albus, an endophytic fungus of tropical tree species (Atmosukarto et al., 2005). A list of natural products derived from some microbial endophytes is given in Table 1.

178

Microbes: In Action

TABLE 1: Natural products derived from various endophytic microorganisms. Bacterial and Fungal Endophyte

Associated Plant species

Pseudomonas viridiflava Grass Streptomyces NRRL Grevillea pteridifolia 30566 Serratia marcescens Rhyncholacis penicillata Paenibacillus polymyxa Wheat and Pinus Phom*opis cassiae Cassia spectabilis Muscodor albus

Tropical tree

Verticillium sp.

Rehmannia glutinosa Terminalia morobensis

Pestalotiopsis microspora

Product

Activity

Ecomycins B and C Kakadumycins

Antimicrobial Miller et al. (1998) Antibiotic Castillo et al. (2003) Antifungal Strobel et al. (2006) Antifungal Li et al. (2007) Antibiotic Silva et al. (2006)

Oocydin A Fusaricidin A–D Cadinane sesquiterpenes Tetrohydofuran

Antibiotic

Ergosterol peroxide

Antibiotic

Pestacin, Isopestacin

Antioxidant

Reference

Atmosukarto et al. (2005) You et al. (2009) Strobel et al. (2002)

Other natural products have also been obtained from endophytic fungi. Kharwar et al. (2009) detected Gignardic acid in the culture broth of an endophytic Gignardia sp. obtained from Spondias mombin. A novel compound from a Phom*opsis sp endophytic in Adenocarpus foliolosus was isolated and identified as phom*osine G (Daija Krhn et al., 2005). A novel taxol producing fungus Taxomyces andreanae, from the yew Taxus brevifolia was isolated and characterized (Huang et al., 2008). Endophytic fungus Penicillium sp JP-1 isolated from Aegiceras corniculatum showed cytotoxicity against A-549 cells (Lin et al., 2008). Jalgaonwala et al. (2011) reported that microbial endophytes from medicinal plants namely Aloe vera, Curcuma longa, Eucalyptus globules, Ocimum sanctum, Pongamia glabra, Vinca rosea and Sphaeranthus indicus have great ability to synthesize natural products as they exhibit excellent antimicrobial and antioxidant activity. Antioxidant metabolites are often produced by endophytic fungi. Pestacin and Isopestacin were obtained from fungal endophyte Pestalotiopsis microspora isolated from the plant Terminalia morobensis, native of the Papua New Guinea (Strobel et al., 2002). Verma et al. (2007) reported that the endophytic fungus Chloridium sp produces Javanicin which exhibits strong antibacterial activity against Pseudomonas sp. Endophytic fungus Phom*opsis sp YM 311483 produced ten membered lactone showing antifungal activity against Aspergillus niger, Botrytis cinere and Fusarium (Poncharoen et al., 2008). Patulin is a mycotoxin found to be produced by some of endophytic fungi. Nodulispotium sp endophytes are known to produce nodulisporic acid a novel diterpene that exhibits potent insecticidal properties against the larvae of the blowfly (Verma et al., 2007). TABLE 2: Activities of bacterial and fungal endophytes against different pathogens. Bacterial endophyte

Activity

Activity against

Pantoea agglomerans Bacillus megaterium

Antifungal Antifungal

Erwinia carotovora Phytophthora

Endophytic Microorganism

179

Bacterial endophyte

Activity

Activity against

Paenibacillus Neotyphodium Neotyphodium Trichoderma harzianum Chloridium sp Phom*opsis sp YM 311483 Nodulispotium sp Fusarium sp

Antifungal Antinematodal Antiviral Antibacterial Antibacterial Antifungal anti insect Antifungal

Rhizoctonia solani Nematodes Barley yellow dwarf virus Rhizoctonia solani Pseudomonas sp. Botrytis cinere Blowfly larvae Candida albicans

Endophytic Stimulation of Plant Secondary Metabolite Secondary metabolites are a group of compounds, which play a major role in the adaptation of plants to their environment (Bourgaud et al., 2001). Plants produce low molecular weight antimicrobial molecules called phytoalexins (Smith, 1996). Although, phytoalexins could also be formed by various nonbiological stress factors such as UV light, heavy metal or salt stress. Stoessl and Arditti (1984) reported that phytoalexins was first discovered in Orchis morio as a response to fungal attack.Li and Tao (2009) demonstrated that in suspension cultures of Taxus, to which fungal endophyte was added, led to the yield of pacl*taxel. It indicates that co-culturing with endophytic elicitor is an alternative way to enhance plant secondary metabolites and increase plant resistance. Fungal endophyte colonization results in the secretion of hydrolase of plant cell to limit the growth of fungi, thus, fragments of endophytes, acting as elicitor, are produced by hydrolization. Endophyte Mediated Phytoremediation In addition to the production of novel chemicals, many endophytes have shown a natural capacity for xenobiotic degradation. The ability of some endophytes to show resistance to heavy metals and degradation of organic compounds probably arises from their exposure to diverse compounds in the soil niche. The endophytic bacteria efficiently expressing necessary catabolic genes can promote the degradation of xenobiotic compounds. Siciliano et al. (2001) demonstrated that plants grown in soil contaminated with xenobiotics naturally recruited endophytes with the genes required for contaminant degradation. Genes encoding for nitro-aromatic compound degradation have been found to be more prevalent in endophytic strains than within rhizospheric or soil microbial communities. Van Aken et al. (2004) showed that Methylobacterium, isolated from Poplar trees had the capability of biodegrading 2, 4, 6-trinitrotoluene. Genetically engineered strains can be constructed in the absence of natural biodegradation ability. Endophytes of yellow lupin that were genetically constructed for nickel resistance, showed the ability to increase nickel accumulation and tolerance of inoculated plants (Lodewyckx et al., 2001). The copper resistant strains of endophytic Bacillus megaterium when introduced in Brassica napus increased root dry weight and above ground tissue copper content. Engineered Burkholderia cepacia showed increased plant tolerance to toluene and decreased the transpiration of toluene to the atmosphere (Barac et al., 2004). Since, toluene is one of the four components of BTEX contamination; this has

180

Microbes: In Action

the potential to improve phyto-remediation by decreasing toxicity. Similarly engineered Pseudomonas endophyte had the capability of degrading 2, 4dichlorophenoxyacetic acid (2, 4-D). The inoculated test plants showed no phytotoxicity and accumulation of herbicide in their tissues while uninoculated displayed signs of toxicity including biomass reduction and leaf abscission (Germaine et al., 2006). Table 3 outlines the potential role of some microbial endophytes in phytoremediation. TABLE 3: Potential role of some endophytic microorganisms in phytoremediation. Bacterial Endophyte

Associated Plant species

Pseudomonas aeruginosa strain Elymus dauricus R75 Methylobacterium populi BJ001 Populus deltoidesnigra DN34 Pseudomonas sp Populus cv. Hazendans Methylobacterium populi BJ001 Populus deltoidesnigra DN34 B. cepacia Bu61(pTOM-Bu61) Poplar Pseudomonas putida VM1450 Willow

Compound

Reference

Dichlorinated benzoic acids Methane

Siciliano et al. (2001)

BTEX TNT, RDX

Germaine et al. (2004) Van Aken et al. (2004)

Toluene 2,4-D

Taghavi et al. (2005) Germaine et al. (2006)

Van Aken et al. (2004)

Phytoremediation plays an ever-increasing role in the cleaning-up of contaminated land and water and it is envisaged that endophytes will play a major role in enhancing both the range of contaminants that can be remediated and the rate of their degradation. For using bacterial endophytes to improve xenobiotic remediation Newman and Reynolds (2005) indicated the major advantage that when genetic engineering of a xenobiotic degradation pathway is required, bacteria are easier to manipulate than plants. In addition, quantitative gene expression of pollutant catabolic genes within the endophytic populations could be a useful monitoring tool for assessing the efficiency of the remediation process. Concluding Remarks Different group of microorganisms coexist in the soil and are its important component. Plants secrete diverse compounds to interact with mutualistic beneficial microorganisms. These microbes on the other hand possess wide range of metabolic properties that enhances plant health. These microorganisms living inside plants intimately interact with cells of the host releasing plant growth promoting compounds and taking up secreted metabolites. This synergistic interaction exemplifies double-fitness trait which is active in plantendophyte partnership. The availability of nutrient elements is a major constraint to plant growth in most of the environments of the world. Understanding the role of non-symbionts in this area would be helpful in development of bio-inoculum. The approach of developing the bio-inoculum is appealing as the fertility of the soil may be increased by inoculating the best suited bacterial strain which in turn will give rise to a better plant population in the natural conditions without applying fertilizer input from outside.

Endophytic Microorganism

181

Inoculation of ornamentals, forestry, agricultural and desert crops with certain strains of plant growth promoting endophytic bacteria and fungi at an early stage of development can improve biomass production through direct effects on root and shoots growth and can result in multiple effects on early season plant growth, plant vigor, plant height, early bloom and chlorophyll content. Inoculation of endophytic strains may also help in production of plant hormones, control of fungal and bacterial diseases, insect pests and enhancement of supply of nutrients such as phosphorus, sulphur, iron and copper. The potential of non-symbiotic nitrogen fixation can provide an improved solution to promote plant development. The understanding of mechanistic aspects of endophytic bacteria and fungi acting as beneficial partners of host plants has great potential to aid in designing strategies to substantially improve the growth and health of host plants. This is especially true when the latter have to develop under stressful conditions. Thus, associations of plants with beneficial endophytic strains can be a valuable addition to toolbox of sustainable agriculture. REFERENCES Abdalla MH and Omar SA (1998). Wheat straw and cellulolytic fungi application increases nodulation, nodule efficiency and growth of fenugreek (Trigonella foenum-graecum L.) grown in saline soil. Biology and Fertility of soils. 25: 58-65 Ahmad F, Ahmad I, Aquil F, Khan MS and Hayat S (2008). Diversity and potential of nonsymbiotic diazotrophic bacteria in promoting plant growth. In: Ahmad I, Pichtel J and Hayat S, editors. Plant Bacteria Interactions. pp.81- 82 Ahmed N and Jha KK (1968). Solubilization of rock phosphate by microorganism isolated from Bihar soil. Journal of Applied Microbiology. 14: 89-95 Arnold AE (2007). Understanding the diversity of foliar endophytic fungi: progress, challenges, and frontiers. Fungal Biology Reviews. 21: 51- 66 Asea PEA, Kucey RMN and Stewart JWB (1998). Inorganic phosphate solubilization by two Penicillium species in solution culture and soil. Soil Biology and Biochemistry. 20: 459-464 Asghar HN, Zahir ZA and Arshad M (2004). Screening rhizobacteria for improving the growth, yield, and oil content of canola (Brassica napus L.) Australian Journal of Agricultural Research. 55: 187-194 Atmosukarto I, Castillo U, Hess WM, Sears J and Strobel G (2005). Isolation and characterization of Muscodor albus I-41.3s, a volatile antibiotic producing fungus. Plant Science. 169: 854-861 Attia M, Ahmed MA and El-Sonbaty MR (2009). Use of biotechnologies to increase growth, productivity and fruit quality of Maghrabi Banana under different rates of phosphorous. World Journal of Agricultural Sciences. 5: 211-220 Backman PA and Sikora RA (2008). Endophytes: An emerging tool for biological control. Biological Control. 46: 1-3 Bacon CW, Porter JK, Robins JD and Lutrell EJ (1977). Epichloe typhina from toxic tall fescue grass. Appl Env Microbiol. 34: 576-581 Bai Y, Zhou X and Smith DL (2003). Enhanced soybean plant growth resulting from coinoculation of Bacillus strains with Bradyrhizobium japonicum. Crop Science. 43: 1774-1781 Baldani VLD, Baldani JI, Olivares FL and Dobereiner J (1992). Identification and ecology of Herbaspirillum seropedicae and the closely related Pseudomonas rubrisubalbicans. Symbiosis. 19: 65-73 Bandara WMMS, Seneviratne G and Kulasooriya SA (2006). Interactions among endophytic bacteria and fungi: effects and potentials. Journal of Biosciences. 31: 645-650

182

Microbes: In Action

Barac T, Taghavi S, Borremans B, Provoost A, Oeyen L, Colpaert JV, Vangronsveld J and Van Der Lelie D (2004). Engineered endophytic bacteria improve phyto-remediation of water-soluble, volatile, organic pollutants. Nat. Biotechnol. 22: 583-588 Benhamou N, Kloepper JW, Quadt-Hallman A and Tuzon S (1996). Induction of defenserelated ultrastructural modification in pea root tissues inoculated with endophytic bacteria. Plant Physiology. 112: 919- 929 Benitez T, Rincon AM, Limon MC and Codon A (2004). Biocontrol mechanisms of Trichoderma strains. International Microbiology. 7: 249-260 Bent E and Chanway CP (1998). The growth-promoting effects of a bacterial endophyte on lodgepole pine are partially inhibited by the presence of other rhizobacteria. Canadian Journal of Microbiology. 44: 980-988 Boddey RM, De Oliveira OC, Urquiaga S, Reis VM, Olivares FL, Baldani VLD and Dobereiner J (1995). Biological nitrogen fixation associated with sugarcane and rice: contributions and prospects for improvement. Plant Soil. 174: 195-209 Bourgaud F, Gravot A, Milesi S and Gontier E (2001). Production of plant secondary metabolites: a historical perspective. Plant Science. 161: 839-851 Castillo U, Harper JK and Strobel GA (2003). Kakadumycins: novel antibiotics from Streptomyces sp. NRRL 30566, an endophyte of Grevillea pteridifolia. FEMS Microbiology Letters. 224: 183-190 Chernin L and Glick BR (2012). The Use of ACC Deaminase to Increase the Tolerance of Plants to Various Phytopathogens. Bacteria In: Agrobiology: Stress Management. Pp. 279299 Chowdhury SP, Schmid M, Hartmann A and Tripathi AK (2009). Diversity of 16S-rRNA and nif H genes derived from rhizosphere soil and roots of an endemic drought tolerant grass, Lasiurus sindicus. European Journal of Soil Biology. 45: 114-122 Chung KR and Tzeng DD (2004). Biosynthesis of Indole-3-acetic acid by the gall-inducing fungus Ustilago esculenta. Journal of Biological Sciences. 4:744-750 Compant S, Clement C and Sessitsch A (2010). Plant growth-promoting bacteria in the rhizoand endosphere of plants: Their role, colonization, mechanisms involved and prospects for utilization. Soil Biology and Biochemistry. 42: 669-678 Costa JM and Loper JE (1994). Characterization of siderophore production by the biological control agent Enterobacter cloacae. Molecular Plant-Microbe Interactions. 7: 440-448 Dai CC, Yu BY and Li X (2008). Screening of endophytic fungi that promote the growth of Euphorbia pekinensis. African Journal of Biotechnology. 7: 3505-3509 Daija Krhn K, Florke V, Gehle D, Aust HJ, drarger S, Schulz B and Rheinheimer J (2005). Novel Highly Substituted Biraryl Ethers, Phom*osines D–G, Isolated from the Endophytic Fungus Phom*opsis sp. from Adenocarpus foliolosus. European journal of organic chemistry. 23:5100-5105 Davis EC, Franklin JB, Shaw AJ, Vilgalys R (2003). Endophytic Xylaria Xylariaceae) among liverworts and angiosperms: phylogenetics, distribution and symbiosis. American Journal of Botany. 90: 1661-1667 Devarajan PT and Suryanarayanan TS (2006). Evidence for the role of phytophagous insects in dispersal of non-grass fungal endophytes. Fungal Diversity. 23: 111-119 Dias ACF, Costa FEC, Andreote FD, Lacava PT, Teixeira MA, Assumpcao LC, Araujo WL, Azevedo JL and Melo IS (2009). Isolation of micro propagated strawberry endophytic bacteria and assessment of their potential for plant growth promotion. World J Microbiol Biotechnol. 25:189-195 Dobereiner J (1992). History and new perspectives of diazotrophs in association with nonleguminous plants. Symbiosis. 13: 1-13 Doi T, Matsumoto H, Ohsh*ta N, Takemoto Y and Shinada T (2006). Microflora analysis on hydrogen fermentation of feedstock wastes. J. Water Waste. 48: 784-790 Dube HC, Vala AK and Vaidya SY (2000). Chemical nature and ligand binding properties of siderophores produced by certain Aspergillus from marine habitats. Natural Academy of Science Letters. 23: 98-100

Endophytic Microorganism

183

Esther Puente M, Ching Y Li and Bashan Y (2009). Endophytic bacteria in cacti seeds can improve the development of cactus seedlings. Environmemal and Experimental Botany. 66: 402-408 Felipe I, de Santi Ferrara, Machado Z, Hebert O, Gonzales HS, Floh EIS and Barbosa HR (2012). Endophytic and rhizospheric enterobacteria isolated from sugar cane have different potentials for producing plant growth-promoting substances. Plant and Soil. 353: 409-417 Forchetti G, Masciarelli O, Alemano S, Alvarez D and Abdala G (2007). Endophytic bacteria in sunflower (Helianthus annuus L.) isolation, characterization, and production of jasmonates and abscisic acid in culture medium. Appl Microbiol Biotechnol. 76:1145-1152 Gallery RA, Dalling JW and Arnold AE (2007). Diversity, host affinity and distribution of seed-infecting fungi: a case study with Cecropia. Ecol. 88: 582-588 Germaine K, Keogh E and Borremans B (2004). Colonisation of poplar trees by gfp expressing bacterial endophytes. FEMS Microbiol. Ecol. 48: 109-118 Germaine K, Liu X, Cabellos G, Hogan J, Ryan D and Dowling DN (2006). Bacterial endophyte-enhanced phyto-remediation of the organochlorine herbicide 2,4dichlorophenoxyacetic acid. FEMS Microbiol. Ecol. 57: 302-310 Gimenez C, Cabrera R, Reina M and Gonzalez CA (2007). Fungal endophytes and their role in plant protection. Curr. Org. Chem. 11: 707-720 Glick BR (1995). The enhancement of plant-growth by free-living bacteria. Canadian Journal of Microbiology. 41: 109-117 Gunatilaka AAL (2006). Natural products from plant-associated microorganisms: distribution, structural diversity, bioactivity and implications of their occurrence. J. Nat. Prod. 69: 509526 Guo B, Dai JR, Ng S, Huang Y, Leong C, Ong W and Carte BK (2000). Cytonic acids A and B: novel tridepside inhibitors of hCMV protease from the endophytic fungus Cytonaema species. J. Nat. Prod. 63: 602-604 Guo LD, Hyde KD and Liew ECY (2000). Identification of endophytic fungi from Livistonia chinensis based on morphology and rDNA sequences. New Phytology. 147: 617-630 Hallman J, Quandt-Hallman A, Mahaffee WF and Kloepper JW (1997). Bacterial endophytes in agricultural crops. Canadian Journal of Microbiology. 43: 895-914 Harman GE, Howel CR, Viterbo A, Chet I and Lorito M (2004). Trichoderma species opportunistic, avirulent plant symbionts. Nature Reviews Microbiology. 2: 43-56 Hellwig V, Grothe T, Mayer-Bartschmid A, Endermann R, Geschke FU, Henkel T and Stadler MA (2002). Altersetin A New antibiotic from cultures of endophytic Alternaria spp. taxonomy, fermentation, isolation, structure elucidation and biological activities. J. Antibiot. 55:881-892 Huang WY, Cai YZ, Hyde KD, Corke H and Sun M (2008). Biodiversity of endophytic fungi associated with 29 traditional Chinese medicinal plants. Fungal Diversity. 33: 61-75 Hurek B, Hurek T, Gillis M, Hoste B, Vancanneyt M, Kersters K and De Ley J (1993). Azoarcus, gen. nov., nitrogen-fixing Proteobacteria associated with roots of Kallar grass (Leptochloa fusca (L.) Kunth) and description of two species, Azoarcus indigens sp. nov. and Azoarcus communis sp. nov. International Journal of Systematic Bacteriology. 43: 574-584 Hyakumachi M (1994). Plant growth-promoting fungi from turf grass rhizosphere with potential for disease suppression. Soil Microorganisms. 44:53-68 Igual JM, Valverde A, Cervantes E and Velazquez E (2001). Phosphate-solubilizing bacteria as inoculants for agriculture: use of updated molecular techniques in their study. Agronomie. 21: 561-568 Jalgaonwala RE and Mahajan RY (2011). Isolation and characterization of endophytic bacteria from roots of Pongamia glabra. International Journal of Pharma and Biosciences. 2: 280-287 Jalgaonwala RE, Mohite BV and Mahajan RTA (2011). Natural products from plant associated endophytic fungi. J. Microbiol. Biotech. Res. 1: 21-32 Khan Z and Doty SL (2009). Characterization of bacterial endophytes of sweet potato plants. Plant Soil. 322:197-207

184

Microbes: In Action

Kharwar RN, Verma VC, Kumar A, Gond SK, Harper KJ, Hess WM, Lobkovosk E, Ma C, Ren Y and Strobel GA (2009). Current Microbiology. 58: 233-238 Kimmons CA, Gwinn KD and Bernard EC (1990). Nematode reproduction on endophyteinfected and endophyte- free tall fescue. Plant Disease. 74: 757-761 Kloepper JW (1997). Plant growth-promoting rhizobacteria (other systems) In: Azospirillum/plant associations. Ed. Okon, Y CRC Press, Boca Raton. pp.137-166 Kobayashi DY and Palumbo JD (2000). Bacterial endophytes and their effects on plants and uses in agriculture. In: Bacon CW and White JF (eds.) Microbial endophytes. Marcel Dekker, Inc., NY, New York. Pp. 199-233 Kogel KH, Franken P and Huckelhoven R (2006). Endophyte or parasite- what decides? Curr. Opin. Plant Biology. 9: 358-363 Kuldau G and Bacon C (2008). Clavicipitaceous endophytes: Their ability to enhance resistance of grasses to multiple stresses. Biol. Control. 46: 57-71 Kumar R, Jalali BL and Chand H (2002). Influence of vesicular arbuscular mycorrhizal fungi on growth and nutrient uptake in chickpea. Journal of Mycology and Plant Pathology. 32: 11-15 Lacava PT, Silva-Stenico ME, Araujo WL, Simionato AVC, Carrilho El, Tsai SM and Azevedo JL (2008). Detection of siderophores in endophytic bacteria Methylobacterium spp. associated with Xylella fastidiosa subsp. Pauca. Pesq. agropec. bras. 43: 521-528 Ladha JK De Bruijn FJ and Malik KA (1997). Introduction: Assessing opportunities for nitrogen fixation in rice- a frontier project. Plant and Soil. 124: 1-10 Lewis GC (2004). Effects of biotic and abiotic stress on the growth of three genotypes of Lolium perenne with and without infection by the fungal endophyte Neotyphodium lolii. Ann. Appl. Biol. 144: 53-63 Li J, Beatty PK, Shah S and Jensen SE (2007). Use of PCR-targeted mutagenesis to disrupt production of Fusaricidin-type antifungal antibiotics in Paenibacillus polymyxa. Applied Environmental Microbioogy. 73: 3480-3489 Li Y and Strobel GA (2001). Jestron and hydroxyl-jesteron antioomycel cyclohexenone epoxides from the Pestalotiopsis jester. Phytochemistry. 57: 261-265 Li YC and Tao WY (2009). Pacl*taxel-producing fungal endophyte stimulates the accumulation of taxoids in suspension cultures of Taxus cuspidate. Sci. Horticult. 121: 97102 Lima AO, Quecine MC, Fungaro MH, Andreote FD, Mac Cheroni WJR, Araujo WL, Silva-Filho MC, Pizzirani-Kleiner AA and Azevedo JL (2005). Molecular characterization of a beta1,4-endoglucanase from an endophytic Bacillus pumilus strain. Applied Microbiology and Biotechnology. 68: 57-65 Lin Z, Zhu T, Fang Y, Gu Q and Zhu W (2008). Polyketides from Penicillium sp. JP-1, an endophytic fungus associated with the mangrove plant Aegiceras corniculatum. Phytochemistry. 69:1273-1278 Lodewyckx C, Taghavi S, Mergeay M, Vangronsveld J, Clijsters H and Van Der Lelie D (2001). The effect of recombinant heavy metal resistant endophytic bacteria in heavy metal uptake by their host plant. Int. J. Phytoremed. 3: 173-187 Lodewyckx C, Vangronsveld J, Porteous F, Moore ERB, Taghavi S, Mezgeay M and Van der Lelie D (2002). Endophytic bacteria and their potential applications- Critical Review. Plant Science. 21: 583-606 Loper JE and Henkels MD (1997). Availability of iron to Pseudomonas fluorescens in rhizosphere and bulk soil evaluated with an ice nucleation reporter gene. Applied Environemtal Microbiology. 63: 99-105 Lu H, Zou WX, Meng JC, Hu J and Tan RX (2000). New bioactive metabolites produced by Colletotrichum sp., an endophytic fungus in Artemisia annua. Plant Science. 151: 67-73 Macagnan D, Romeiro RS, Pomella AWV and deSouza T (2008). Production of lytic enzymes and siderophores, and inhibition of germination of basidiospores of Moniliophthora (ex Crinipellis) perniciosa by phylloplane actinomycetes. Biol. Control. 47: 309-314

Endophytic Microorganism

185

Madhaiyan M, Poonguzhali S, Ryu J and Sa T (2006). Regulation of ethylene levels in canola (Brassica campestris) by 1-aminocyclopropane-1-carboxylate deaminase-containing Methylobacterium fujisawaense. Planta. 224: 268–278 Mano H and Hisao M (2008). Endophytic bacteria in rice plant. Microbres Environ. 23: 109117 Medina A, Jakobsen I, Vasiilev N, Azcon K and Larsen J (2007). Fermentation of sugar beet waste by Aspergillus niger facilitate growth and P uptake of external mycelium of mixed populations of arbuscular mycorrhizal fungi. Soil Biology and Biochemistry. 39: 485-492 Miethke M and Marahiel M (2007). Siderophore-based iron acquistion and pathogen control. Microbiol. Mol. Biol. Rev. 71: 413-451 Miller CM, Mille RV, Garton-Kenny D, Redgrave B, Sears J, Condron MM, Teplow DB and Strobel GA (1998). Ecomycins, unique antimycotics from Pseudomonas viridiflava. Journal of Applied Microbiology. 84: 937-944 Mittal V, Singh O, Nayyar H, Kaur J and Tewari R (2008). Stimulatory effect of phosphatesolubilizing fungal strains (Aspergillus awamori and Penicillium citrinum) on the yield of chickpea (Cicer arietinum L. cv. GPF2). Soil Biology and Biochemistry. 40: 718-727 Nahas E (1996). Factors determining rock phosphate solubilization by microorganisms isolated from soil. World Journal of Microbiology and Biotechnology. 12: 567-572 Naseby DC, Pascual JA and Lynch JM (2000). Effect of biocontrol strains of Trichoderma on plant growth, Pythium ultimum populations, soil microbial communities and soil enzyme activities. Journal of Applied Microbiology. 88: 161-169 Newman LA and Reynolds CM (2005). Bacteria and phytoremediation: new uses for endophytic bacteria in plants. Trends Biotechnol. 23:6-8 Ojha S, Chakaraborty MR, Dutta S and Chatterjee NC (2008). Influence of VAM on nutrient uptake and growth of custard-apple. Asian Journal of Experimental Sciences. 22: 221-224 O'Sullivan DJ and O'Gara F (1992). Traits of fluorescent Pseudomonas spp. involved in suppression of plant root pathogens. Microbiology Reviews. 56: 662-676 Petrini O (1991). Fungal endophytes of trees leave. In: Andrews, J and Hirano, S (eds.) Microbial ecology of leaves. New York: Springer Verlag. pp: 179-197. Phuwiawat W and Soytong K (1999). Growth and yield response of Chinese radish to application of Trichoderma harziznum. Thammasat International Journal of Science and Technology. 4: 68-71 Pitchai P, Chauhan PS, Venkatakrishnan SS, Rangasamy A and Tongmin Sa (2010). Isolation and characterization of plant growth promoting endophytic bacterial isolates from root nodule of Lespedeza sp. Biology and Fertility of Soils. 46: 807-816 Poncharoen V, Rukachaisirikul S, Phongpaichit T, Kuhn M, Pelzing M and Sakayaroj WC (2008). Phytochemistry. 69: 1900-1902 *(original not seen) Rajankar PN, Tambekar DH and Wate SR (2007). Study of phosphate solubilization efficiencies of fungi and bacteria isolated from saline belt of purna river basin. Research Journal of Agriculture and Biological Sciences. 3: 701-703 Richardson AE, Barea JM, McNeill AM and Prigent-Combaret C (2009). Acquisition of phosphorus and nitrogen in the rhizosphere and plant growth promotion by microorganisms. Plant Soil. 321: 305-339 Rodriguez RJ, Redman RS and Henson JM (2004). The role of fungal symbiosis in the adaptation of plants to high stress environments. Mitig Adap Strat Glob Change. 9: 261272 Saikkonen K, Faeth SH, Heande M and Sullivan TJ (1998). Fungal endophytes: a continuum of interactions with host plants. Ann Rev Ecol Syst. 29: 319-343 Saikkonen K, Ion D and Gyllenberg M (2002). The persistence of vertically transmitted fungi in grass metapopulations. Proceedings of the Royal Society B, Biological Sciences. 269: 13971403 Sakai M, Matsuka A, Komura T and Kanazawa S (2004). Application of a new PCR primer for terminal restriction fragment length polymorphism analysis of the bacterial communities in plant root. J. Microbiol. Methods. 59: 81-89

186

Microbes: In Action

Sanchez MS, Bills GF and Zabalgogeazcoa I (2007). The endophytic mycobiota of the grass Dactylis glomerata. Fungal Diversity. 27: 171-195 Schardl CL, Leuchtmann A and Spiering MJ (2004). Symbioses of grasses with seed borne fungal endophytes. Ann Rev Plant Biol. 55: 315-340 Seghers D, Wittebolle L, Top EM, Verstraete W and Sciliano SD (2004). Impact of agricultural practices on the Zea mays (L.) endophytic community. Applied Environmental Microbiology. 70: 1475-1482 Serfling A, Wirsel SGR, Volker Lind V and Deising HB (2007). Performance of the biocontrol fungus Piriformospora indica on Wheat under greenhouse and field conditions. Biological Control. 97: 523-531 Sharma A and Johri BN (2003). Growth promoting influence of siderophore-producing Pseudomonas strains GRP3A and PRS9 in maize (Zea mays L.) under iron limiting conditions. Microbiol. Research. 158: 243-248 Shenker M, Ghirlando R, Oliver I, Helmann M, Hadur Y and Chen Y (1995). Chemical structure and biological activities of a siderophore produced by Rhizopus arrhizus. Soil Science Society of America Journal. 59: 837-843 Shimada A, Takeuchi S, Nakajima A, Tanaka S, Kawano T and Kimura Y (2000). Phytotoxicity of Indole-3-acetic acid produced by the fungus Phythium aphanidermatum. Bioscience, Biotechnology and Biochemistry. 64: 187-189 Shivanna MB, Meera MS and Hyakumachi M (1996). Role of root colonization ability of plant growth promoting fungi in the suppression of take-all and common root rot of wheat. Crop Protection. 15: 497-504 Shoresh M, Yedida I and Chat I (2005). Involvement of jasmonic acid/ethylene signaling pathway in the systemic resistance induced in cucumber by Trichoderma asperellum T203. Phytopathology. 95: 76-84 Siciliano S, Fortin N and Himoc N (2001). Selection of specific endophytic bacterial genotypes by plants in response to soil contamination. Applied Environ. Microbiology. 67: 2469-2475 Silva GH, Teles HL, Zanardi LM, Marx Young MC, Eberlin MN, Hadad R, Pfenning LH, CostaNeto CM, Castro-Gamboa I, Bolzani YS and Araujo AR (2006). Cadinane sesquiterpenoids of Phom*opsis cassiae, an endophytic fungus associated with Cassia spectabilis (Leguminosae). Phytochemistry. 67: 1964-1969 Smith CJ (1996). Accumulation of phytoalexins: defense mechanism and stimulus response system. New Phytologist. 32: 1-45 Srivastav S, Yadav KS and Kundu BS (2004). Prospects of using phosphate solubilizing Pseudomonas as biofungicide. Indian Journal of Microbiology. 44: 91-94 Stoessl A and Arditti J (1984). Orchid phytoalexins. In: Arditti, J (Ed.), Orchid Biology. Reviews and Perspectives, III. Cornell University Press, Ithaca, pp. 151-175 Stone JK Bacon CW and White Jr. JF (2000). An overview of endophytic microbes: endophytism defined. In: Bacon CW, White Jr. JF. (Eds.), Microbial Endophytes. Marcel Dekker, New York, pp. 3-30 Stone JK, Polishook JD and White JF (2004). Endophytic fungi. In: Biodiversity of fungi. Inventory and monitoring methods (Mueller GM, Bills GF, Foster MS, eds). Elsevier Academic Press, San Diego, USA. pp. 241-270 Strobel GA (2006). Harnessing endophytes for industrial microbiology. Curr. Opin. Microbiology. 9: 240-244 Strobel GA, Ford E, Worapong J, Harper JK, Arif AM, Gran DM, Fung PCW and Chan K (2002). Phytochemistry. 60: 179-183 Tadych M, Bergen M, Dugan FM and White JF (2007). Evaluation of the potential role of water in spread of conidia of the Neotyphodium endophyte of Poa ampla. Mycology Research. 111: 466-472 Taghavi S, Barac T, Greenberg B, Borremans B, Vangronsveld J and Van Der Lelie D (2005). Horizontal gene transfer to endogenous endophytic bacteria from poplar improved phyto-remediation of toluene. Applied Environmental and Microbiology. 71: 8500-8505

Endophytic Microorganism

187

Tian F, Ding Y, Zhu H, Yao L and Du B (2009). Genetic diversity of siderophore-producing bacteria of tobacco rhizosphere. Brazilian Journal of Microbiology. 40: 276-284 Tiwari M, Paroda S and Dadarwal KR (2003). Associative diazotrophs of pearl-millet from semi-arid region-Isolation and characterization. Indian Journal of Experimental Biology. 41: 341-345 Tudzymski B and Sharon A (1994). Biosynthesis, biological role and application of fungal phytohormones. In: The Mycota: A comprehensive treatise on fungi as experimental systems for basic and applied research. pp.183-185 Unyayar S (2001). Changes in Abscisic acid and Indole acetic acid concentrations in Funalia trogii (Berk.) Bondartsec and Singer and Phanerochaete chrysosporium Burds ME446 subjected to salt stress. Turkish Journal of Botany. 26: 1-4 Van Aken B, Peres C, Doty S, Yoon J and Schnoor J (2004). Methylobacterium populi sp. nov., a novel aerobic, pink-pigmented, facultatively methylotrophic, methane-ultilising bacterium isolated from poplar trees (Populus deltoides x nigra DN34). Evol. Microbiol. 54: 1191-1196 Van Loon LC, Bakker P and Pieterse CMJ (1998). Systemic resistance induced by rhizosphere bacteria. Annual Review of Phytopathology. 36: 453-483 Vega FE, Posada F, Aime MC, Pava-Ripoll M, Infante F and Rehner SA (2008). Entomopathogenic fungal endophytes. Biol. Control. 46: 72- 82 Verma A, Verma S, Sudha Sahay N, Butehorn B and Franken P (1999). Piriformospora indica, a cultivable plant growth promoting root endophyte. Applied and Environmental Microbiology. 65: 2741-2744 Verma M, Bra SK, Tyagi RD, Surampalli RY and Valero JR (2007). Antagonistic fungi, Trichoderma spp.: Panoply of biological control Biochemical Engineering Journal. 37: 1-20 Verma VC, Gond SK, Kumara A, Kharwar RN and Strobel GA (2007). The endophytic mycoflora of bark, leaf and stem tissue of Azadirachta indica A. Juss (Neem) from Varanasi (India) Microbial Ecology. 54: 119-125 Wakelin SA, Warren RA, Harvey PR and Ryder MH (2004). Phosphate solubilization by Penicillium spp. closely associated with wheat roots. Biol. Fertil. Soils. 40: 36-43 Waller F, Achatz B, Baltruschat H, Fodor J, Becker K, Fischer M, Heier T, Huckelhoven R, Neumann C, Von Wettstein D, Franken P and Kogel KH (2005). The endophytic fungus Piriformospora indica reprograms barley to salt-stress tolerance, disease resistance, and higher yield. PNAS USA. 102: 13386-13391 Watt M, Kirkegaard JA and Passioura J (2006). Rhizosphere biology and crop productivity- a review. Australian Journal of Soil Research. 44: 299-317 You F, Han T, Wu JZ, Huang BK and Qin LP (2009). Antifungal secondary metabolites from endophytic Verticillium sp. Biochem Syst Ecol. 37: 162-165 Zang W, Becker D and Cheng QA (2006). Mini review of recent WO, Resent patents on anti infective drug discovery. 1: 225-230

CHAPTER 12 Horizontal Gene Transfer: A Determining Factor of Microbial Diversity Santosh Kumar Mehar and S. Sundaramoorthy Department of Botany, Jai Narain Vyas University, Jodhpur-342001 India Corresponding author: [emailprotected]

INTRODUCTION The Tree of Life (TOL) symbol has dominated evolutionary biology ever since Darwin introduced it in the "Origin of species" as a depiction of the entire history of life forms on earth. It was then followed by the three-domain tree of ribosomal RNA (rRNA), which was professed as an authentic accomplishment of tree thinking in biology. However, phylogenomics i.e. genome-wide analysis of gene phylogenies, reveals a more complex picture of evolution, and in prokaryotes, phylogenetic trees of individual genes possess differences, which are not the artefacts of phylogenetic reconstruction, and require some other reasons for explaining them, such as extensive horizontal gene transfer (HGT) in the prokaryotic world. HGT results in the incorporation of radically new genetic information by the genomes. It has a very high rate and could create very large species pan-genomes (Tettelin et al., 2008). Up to 96% of the genes in a given prokaryote genome have been reported to be affected by HGT (Kunin and Ouzounis, 2003; Dagan et al., 2008), and it has been estimated that HGT contributes to the extent of 25% of all expansions of protein families (Pushker et al., 2004), which could be upto 60% for large protein families (Lerat et al., 2005). The analysis of individual genes in different organisms has shown several cases of HGT on the basis of comparison of sequence characteristics. Using this approach it was estimated that 10-16% of E. coli chromosome arose through HGT. As complete genome sequences of more and more organisms are becoming available (due to the developments in sequencing techniques), cross comparisons can be carried out to know the extent of horizontally acquired sequences in different organisms. Potentially foreign genes can be identified by their atypical nucleotide compositions, or pattern of codon usage bias (Lawrence and Ochman, 1997; Lawrence and Ochman, 1998a). Comparison of completely sequenced genomes has confirmed that bacteria have experienced significant amount of HGT, resulting in noteworthy alterations in their chromosome make up. As on today, the bacterial chromosomes are a mosaic of ancestral and horizontally acquired sequences. For example, the hyperthermophilic eubacteria Aquifex aeolicus and Thermotoga maritime both contain a large number of genes that are very similar

190

Microbes: In Action

in protein sequences and in their arrangements to hom*ologues in Thermophilic archaea (Ochman et al., 2000). We get indication of horizontal gene transfer usually when a gene sequence from a particular organism shows the strongest similarity to a hom*olog from a distant taxon. When more and more genome sequences became available and cross comparisons became a sort of routine exercise, this was the time for the advent of the new age of "lateral genomics" (Doolittle, 1999a). Tatusov et al. (1996) suggested differences in gene repertoires even among bacteria that belong to the same evolutionary lineage, such as E. coli and Haemophilus influenzae. This point to the fact that genome evolution could not be reasonably described in terms of vertical descent alone. Although much of the difference could be attributed to differential gene loss, specially in the parasites, but the emerging complex picture of prokaryotic genomes could be explained better by horizontal gene transfer. The ability of microbes to absorb DNA from the environment and to integrate it into the genome had been dramatically demonstrated in the AveryMcLeod-McCarthy experiment of 1943 that proved the role of DNA as the genetic material. Further, the evidence that horizontal gene transfer (HGT) could occur was the recognition that virulence determinants could be transferred between pneumococci in infected mice, a phenomenon that was later shown to be mediated by the uptake of DNA in a process called transformation (Griffith, 1928). In spite of all this, the significance of HGT for bacterial evolution was not recognized until the 1950s, when multidrug resistance patterns emerged on a worldwide scale (Davies, 1996). The mechanism by which certain bacteria developed resistance to the same kind of antibiotics showed that these traits were transferred among taxa, and not generated de novo by different lineages. Although the impact of lateral gene transfer on bacterial evolution was not fully appreciated until late; these findings of rapid evolution by gene acquisition strongly point towards some important questions related with the process, like;  

how to identify the process of HGT where do the genes come from, and what is the mechanism for transfer of the genes  which kind of and how many traits have been introduced through the process of HGT, and  what is the relative rate at which different classes of genes are mobilized among genomes Determining whether a new trait or a specific genetic region is the result of horizontal gene transfer is not a straightforward process. In most cases of HGT in the recent or evolutionary history of bacterial species the actual transfer events are rarely observed or, we could say, can be observed. This means, the search has to be made for other evidences of their occurrence. HGT has a property that it creates a very high degree of similarity between the donor and the recipient strains for the particular character. Besides, since each transfer event involves the introduction of DNA into a single lineage, the acquired trait as a result will be limited to the descendents of the recipient strain, and lacking in the other closely related taxa. This results in a scattered

Horizontal Gene Transfer

191

phylogenetic distribution. The answer to the other question: which kind of traits are transferred by HGT?, needs to be addressed with caution, because HGT can not be the sole reason for random occurrence of some phenotypic traits, like the ability to withstand a particular antibiotic, since these properties can easily originate through point mutations also in the existing genes, and could evolve independently in divergent lines. Thus, it demands a more strict scrutiny to discriminate between convergent evolution and horizontal gene transfer. The strongest evidence that we could have, both for, and against the HGT, is the analysis of DNA sequences. The information in the DNA sequences can be used in a variety of ways to identify the instances of HGT, but the underlying application is always to discover features which could indicate that the evolutionary history of genes in a particular region differs significantly from that of ancestral i.e. vertically transmitted genes. The specific regions acquired through HGT will show high level of DNA or protein sequence similarities to genes from taxa very divergent from the organism group under study. The significance of aberrant phylogenies can be evaluated by phylogenetic congruency tests or related means (Swofford, et al., 1996). When investigating HGT in bacteria, there is an inbuilt advantage that bacterial species display a wide degree of variation in their overall G+C content, but genes in a particular species' genome are quite similar with regard to their base composition, pattern of codon use and frequency of di- and trinucleotides (Karlin et al., 1998). As a result, sequences that are new to a bacterial genome (i.e., introduced through HGT), would retain the sequence characteristics of the donor genome, and thus can be easily distinguished from the ancestral DNA (Lawrence and Ochman, 1998b). This feature has been noticed repeatedly in a number of studies; for example, Salmonella enterica and Escherichia coli both are enteric bacteria, and closely related to each other. In fact, S. enterica is pathogenic sister species of E. coli. Research has revealed that S. entierica has several genes that are not present in E. coli (or in any other enteric species), and have base composition that is significantly different form the overall 52% G+C content of the entire chromosome (Groisman et al., 1992). Within S. entierica several contain serovars (lineages that exhibit a distinct composition of flagellar and/or lipopolysaccharide surface antigens) with more than a megabase of DNA not present in other serovars. The base composition of these sequences suggests that at least half of them were acquired through HGT. Besides, the regions adjacent to such sequences contain remnants of sequences which could have affected their integration like parts of transposable elements, transfer regions of plasmids or known attachment sites of phage integers, which further confirm their mode of acquisition. There are suggestions that hom*ologous recombination could also be a reason for genetic exchange within and between bacterial species. However, the process of hom*ologous recombination is more successful in integrating DNA into the chromosome when the donor and recipient are relatively closely related, and this type of genetic exchange could principally affect the variation in existing genes rather than introducing new and unique traits to the genome. Hence, its role in ecological and physiological diversification of bacteria will be insignificant.

192

Microbes: In Action

Another important question with particular reference to HGT is when and how the sequences are acquired. There are three prerequisites for acquisition of new characters through horizontal gene transfer, viz., 1. there has to be a means for the donor DNA to be delivered into the recipient cell. 2. the acquired sequences must be incorporated into the recipient's genome, or gets coupled with autonomous replicating element), and more importantly, 3. the incorporated genes must be expressed in a manner that befits the recipient microorganism. The first two steps occur through any of the following mechanisms: 1. Natural transformations in which the uptake, integration and expression of extracellular DNA occurs under natural populations of bacteria. Through this mechanism bacteria can acquire DNA from foreign species which are not accessible to mobile genetic elements or bacteriophages. The requirement for this process is that the bacteria should first develop a physiological state of competence. Some bacterial species such as Neisseria gonorrhoeae and Haemophilus influenzae, are competent to accept DNA, whereas some others, such as Bacillus subtilis and Streptococcus pneumoniae, become competent after reaching a certain physiological stage in their life cycle (Dubnau, 1999). 2. Conjugative transfer which involves the acquisition of plasmid, and is mediated by cell to cell junctions and a pore through which DNA passes. This system has plasmid as the important component. The transfer of DNA in small units through the plasmid carriers is possible and is found to be preferred because, the transfer of whole chromosomes could take an hour, a duration too long to keep the interbacterial junction intact. Conjugation can mediate the transfer of genetic material between domains (for example, between bacteria and plants, and between bacteria and yeast; Buchanan et al. (1987). 3. Virus-mediated gene transfer which involves the transfer of genetic material through viruses between different bacteria, and its importance cannot be undermined (Lawrence et al., 2002). New genetic material that is introduced into a bacterium by a bacteriophage could be of two types viz. (i) generalized transduction when the bacteriophage packages random DNA fragments or (ii) specialized transduction when the bacteriophage transfers DNA fragments adjacent to the phage attachment site. The amount of DNA that can be transferred in a single event is limited by the size of the phage capsid, but can be more than 100 kilobases (kb). Although phages are prevalent in the environment (Schicklmaier and Schmieger, 1995; Jiang and Paul, 1998) the spectrum of microorganisms that can be transduced depends upon receptors recognized by the bacteriophage. Like transformation, transduction does not require donor and recipient cells to be present at the same place, or even the same time. On the other hand, phage-encoded proteins not only mediate the delivery of double-stranded DNA into the recipient cytoplasm, but can also promote the integration of DNA into the chromosome and protect the transferred sequences from degradation by host restriction endonucleases.

Horizontal Gene Transfer

193

4. Recently a new transfer mechanism, mediated through nanotubes has been discovered (Dubey and Ben-Yehuda, 2011). These nanotubes are tubular protrusions made up of membrane components that can bridge between neighboring cells and conduct the transfer of DNA and proteins. High transformability has been demonstrated for a variety of microbial species (Lorenz and Wackernagel, 1994). Since microbes typically coexist in tightly knit communities such as microbial mats and the microflora of animal intestines (Ward et al., 1998), it appears that opportunities should be plentiful for DNA transfer by various means between diverse prokaryotes and potentially even between eukaryotes and prokaryotes, although in the latter case, the extra complication of getting rid of introns found in the eukaryotic genes has to be taken care of. Instances of HGT abound in different lineages of microbes, for example, the analysis of genomes of archaebacteria give indication of massive horizontal gene transfer. This is in agreement with the earlier indications from phylogenetic studies, but now on the whole-genome scale. It is now proven that archaeal proteins split into those genes that were most similar to their bacterial hom*ologs and that looked like "eukaryotic" (Doolittle and Logsdon, 1998). Bare some exceptions like, the bacterial and eukaryotic proteins in archaea were clearly divided along functional lines, such as the ones involved in information processing (translation, transcription, and replication) showed the eukaryotic affinity, on the other hand the metabolic enzymes along with the structural components, and many uncharacterized proteins were more related to bacterial types. Since the percentage of informational components are generally less among the horizontally transferred genes (some exceptions are there), which is in accord with the standard model of early evolution whereby eukaryotes share a common ancestor with archaea, these observations are cautiously explained by massive gene exchange between archaea and bacteria (Koonin et al., 1997). This view was further supported by Aravind et al. (1998) and Nelson et al. (1999) on the basis of study of genomes of two hyperthermophilic bacteria, Aquifex aeolicus and Thermotoga maritime, mentioned earlier. Each of these genomes had large fraction of archaeal genes in comparison to any of the other bacterial genomes. This example establishes a plausible connection between the similarity in the lifestyle of organisms which are evolutionarily very distant, and the perceptible pace of horizontal gene exchange between them. Also, these findings emphasize the issue of the adaptive versus opportunistic nature of horizontal gene transfer, and raise some questions, such as; did the genes acquired from archaea enabled these bacteria to thrive in hyperthermal conditions, or did they acquire more archaeal genes just because they have been more exposed to contacts with archaea owing to their thermophily? Ponting et al. (1999) has found another case of nonrandomness in the horizontal gene transfer in the genome of the cyanobacterium Synechocystis sp. It encodes a variety of proteins associated with different forms of signaling that have been thought of as more of eukaryotic in nature. Questions about HGT abound, still one more is; once the genes have been acquired by bacteria through HGT means "What is the fate of these HGTs and

194

Microbes: In Action

what is their effect on bacteria". The answer is not straightforward but could be any of the suggestions given below: 

A significant number of the horizontally acquired genes could have deleterious effects on the chromosome of the recipient bacteria. As a result these bacteria in due course of time will be lost from the population. This will be similar to the loss of deleterious mutations from the genome  A part of the horizontal acquisitions could have neutral effect, and its survival therefore will depend on chance events  DNA which confers a selective advantage to the host, or mobile genetic elements that encode their own transfer and maintenance functions, have the potential to spread rapidly within a bacterial population. Jain et al. (1999) postulated that where HGTs succeed between distantly related organisms, the genes most likely to be involved belong to the simplest sets of functional networks. As mentioned earlier, there are different mechanisms for the process of HGT, and these mechanisms themselves can determine which one is needed when, which gene(s) are transferred, and between which group(s) of organisms. The third mechanism of gene transfer i.e., transduction has great impact on the status of diversity of bacteria. Many studies (Bergh et al., 1989; Proctor, 1991; Suttle et al., 1990), which were aimed at estimating the numbers of viruses and the frequency of infection of bacteria by viral particles have shown that viruses could be responsible in part or in major to influence the diversity of bacteria. Thingstad and Lignell (1997) advocated the hypothesis "killing the winner", which means the lytic viruses can keep in check competitive dominants and thus allow for the coexistence of less competitive populations and even sustain bacterial diversity. This model was further supported by the study involving phage-host systems in isolation. The results point to the fact that phages propagate as a function of host density and can therefore in turn control hosts' abundance. The study of Hennes et al. (1995) can be taken as an example who have shown that when Vibrio natriegens strain PWH3a was added to sea water (the same water from which it was isolated), there followed a bloom of the strain, and ultimately indigenous phages terminated the bloom resulting in a strong increase in the abundance of phages which were able to produce plaques on culture plates with this strain. Middelboe et al. (2001) reported in multi host systems that phages changed the clonal composition of the hosts by forcing the formation of resistance mechanisms. Some reports (Waterbury and Valois, 1993; Suttle and Chan, 1994) have shown the virus-induced resistance even in cyanobacteria, both in laboratories and in situ studies. Some other evidences come from the geographical and temporal variability of viral populations in Chesapeake Bay (Wommack et al., 1999a,b) and from the dynamics of viral populations in mesocosms (Øvreås et al., 2003) when determined by PFGE. These data show predator–prey-type oscillations of different phages and their hosts, wherein the total abundance of bacteria and viruses remained relatively stable (Wommack et al., 1999a,b). Weinbauer and Höfle (1998) found that when freshwater bacterial community was incubated with, and without the viral community from the same sample, it

Horizontal Gene Transfer

195

resulted in changes in abundance and growth rates of bacterial populations as well as, in changes of the community composition. The results of similar type of experiments on phytoplankton (Suttle, 1992) or plankton community composition (Peduzzi and Weinbauer, 1993) were found to be influenced by adding viruses. Virus-induced mass lysis event of filamentous cyanobacteria needs to be looked at from a different perspective to understand the impact on the composition of the community and its effect on the diversity of the microbes living therein. This mass lysis can cause great changes in community composition as noted by Van Hannen et al. (1999). Although the "killing the winner" concept could hold true here also, it is quite possible that the mass release of organic matter during cell lysis changes the composition and bioavailability of organic nutrients, which in turn brings significant changes in the community composition of bacteria. It has earlier been shown (Arrieta and Herndl, 2002) that changes in the DOM composition can undeniably affect bacterial community structure. Middelboe (2000) has also suggested that the release of organic matter caused by the influence of viruses has significant impact on the composition of bacterial community. The impact of virus mediated lysis has other tenets also, such as; the lysis products could include phage borne enzymes which can kill cells, which in turn can influence the community composition. Thus community composition and functioning is demonstrated to be influenced by the viruses, but how much do they contribute in shaping the diversity of the communities remained unclear, until the advent of whole genome sequencing; the picture has started to become clearer now, and recent studies have clearly established the extent of HGT. Some examples can further illustrate this; genome size of E. coli is quite variable and ranges from 4.5 to 5.5 Mb, although its rRNA operon is reported to be highly conserved. Genome of E. coli strain O157 Sakai has a huge amount of strain-specific DNA (1.44Mb) which contains 18 prophages or leftovers of prophages, which account for ~50% of the strain specific sequences. Besides this, Hayashi et al. (2001) has reported that six large chromosome segments, which represent prophage like genetic elements are part of O157. This points to the fact that it has encountered high rate of virus mediated HGT. Ohnishi et al. (2001) have therefore suggested that phage genomes are integral part of O157 genomes, and that phages have played a predominant role in the evolution of this strain. Since other strains also contain large numbers of prophages, prophage remnants and phage-related elements; bacteriophages appear to be major contributors to the genome diversification of E. coli. This serves as an example as to how phages could have influenced evolutionary diversification and speciation. Many researchers (Saye et al., 1987; Jiang and Paul, 1998; Paul, 1999) have shown that virus-mediated HGT is important in both the freshwater and marine systems, however, transduction rates can not be measured easily in situ. Besides, the transduction frequencies also vary over orders of magnitude from 10−8 to 10−5 per virus. Studies with auxotrophic E. coli cells have shown that in these cells the

196

Microbes: In Action

amino acid prototrophy was acquired from marine algae (Chiura et al., 2000). Since this transfer of DNA from the marine algae to a non marine enterobacterium could only have resulted from broad host range transduction. The assumption that phages do not cross the genus barrier (Ackermann and DuBow, 1987) comes under scrutiny, lately Jensen et al. (1998) has argued that the narrow host range is an isolation artifact. Further, Wichels et al. (1998) have shown that host range can vary greatly between marine phages. In this connection, Suttle (2005) has also shown a large variability of host ranges for cyanophages. According to Azam (1998), and Long and Azam (2001) microorganisms are not hom*ogeneously distributed in the ecosystem, but concentrated in patches with organic matter aggregates or around the decaying phytoplankton cells in aquatic systems. Since the bacteria and viruses are highly aggregated in organic aggregates, this results in increased infection frequency of prokaryotes, which could reach great proportions. Similarly, enhanced transduction is noticed on suspended material in freshwater probably for the similar reason that there is higher contact rate between bacteria and phages. This shows that hot spots of activity are also hot spots of HGT in general. What is the ultimate result of gene transfer event? The answer to the question depends on whether it happened within or among the species as pointed out by Torsvik et al. (2002). Gene transfer within species is supposed to slow down the diversification by increasing genetic similarity. This results in higher standing stocks of (more or less) identical genomes. These identical genomes will have a higher chance of survival provided the environment remains stable. Gene transfer across species and genus barriers, on the other hand, should support adaptation and increase diversity. For example, acquiring noval genes could open new ecological niches (Ochman et al., 2000) and increase the geographical distribution of species. The new niches would also allow for gene transfer with prokaryotic species in these niches. Summarizing the discussion, it can be said that viruses potentially shape the standing stock and the flux of genetic information. This in turn has the potential to influence the ecology, and also the evolution of species as pointed out by Ilippis and Villarreal (2000). dsDNA phages thus have access to the global phage DNA pool by means of lateral gene transfer. However, this access could not be so uniform owing to host range barriers (Hendrix et al., 1999). As suggested by some researchers (Chiura, 1997; Jensen et al., 1998; Wichels et al., 1998), if the host ranges are indeed broad, it will enable more speedy transfer of genetic material through increased access to diverse hosts. Ultimately, as pointed out by Doolittle (1999b), prokaryotes could be seen as global superorganisms owing to the potential of HGT. This virus mediated gene transfer and viral genes enormously extend the possibility of generating genetic variability beyond that caused by point mutations, recombination and sexual exchange. ACKNOWLEDGEMENT The authors gratefully acknowledge the UGC-SAP II- CAS funding for the Department of Botany, JNV University, Jodhpur.

Horizontal Gene Transfer

197

REFERENCES Ackermann H and DuBow M (1987). Viruses of Prokaryotes, Volume 1, General Properties of Bacteriophages. CRC Press, Boca Raton, Florida Aravind L, Tatusov RL, Wolf YI, Walker DR and Koonin EV (1998). Evidence for massive gene exchange between archaeal and bacterial hyperthermophiles. Trends Genet. 14: 442-444 Arrieta JM and Herndl GJ (2002). Changes in bacterial β-glucosidase diversity during a coastal phytoplankton bloom. Limnology and Oceanography. 47: 594-599 Azam F (1998). Microbial control of oceanic carbon flux: the plot thickens. Science. 280: 694695 Bergh O, Borsheim KY, Bratbak G and Heldal M (1989). High abundance of viruses found in aquatic environments. Nature. 340: 467-468 Buchanan-Wollaston V, Passiatore JE and Canon F (1987). The mob and oriT mobilization functions of a bacterial plasmid promote its transfer to plants. Nature. 328:170-175 Chiura H, Velimirov B and Kogure K (2000). Virus-like particles in microbial population control and horizontal gene transfer in aquatic environments. Presented at the Proceedings of the Eighth International Symposium on Microbial Ecology. Atlantic Canada Society for Microbial Ecology, Halifax, Canada. Chiura HX (1997). Generalized gene transfer by virus-like particles from marine bacteria. Aquatic Microbial Ecology. 13: 75-83 Dagan T, Artzy-Randrup Y and Martin W (2008). Modular networks and cumulative impact of lateral transfer in prokaryote genome evolution. Proceedings of the National Academy of Sciences. 105: 10039-10044 Davies J (1996). Origins and evolution of antibiotic resistance. Microbiologia 12: 9-16 Doolittle WF (1999a). Lateral genomics. Trends in cell biology. 9: M5-M8 Doolittle WF (1999b). Phylogenetic classification and the universal tree. Science. 284: 21242129 Doolittle WF and Logsdon JM (1998). Archaeal genomics: do archaea have a mixed heritage? Curr. Biol. 8: R209-211 Dubey GP and Ben-Yehuda S (2011). Intercellular Nanotubes Mediate Bacterial Communication. Cell. 144: 590-600 Dubnau D (1999). DNA uptake in bacteria. Annual Reviews in Microbiology 53: 217-244 Griffith F (1928). The significance of pneumococcal types. Journal of Hygiene. 27: 113-159 Groisman E, Saier Jr M and Ochman H (1992). Horizontal transfer of a phosphatase gene as evidence for mosaic structure of the Salmonella genome. The EMBO Journal. 11: 13091316 Hayashi T, Makino K, Ohnishi M, Kurokawa K, Ishii K, Yokoyama K, Han CG, Ohtsubo E, Nakayama K, Murata T, Tanaka M, Tobe T, Iida T, Takami H, Honda T, Sasakawa C, Ogasawara N, Yasunaga T, Kuhara S, Shiba T, Hattori M and Shinagawa H (2001). Complete genome sequence of enterohemorrhagic Escherichia coli O157:H7 and genomic comparison with a laboratory strain K-12. DNA Res. 8: 11-22 Hendrix RW, Smith MC, Burns RN, Ford ME and Hatfull GF (1999). Evolutionary relationships among diverse bacteriophages and prophages: all the world's a phage. Proc. Natl. Acad. Sci. USA. 96: 2192-2197 Hennes KP, Suttle CA and Chan AM (1995). Fluorescently labeled virus probes show that natural virus populations can control the structure of marine microbial communities. Applied and environmental microbiology. 61: 3623-3627 Ilippis VRD and Villarreal LP (2000). An introduction to the evolutionary ecology of viruses. Viral ecology. pp. 125 Jain R, Rivera MC and Lake JA (1999). Horizontal gene transfer among genomes: the complexity hypothesis. Proceedings of the National Academy of Sciences. 96: 3801-3806 Jensen EC, Schrader HS, Rieland B, Thompson TL, Lee KW, Nickerson KW and Kokjohn TA (1998). Prevalence of broad-host-range lytic bacteriophages of Sphaerotilus natans, Escherichia coli and Pseudomonas aeruginosa. Appl. Environ. Microbiol. 64: 575-580

198

Microbes: In Action

Jiang SC and Paul JH (1998). Gene transfer by transduction in the marine environment. Applied and Environmental Microbiology. 64: 2780-2787 Karlin S, Campbell AM and Mrazek J (1998). Comparative DNA analysis across diverse genomes. Annual review of genetics. 32: 185-225 Koonin EV, Mushegian AR, Galperin MY and Walker DR (1997). Comparison of archaeal and bacterial genomes: computer analysis of protein sequences predicts novel functions and suggests a chimeric origin for the archaea. Mol. Microbiol. 25: 619-637 Kunin V and Ouzounis CA (2003). The balance of driving forces during genome evolution in prokaryotes. Genome Research. 13: 1589-1594 Lawrence JG, Hatfull GF and Hendrix RW (2002). Imbroglios of viral taxonomy: genetic exchange and failings of phenetic approaches. J. Bacteriol. 184: 4891-4905 Lawrence JG and Ochman H (1997). Amelioration of bacterial genomes: Rates of Change and Exchange. J Mol Evol. 44: 383-397 Lawrence JG and Ochman H (1998). Molecular archaeology of the Escherichia coli genome. Proceedings of the National Academy of Sciences. 95: 9413-9417 Lerat E, Daubin V, Ochman H and Moran NA (2005). Evolutionary origins of genomic repertoires in bacteria. PLoS Biol. 3: e130 Long RA and Azam F (2001). Microscale patchiness of bacterioplankton assemblage richness in seawater. Aquatic Microbial Ecology. 26: 103-113 Lorenz MG and Wackernagel W (1994). Bacterial gene transfer by natural genetic transformation in the environment. Microbiol Rev. 58: 563-602 Middelboe M, Hagstrom A, Blackburn N, Sinn B, Fischer U, Borch N, Pinhassi J, Simu K and Lorenz M (2001). Effects of bacteriophages on the population dynamics of four strains of pelagic marine bacteria. Microbial Ecology. 42: 395-406 Middelboe M (2000). Bacterial growth rate and marine virus–host dynamics. Microbial Ecology. 40: 114-124 Nelson KE, Clayton RA, Gill SR, Gwinn ML, Dodson RJ, Haft DH, Hickey EK, Peterson JD, Nelson WC, Ketchum KA, McDonald L, Utterback TR, Malek JA, Linher KD, Garrett MM, Stewart AM, Cotton MD, Pratt MS, Phillips CA, Richardson D, Heidelberg J, Sutton GG, Fleischmann RD, Eisen JA, White O, Salzberg SL, Smith HO, Venter JC and Fraser CM (1999). Evidence for lateral gene transfer between Archaea and bacteria from genome sequence of Thermotoga maritima. Nature. 399: 323-329 Ochman H, Lawrence JG and Groisman EA (2000). Lateral gene transfer and the nature of bacterial innovation. Nature. 405: 299-304 Ohnishi M, Kurokawa K and Hayashi T (2001). Diversification of Escherichia coli genomes: are bacteriophages the major contributors? Trends Microbiol. 9: 481-485 Ovreas L, Bourne D, Sandaa RA, Casamayor EO, Benlloch S, Goddard V, Smerdon G, Heldal M and Thingstad TF (2003). Response of bacterial and viral communities to nutrient manipulations in seawater mesocosms. Aquatic microbial ecology. 31: 109-121 Paul JH (1999). Microbial gene transfer: an ecological perspective. J. Mol. Microbiol. Biotechnol. 1: 45-50 Peduzzi P and Weinbauer MG (1993). The submicron size fraction of seawater containing high numbers of virus particles as bioactive agent in unicellular plankton community successions. Journal of plankton research. 15: 1375-1386 Ponting CP, Aravind L, Schultz J, Bork P and Koonin EV (1999). Eukaryotic signalling domain hom*ologues in archaea and bacteria. Ancient ancestry and horizontal gene transfer. J. Mol. Biol. 289: 729-745 Proctor L (1991). Roles of viral infection in organic particle flux. Mar. Ecol. Prog. Ser. 69: 133142 Pushker R, Mira A and Rodriguez-Valera F (2004). Comparative genomics of gene-family size in closely related bacteria. Genome Biol. 5: R27 Saye DJ, Ogunseitan O, Sayler G and Miller RV (1987). Potential for transduction of plasmids in a natural freshwater environment: effect of plasmid donor concentration and a natural microbial community on transduction in Pseudomonas aeruginosa. Applied and environmental microbiology. 53: 987-995

Horizontal Gene Transfer

199

Schicklmaier P and Schmieger H (1995). Frequency of generalized transducing phages in natural isolates of the Salmonella typhimurium complex. Applied and environmental microbiology. 61: 1637-1640 Suttle CA and Chan AM (1994). Dynamics and distribution of cyanophages and their effect on marine Synechococcus spp. Applied and environmental microbiology. 60: 3167-3174 Suttle CA, Chan AM and Cottrell MT (1990). Infection of phytoplankton by viruses and reduction of primary productivity. Nature. 347: 467-469 Suttle CA (1992). Inhibition of photosynthesis in phytoplankton by the submicron size fraction concentrated from seawater. Marine Ecology Progress Series. 87: 105-105 Suttle CA (2005). Viruses in the sea. Nature. 437: 356-361 Swofford D, Olsen G and Waddell P (1996). Phylogenetic inference. In: Molecular Systematics(Eds DM Hillis, C Moritz and BK Mable.) pp. 407-514 Tatusov RL, Mushegian AR, Bork P, Brown NP, Hayes WS, Borodovsky M, Rudd KE and Koonin EV (1996). Metabolism and evolution of Haemophilus influenzae deduced from a whole-genome comparison with Escherichia coli. Curr. Biol. 6: 279-291 Tettelin H, Riley D, Cattuto C and Medini D (2008). Comparative genomics: the bacterial pan-genome. Current opinion in microbiology. 11: 472-477 Thingstad TF and Lignell R (1997). Theoretical models for the control of bacterial growth rate, abundance, diversity and carbon demand. Aquatic microbial ecology. 13: 19-27 Torsvik V, Ovreas L and Thingstad TF (2002). Prokaryotic diversity-magnitude, dynamics, and controlling factors. Science. 296: 1064-1066 Van Hannen EJ, Zwart G, van Agterveld MP, Gons HJ, Ebert J and Laanbroek HJ (1999). Changes in bacterial and eukaryotic community structure after mass lysis of filamentous cyanobacteria associated with viruses. Appl. Environ. Microbiol. 65: 795-801 Ward DM, Ferris MJ, Nold SC and Bateson MM (1998). A natural view of microbial biodiversity within hot spring cyanobacterial mat communities. Microbiol. Mol. Biol. Rev. 62: 1353-1370 Waterbury JB and Valois FW (1993). Resistance to co-occurring phages enables marine Synechococcus communities to coexist with cyanophages abundant in seawater. Applied and Environmental Microbiology. 59: 3393-3399 Weinbauer N and Hofle N (1998). Distribution and life strategies of two bacterial populations in a eutrophic lake. Appl. Environ. Microbiol. 64: 3776-3783 Wichels A, Biel SS, Gelderblom HR, Brinkhoff T, Muyzer G and Schutt C (1998). Bacteriophage diversity in the North Sea. Appl. Environ. Microbiol. 64: 4128-4133 Wommack KE, Ravel J, Hill RT and Colwell RR (1999a). Hybridization analysis of Chesapeake Bay virioplankton. Applied and environmental microbiology. 65: 241-250 Wommack KE, Ravel J, Holl RT, Chun J and Colwell RR (1999b). Population dynamics of Chesapeake Bay virioplankton: total-community analysis by pulse-field gel electrophoresis. Appl Environ Microbiol. 65: 231-240

CHAPTER 13 Endophytes Diversity: Scope and Applications Sheelendra M Bhatt and Shilpa Department of Biotechnology, School of Biotechnology and Bioscience, Lovely Professional University, Phagwara, Punjab – 144411 India Corresponding author: [emailprotected]

INTRODUCTION Endophytes mark their presence in internal part of most of the higher plants, grasses as well as various medicinal plants harbouring diverse array of habitat viz root, stem or leaves with range of useful and novel secondary metabolites. A novel identification feature of endophytes is their asymptomatic presence inside invading plant tissues (Tejesvi et al., 2005) making them an outstanding research tool for various industrial applications such as biofuel production, functional metabolites and pharmaceutical products which is still a distance from reality. Endophytes is known since 17th century and still have many untapped information, and hidden applications. Can anyone had imagined, how beautifully these endophytes interacts with plants without harming the plant, though they invade like pathogens. Rather these endophytes builds a strong wall against pathogens, always supports plant in highly stressed conditions. One of the most interesting part, "plant-microbes interaction" is still a mystery? To understand the way they express, they interact, modulates metabolic pathway, they reduces the pathogen infestation, and mechanism of releasing plethora of active compounds releasing in their vicinity (Brader, Compant, Mitter, Trognitz, and Sessitsch, 2014), and biomolecules. Modulation of expression makes endophytes a very interesting research subject. Recently, many more applications has been explored such as their potential to make VHC a secondary metabolites called as "volatile hydrocarbons" which can be used in production of mycodiesel and is also helpful in combating various pathogens. Algae commonly used for biodiesel production through transesterifications had various issues related to water availability and proper photoperiod. However, in case of infection VHC gets converted into many intermediate metabolites, a very effective tool against many resistance pathogenic infection such as bacterial and fungal infections. But unfortunately production of these natural products had not been scaled up at industries. In current chapter, there will be focus on diversity, classification diversity and some natural products of industrial relevance and applications in biofuel production and bioremediations.

202

Microbes: In Action

ENDOPHYTES: DÉFINITIONS AND NATURE De Bary was first to introduce the term endophyte in 1886 for those microorganisms (fungi, yeast, and bacteria) that are colonizing internal plant tissues (Bary, 1884) since then, many definition have been formulated. As per Bacon and White endophytic microbes colonizes living and internal tissues of plants without causing any immediate and negative effects (Bacon, C.W., White, 2000) while Hirsch and Braun (Hirsch, Braun, and Winterhoff, 1992) described endophyte as those endobionts which colonizes tissues without any visible consequences of infection (latent pathogens). The latest definition of endophytes proposed by Posada and Vega (Posada and Vega, 2005) describes all those organisms inhabiting different internal parts of plants, including seeds. Epiphytes differs from endophyte in terms of their presence at rhizoplane and phylloplane surfaces (Andrews and Harris, 2000) whereas endophyte harbours interior of tissues where they inhabit without causing any disease or symptoms to the host (J. M. de Araújo, Silva, and Azevedo, 2000); (KuklinskySobral et al., 2004) while some bacterial populations ﬂuctuates between endophytic and epiphytic (Mei and Flinn, 2010). One of the most studied plantassociated bacteria, Rhizobacteria known to have important role in plant growth (Mastretta and Taghavi, 2009). Similarly many endophytic bacteria known to have diverse range of positive effects over plants viz. enhanced plant growth, increased plant resistance against pathogens, against drought and even against toxic heavy metals (J. M. de Araújo et al., 2000; Reiter, Bürgmann, Burg, and Sessitsch, 2003; Surette, Sturz, Lada, and Nowak, 2003). ENDOPHYTE: CLASSIFICATION AND DIVERSITY Endophytes inhabits almost all parts of plant parts inside legume nodules, plant roots, stems, leaves, fruits, tubers, and also seeds (Hallmann, Quadt-Hallmann, Mahaffee, and Kloepper, 1997; Hardoim, Hardoim, van Overbeek, and van Elsas, 2012) and also reported from so many unusual environments as shown in Table 1. In roots generally there are higher numbers of endophytes compared to other plant part or tissues (Rosenblueth and Martínez-Romero, 2004) while xylem vessels is second most favoured place for (Engelhard, Hurek, and Reinhold-Hurek, 2000; Sprent and James, 1995) for instance a Burkholderia sp. strain xylem part of Vitis vinifera plants (Brader et al., 2014) whileBacillus sp., Enterobacter sp., and Sporosarcina aquimarina, mostly occurs in roots of some coastal mangrove pioneer plants (Avicennia marina) (sona Janarthine, Eganathan, Balasubramanian, and Vijayalakshmi, 2011). The endophytes has been reported in various plants such as beets, corn, bananas, tomatoes, as citrus, sugar cane, soybean and rice roots (Altalhi, 2009; Brown, Hyde, and Guest, 1998; Cao, Qiu, You, Tan, and Zhou, 2005). Specifically microbes from genera Bacillus, Enterobacter and Pantoea has wide occurrence (Medrano and Bell, 2007); (Magnani et al., 2010). Bacillus has its role as growth promoters nitrogen fixers and phosphate solubilizers (Forchetti, Masciarelli, Alemano, Alvarez, and Abdala, 2007). Bacteria residing in roots, invade the roots passively, due to wounds (Kobayashi and Palumbo, 2000), or via entry at single site causing systemic colonisation (Hallmann et al., 1997). These are mostly non-pathogenic endophytic bacteria and little of pathogenic bacteria (Hallmann, Quadt-

Endophytes Diversity

203

Hallmann, et al., 1997; Kobayashi and Palumbo, 2000). Ting et al., had (Ting, Mah, Tee, and others, 2009) compared occurrence of endophytes in number of endophytes per plants for instance, in the medicinal plants there was three endophytic organisms per plant, while the weeds were characterized by a lower rate of prevalence (2.4 endophytes per plant). Thus, endophytes had better role in various disease control because of same niche of pathogens (Hallmann, Quadt-Hallmann, et al., 1997). Endophytes has been divided into pathogenic and non-pathogenic endophytes according to their invasion style. The non-pathogenic fungi are bestcharacterized microbial endophytes including both fungi and bacteria. Darnel, Germany, was the first to discover pathogenic endophytes in 1904 (Tan and Zou, 2001), since then various endophytes were reported as pathogenic endophytic algae (Bouarab, Potin, Correa, and Kloareg, 1999), parasitic endophytic plants (Marler, Zabinski, and Callaway, 1999). An additional classification are mutualistic endophytic bacteria (Adhikari, Joseph, Yang, Phillips, and Nelson, 2001; Y. Bai, D'Aoust, Smith, and Driscoll, 2002; Chanway, 1996) commensal, symbioses and mycorrhizal endophytes as shown below (Sturz and Nowak, 2000).

FIG 1: Classification of endophytes TABLE 1: Bacterial Endophyte and native plants Endophytes

Plant species

References

Azorhizobium coulinodons Azospirillum brasilense Azospirillum amazonense Bradyrhizobium japonicum Gluconoacetobactor diazotrphicus Methylobacterium mesophilicum Methylobacterium extarquens

Rice Banana Banana, pineapple Rice Sugarcane coffee

(Engelhard et al., 2000) (Weber et al., 1999) (Weber et al., 1999) (Chaintreuil et al., 2000) (Cavalcante and Dobereiner, 1988)(JimenezSalgado et al., 1997) (Welington L. Araújo et al., 2002)

Rhizobium leguminosarum Rhizobium agrobacterium radiobactor Sinorhizobium maliloti Sphingomonas paucimobilis

Rice Carrot, rice

(Welington L. Araújo et al., 2002) (Pirttilä, Joensuu, Pospiech, Jalonen, and Hohtola, 2004) (Yanni et al., 1997) (Surette et al., 2003)

Sweet potato Rice

(Reiter et al., 2003) (Engelhard, Hurek, and Reinhold-Hurek, 2000)

-Proteobacteria

Citrus plant Scot pine citrus plant

204

Endophytes

Microbes: In Action

Plant species

References

Kallar grass, rice Maize Yellow lupin citrus plants Banana pine apple rice Rice

(Engelhard, Hurek, and Reinhold-Hurek, 2000); (McInroy and Kloepper, 1995) (W L Araújo et al., 2001); (Barac et al., 2004) (Weber et al., 1999) (Phillips, Martinez-Romero, Yang, and Joseph, 2000) (Olivares, Baldani, Reis, Baldani, and Döbereiner, 1996) (Olivares et al., 1996)

-proteobacteria Azoarcus sp. Burkholderia pickettii Burkholderia cepacia Burkholderia sp Chromobacterium violaceum Herbaspirillum seropedicae Herbaspirillum rubrisulbalbicans

Sugarcane, rice, maize Sugarcane

ɤ proteobacteria Citrobacter sp.

Banana

Enterobacter spp. Enterobacter sakazakii

Maize Soybean

Enterobacter cloacae

Citrus plants, maize

Enterobacter aglomerans Enterobacter asburiae Erwinia sp. E. coli Klebsiella sp.

soybean Sweet potato soybean Lettuce Wheat, sweet potato, rice

Klebsiella pneumonia Klebsiella variicola Klebsiella terrigena Klebsiella oxytoca Pantoea sp.

Soybean Banana, rice, maize, sugarcane Carrot Soybean Rice, soybean

Pantoea agglomerans

Citrus plants, sweet potato

Pseudomonas chlororaphis Pseudomonas putida Pseudomonas fluorescens Pseudomonas citronellolis Pseudomonas synxantha Salmonella enterica

Marigold, carrot

Serratia sp.

Carrot Carrot Soybean Scots pine Alfalfa, carrot, radish, tomato Rice

(Martínez, Caballero-Mellado, Orozco, and Martínez-Romero, 2003) (McInroy and Kloepper, 1995) (Kuklinsky-Sobral, Araújo, Mendes, PizziraniKleiner, and Azevedo, 2005) (Welington L. Araújo et al., 2002); (Hinton and Bacon, 1995) (Kuklinsky-Sobral et al., 2004) (Asis and Adachi, 2004) (Kuklinsky-Sobral et al., 2004) (Ingham et al., 2005) (Engelhard, Hurek, and Reinhold-Hurek, 2000); Iniguez et al.2004 Kuklinsky-Sobral et al.2004 (Iniguez, Dong, and Triplett, 2004) (Surette et al., 2003) (Kuklinsky-Sobral et al., 2004) (Kuklinsky-Sobral et al., 2004); (S. C. Verma, Singh, Chowdhury, and Tripathi, 2004) (Welington L. Araújo et al., 2002)(W L Araújo et al., 2001); (Asis and Adachi, 2004) (Sturz and Kimpinski, 2004); (Surette et al., 2003) (Surette et al., 2003) (Surette et al., 2003) (Kuklinsky-Sobral et al., 2004) (Pirttilä et al., 2004) (Cooley, Miller, and Mandrell, 2003); (X. Guo, Van Iersel, Chen, Brackett, and Beuchat, 2002); (Islam et al., 2004) (Sandhiya, Sugitha, Balachandar, and Kumar, 2005)

Endophytes Diversity

205

Endophytes

Plant species

References

Serratia marcescens Stenotrophom*onas

Rice Dune grasses (Ammophila arenaria and Elymus mollis)

(Gyaneshwar et al., 2001) (Dalton et al., 2004)

Firmicutes Bacillus spp.

Citrus plants

Bacillus megaterium Clostridium Paenibacillus odorifer Staphylococcus saprophyticus b

(Welington L. Araújo et al., 2002) (W L Araújo et al., 2001) Maize, carrot, citrus plants (W L Araújo et al., 2001); (McInroy and Kloepper, 1995); (Surette et al., 2003) Grass Miscanthus sinensis (Miyamoto, Kawahara, and Minamisawa, 2004) Sweet potato (Reiter et al., 2003) Carrot (Surette et al., 2003)

Bacteoidetes Sphingobacterium sp.a Actinobacteria

Rice

(Phillips et al., 2000)

Arthrobacter globiformis Curtobacterium flaccumfaciens Kocuria varians Microbacterium esteraromaticum Microbacterium testaceum Microbacterium sp. b

Maize Citrus plants

(Chelius, Triplett, and others, 2000) (Welington L. Araújo et al., 2002)

Marigold Marigold

(Sturz and Kimpinski, 2004) (Sturz and Kimpinski, 2004)

Maize

(Zinniel et al., 2002)

Wheat, Scots pine

(Conn and Franco, 2004); (Pirttilä, Pospiech, Laukkanen, Myllylä, and Hohtola, 2005) (Welington L. Araújo et al., 2002) (Coombs and Franco, 2003a)

Nocardia sp.b Streptomyces a

Citrus plants Wheat

Opportunistic human pathogenic bacteria; b Common human pathogenic bacteria

TABLE 2: Diversity of Bacterial Root Endophytes (Johannes Hallmann, 2006) Plant

Bacterial Taxa

Reference

Alfalfa

Pseudomonas, Erwinia-like bacteria

Carrot Clover

Pseudomonas, Agrobacterium, Staphylococcus Pseudomonas, Agrobacterium, Bacillus, Methylobacterium, Rhizobium Pseudomonas, Bacillus, Burkholderia, Clavibcater, Erwinia, Phyllobacterium

(Gagné, Richard, Rousseau, and Antoun, 1987) (Surette et al., 2003) (Sturz, Christie, Matheson, and Nowak, 1997) (Chen, Bauske, Musson, RodriguezKabana, and Kloepper, 1995); (Hallmann, Rodr\iguez-Kábana, and Kloepper, 1999); (Misaghi, 1990) (Hallmann, Kloepper, and RodríguezKábana, 1997) (McInroy and Kloepper, 1995)

Cotton

Cucumber

Pseudomonas, Agrobacterium, Bacillus, Burkholderia, Chryseobacterium, Clavibacter, Curtobacterium, enterobacter, Micrococcus, Paenibacillus, Phyllobacterium, Serratia, Stenotrophom*onas

206

Microbes: In Action

Plant

Bacterial Taxa

Reference

Grapevine

Pseudomonas, Staphylococcus, Enterobacter, Rahnella, Rhodococcus Pseudomonas, Agrobacterium, Bacillus, Arthrobacter, Burkholderia, corynebacterium, Curtobacterium, Enterobacter, Micrococcus, Phyllobacterium, Serratia Pseudomonas, Agrobacterium, Bacillus, Agrobacterium, Arthrobacter, Chryseobacterium, Enterobacter, Micrococcus, Pantoea, Stenotrophom*onas, Streptomyces Acidovorax, Agrobacterium, Aureobacterium, Bacillus, Cytophaga, Chryseobacterium, Flavobacterium, Micrococcus, Rathayibacter, Pseudomonas Agrobacterium, Bacillus, Methylobacterium, Pantoea, Pseudomonas, Rhizobium, Xanthom*onas Serratia, Azoarcus

(Bell, Dickie, Harvey, and Chan, 1995)

Maize

Potato

Canola

Red clover Rice

(Lalande, Bissonnette, Coutlée, and Antoun, 1989); (McInroy and Kloepper, 1995) (Krechel, Faupel, Hallmann, Ulrich, and Berg, 2002); (Sturz, 1995)

(Siciliano, Goldie, and Germida, 1998); (Granér, Persson, Meijer, and Alström, 2003); (Misko and Germida, 2002) (Sturz et al., 1997)

(Gyaneshwar et al., 2001); (Hurek, Reinhold-Hurek, Van Montagu, and Kellenberger, 1994) Rough Bacillus, Corynebacterium, Enterobacter, (Gardner, Feldman, and Zablotowicz, lemon Pseudomonas, Serratia 1982) Soybean Bacillus (Y. Bai et al., 2002) Sugar Beet Bacillus, Corynebacterium, Erwinia, Lactobacillus, (Jacobs, Bugbee, and Gabrielson, Pseudomonas, Xanthom*onas 1985) Sugar cane Acetobacter (Cavalcante and Dobereiner, 1988) Tomato Bacillus, Burkholderia, Chryseobacterium, Kluyvera, (Munif, 2001) Micrococcus, Pseudomonas, Serratia Wheat Bacillus, Flavobacterium, Microbipora, (Coombs and Franco, 2003); (Siciliano Micrococcus, Micromonospora, Nacardiodes, et al., 1998) Rathayibacter, Streptomyces Diverse Streptomyces (Sardi et al., 1992) species

Endophytes in Industrial Application In Réduction of Carbon Cycle

FIG 2: Endophytic methanotrophs (Kip et al., 2012)

Endophytes Diversity

207

One of the most exciting role discovered was utilization of methane by use of endophytic methanotrophic bacteria that oxidizes methane to carbon dioxide up to 50% (Kip et al., 2012) and up to 77 %, depending on the season and the host plant by (Raghoebarsing et al., 2005) use of Methylocella palustris and Methylocapsa acidiphila, from moss tissues belong to the genus Sphagnum (Goraj, Kuźniar, Urban, Pietrzykowska, and St\kepniewska, 2013). Natural Products from Endophytic Bacteria Various endophytic microorganisms from medicinal plant reported to produce secondary metabolites such as antifungal and antibacterial components, plant hormones, vitamins B12 and B1, and bio protectants (Ivanova, Fedorov, Doronina, and Trotsenko, 2006; Mercado-Blanco and Bakker, 2007; Simons, Permentier, Weger, Wijffelman, and Ben, 1997; Yuri A. Trotsenko and Khmelenina, 2002). An endophytic ﬂuorescent bacterium had been isolated was Pseudomonas viridiﬂava from leaves of many grasses that known to produce a group of novel antifungal lipopeptides named ecomycins (van Loon, Bakker, and Pieterse, 1998). Beside this various important natural product have been isolated such as Taxol (in cancer therapy)(Kumaran, Kim, and Hur, 2010), Ecomycins B and C (highly potent antimicrobial)(Miller et al., 1998). See table 3 TABLE 3: Microbe Plant association and Active agent Organism

Plant association

Active agent

Activity

Reference

Taxomyces andreanae Pseudomonas viridiflava Streptomyces griseus Streptomyces NRRL 30562

Taxus brevifolia

Taxol

Anticancer

Grass

Ecomycins B and C

Antimicrobial

(Strobel and Daisy, 2003) (Miller et al., 1998)

Kandelia candel

Antimicrobial

Guan et al., 2005

Grevillea pteridifolia Rhyncholacis penicillata

Antibiotic Antimalarial Antibiotic

(U. F. Castillo et al., 2002)

Streptomyces NRRL 30566 Serratia marcescns

p-Aminoacetophenonic acids Munumbicins Munumbicin D Kakadumycins Oocydin A

Antifungal

Paenibacillus polymyxa

Wheat Lodge pine Green beans Arabidopsis thaliana Canola Quercus sp. 103 Monstera sp.

Fusaricidin A-D

Antifungal

Cytonic acids A and D Coronamycin

Antiviral Antimalarial antifungal

Cytonaema sp. Streptomyces sp.

Kennedia nigriscans

(U. Castillo et al., 2003) (Strobel, Daisy, Castillo, and Harper, 2004) (Beck, Hansen, and Lauritsen, 2003) (J. Li, Beatty, Shah, and Jensen, 2007) (Beatty and Jensen, 2002) (B. Guo et al., 2000) (Ezra et al., 2004)

208

Microbes: In Action

Endophytes in Pest Control After failure of Bt cotton, in near-future GMO endophytes may find large application with biological control potential in agricultural crops which is still in infancy. Recently, the endophytes Herbaspirillum seropedicae and Clavibacter xylii have been genetically modified to produce and excrete the δ-endotoxin of Bacillus thuringiensis to control insect pests (Downing, Leslie, and Thomson, 2000); (Turner et al., 1991). Oleaginous Endophytes: A Promising Tools In recent past production of biodiesel from algal and other seeds rich in lipid has various concerns viz large bioreactor system, long incubation time, availability of constant photoperiod (Meng et al., 2009; Yusuf, 2007). Therefore, a better alternative source may be oleaginous microbes which is known to harbour single cell oil (SCO) and has capacity to produce more than >20% biomass as lipid (Holdsworth and Ratledge, 1991; Meng et al., 2009). Though they don't have capacity to fill the oil requirements for people in form of PUFA as plants can do, but certainly they have capacity to meet the requirements of biodiesel in the reactors (Gill, Hall, and Ratledge, 1977) for instance a yeast candida 107 when grown in continuous reactor system there was maximum lipid up to 0.59 g of lipid/g/h of yeast per h at dilution rate 0.21/h in double limited nutrients (phosphate and nitrogen both) while in nitrogen limited medium at dilution rate 0.06/h there was 22 g of lipid per g glucose consumed. Since quality of biodiesel depends on suitable fatty acid profile therefore, diverse range of microbes have been examined for there oleaginous capacity where lipid profile have been prepared to obtained clue for fitness into biodiesel quality requirements. Out of diverse array of natural occurring microbes mostly yeast and fungi known to accumulate lipid up to 70-86% (Meng et al., 2009). Fungi in this regard fits into requirement of scaling up viz, there is no limitation of substrate, can be scaled up easily and can be optimized for high biodiesel production. The list of these microbes are not long and among those few of them are Zygomycetes, (Mortierella isabellina) and Cunninghamella echinulata with reported lipid 60–87% and 40–57% of dry biomass, respectively (Stylianos Fakas et al., 2009). Starting from first commercialized oleaginous fungi Mucor circnelloides with 20% lipid of dry biomass, now more number of fungus have been elucidated out where high lipid had been reported. Recently various bacteria have been isolated where high lipid had been recovered viz. Rhodococcus opacus strain PD630 was isolated from a soil sample collected near a gas-works plant in Germany, (Brigham, Kurosawa, Rha, and Sinskey, 2011), and Pseudomonas spp. (RRL-28), with total lipids of 33.4 and 42.7% respectively, with a C/N ratio of 50 (Palnayak and Sree, 2005). A novel yeast Candida curvata D has been reported to be oleaginous yeast, when compared with different substrate for miximizing lipid production, the fatty acids profile were 16:0, 18:0, 18:1, 18:2 at xylose as substrate with highest fraction of stearic acid 15% and in presence of ethanol oleic acid (18:2) was up to 51% (Evans and Ratledge, 1983). Recently a fungus isolated from marshy oil region named Aspergillus awamori MTCC11639 (Venkata Subhash and Venkata Mohan, 2014) were reported to produce 31% lipid in optimised factor conditions by Taguchi methodology

Endophytes Diversity

209

(Bhatt and Srivastava, 2012). The report of simultaneous secretions of cellulase enzyme along with high lipid has also been reported from endophytes (Peng and Chen, 2007) while laccase and xylanase enzyme which is part of system (Osono and Takeda, 1999; Suto et al., 2002). Some endophytic fungi (from genus Gliocladium) were reported to secrete cellulose degrader via synthesis of some complex hydrocarbons called as VHC (volatile hydrocarbon) under microaerophilic conditions (Ahamed and Ahring, 2011). Some endophytic fungi are better in secretions of various hydrocarbons such as benzene, 1-octene and m-xylene (in co-culture Gliocladium with G. roseum 62726), when G. roseum 62726 co-cultured with E. coli produced of benzene higher amounts of dodecane and hexadecane were produced which can be utilized production of myco-diesel hydrocarbons. Marc Stadler (2009) reported a fungal endophyte Gliocladium roseum NRRL 50072 isolated from the Patagonian angiosperm Eucryphia cordifolia (Chilean trivial name 'ulmo') a wellknown mycoparasite of the order Hypocreales (class Sordariomycetes) which secretes VHCs in the apoplastic region which is equivalent to mycodiesel. However, some scientist believes that production of saturated 'mycodiesel' can takes place from VHCs after oxidation under aerobic conditions. However (Boyle, Goetz, Dammann-Tugend, and Schulz, 2001) assumes that all plantassociated fungi, including endophytes, are able to degrade cellulose specially 'brown rot' fungi. In near future it is possible to make biodiesel using cellulose by transfer of the genes into heterologous hosts. Variations in the content of methyl esters has been shown in Table-4 the endophytic fungus, Xylaria (NICL5), had palmitic acid (15.50%), stearic acid (5.20%), oleic acid (26.50%), linoleic acid (48.58%), and linolenic acid (7.78%) at high levels, similar to soybean oil (11.29%, 3.54%, 22.45%, 54.62%, and 8.11% for the respective methyl esters) thus can be used for biodiesel production. The endophytic fungus identified as Penicillium (PAOE) also showed methyl ester concentrations at high levels (33.25%, 5.20%, 13.80%, 43.51%, and 2.94%, respectively). similar to soy biodiesel.(Santos-Fo, Fill, Nakamura, Monteiro, and Rodrigues-Fo, 2011)

210

Microbes: In Action

Endophytes Diversity

211

TABLE 5: Lipid content in diverse microbes (Santos-Fo et al., 2011) Microorganisms Microalgae Chlorella vulgaris

Fungi

Yeast Bacteria

Lipid content (%)

Reference

40-60

(Illman, Scragg, and Shales, 2000) (Illman et al., 2000) (Meng et al., 2009) (Illman et al., 2000) (Meng et al., 2009) (Meng et al., 2009)(Yusuf, 2007) (S. Fakas, Papanikolaou, Galiotou-Panayotou, Komaitis, and Aggelis, 2008) (Stylianos Fakas et al., 2009) (S. Fakas et al., 2008), (Meng et al., 2009), (Papanikolaou, Komaitis, and Aggelis, 2004) (Vicente et al., 2010)

Chlorella emersonii Nannochoris sp. Schizochytrium sp. A. oryzae

63 38-68 50-77 57

Cunninghamella echinulata

40-47

Mortierella isabellina Mucor circinelloides

68-86 20 64 72 93 96

Lypomices starkegi Rhodotula glutinis Gordonia sp. Rhodococus opacus

(Meng et al., 2009) (Meng et al., 2009) (Gouda, Omar, and Aouad, 2008)

TABLE 6: Concentration of biodiesel from endophytic fungi Source: (Santos-Fo, 2011) Endophytic fungi

Concentration of Biodiesel (%)

Xylaria (NICL3) Penicillium PAOE Penicillium brasilianum Penicillium griseoroseum Xylaria (NICL5) Trichoderma T19 Trichoderma T25 Trichoderma T27 Trichoderma harvezionum Soy biodiesel

66.7 83.1 50.8 40.5 91.0 67.8 11.6 40.1 40.4 90.7

TABLE 7: Lipid production by various oleaginous lamentous fungi on different carbon sources including cheap agro-industrial residues.(Dey, Banerjee, and Maiti, 2011) Strain

Carbon source

Biomass

Lipid yield Culture media

Reference

M. isabellina

Glucose Xylose Raw glycerol Starch

27.0 (g/L) 9.5 (g/L) 6.2 (g/L) 10.4(g/L)

14.0 (g/L) 6.1 (g/L) 3.3 (g/L) 3.7 (g/L)

Liquid

Pectin Tapioca

8.4(g/L) 28.0(g/L)

2.0 (g/L) 5.0 (g/L)

Liquid Liquid

(Stylianos Fakas et al., 2009) (Stylianos Fakas et al., 2009) (Stylianos Fakas et al., 2009) (Papanikolaou, GaliotouPanayotou, Fakas, Komaitis, and Aggelis, 2007) (Papanikolaou et al., 2007) (Ahmed, Singh, Pandey,

Mucor sp. RRL001

Liquid

212

Strain

C. echinulata

Colletotrichum sp. (DM06)

Alternaria sp. (DM09)

A. oryzae A-4 Microsphaeropsis sp Colletotrichum sp. (DM06) Alternaria sp. (DM09)

Microbes: In Action

Carbon source starch Glucose Xylose Raw glycerol Starch Pectin Glucose

Biomass

Lipid yield Culture media

15.0 (g/L) 12.6 (g/L) 7.8 (g/L) 13.5(g/L) 4.1(g/L) 18.4 (g/L)

6.9 (g/L) 6.7 (g/L) 2.0 (g/L) 3.8 (g/L) 0.4 (g/L) 7.8 (g/L)

Liquid Liquid Liquid

Kanjilal, and Prasad, 2006) (Stylianos Fakas et al., 2009) (Stylianos Fakas et al., 2009) (Stylianos Fakas et al., 2009) (Papanikolaou et al., 2007) (Papanikolaou et al., 2007) (Papanikolaou et al., 2007)

Sucrose Xylose Glucose

16.7 (g/L) 7.4 (g/L) 15.2 (g/L)

7.5(g/L) 2.2 (g/L) 8.6 (g/L)

Liquid Liquid Liquid

(Dey et al., 2011) (Dey et al., 2011). (Dey et al., 2011)

Sucrose Xylose Wheat straw and bran Wheat straw and bran Rice straw and wheat bran Rice straw and wheat bran

11.5 (g/L) 10.4 (g/L) N.A.

Liquid Liquid Solid

(Dey et al., 2011) (Dey et al., 2011). (Hui et al., 2010)

10.9 (mg/gds) 10.8 (mg/gds)

4.6 (g/L) 4.3 (g/L) 36.6 (mg/gds) 42 (mg/gds) 68.2 (mg/gds)

Solid

(Peng and Chen, 2007)

Solid

(Dey et al., 2011)

8.97 (mg/gds)

60.32 (mg/gds)

Liquid Liquid

Reference

(Dey et al., 2011)

Metal Hyper-Accumulator Endophytes Bioremediation, is the use of microbes to detoxify and degrade various contaminants,((Farhadian, Vachelard, duch*ez, and Larroche, 2008). Heavy metal bioremediation using in situ treatment, may be a safe alternative by use of an efficient microbes (H. J. Bai, Zhang, Yang, and Li, 2008). In this regard plantassociated bacteria may play a key role since they are part of varied environment (Sturz and Nowak, 2000). Numerous experimental demonstration show that endophytic microorganisms had enhanced bioremediation capability depends on interaction between close interaction with their host plants (Khan and Doty, 2011; H. Y. Li, Wei, Shen, and Zhou, 2012). Bacterial endophytes has added advantages and is more effective in term of simultaneous precipitation of multiple metals compared to bacteria after adding to the soil via a process known as bioaugmentation (Newman and Reynolds, 2005). Bacterial endophytes isolated from grapevine (Vitis vinifera L.) shows such multiple resistant to various metals such as lead, mercury, nickel, zinc, and manganese (Altalhi, 2009) and thus complete bioremediation is possible. (H. Guo et al., 2010) reported that the Bacillus sp. can reduce toxic cadmium up to 94 % in the presence of metabolic inhibitors (specific ATPase inhibitor N,N′dicyclohexylcarbodiimide, or 2,4-dinitrophenol (DNP). Similarly, a multi-metal resistant endophytic bacteria identified as bacillus have been reported from

Endophytes Diversity

213

Solanum nigrum L. was capable of biosorption up to (10mg/L) in presence of divalent heavy metals (Cu (II), Cd (II) and Pb (II)) at the rate of 75.78%, 80.48%, 21.25% of Cd (II), Pb (II) and Cu (II) in 24 hours after inhibition of ATPase activity. However, nearly no chromium uptake was observed. Engineered endophytic Burkholderia cepacia strains has improved phytoremediation capacity with increased tolerance towards toluene (Barac et al., 2004). TABLE 8: Bacterial endophyte in Bio-remediation Compound

Plant association

Mono-and Wild rye (Elymus Dichlorinated benzoic dauricus) acids 2,4-D Poplar (Populus) and Willow (Salix) Methane Poplar tissues

TNT, RDX, HMX

Poplar tissues

MTBE, BTEX, TCE

Populus cv.

Toluene TCP and PCB

Poplar (Populus) Wheat

Volatile organic compounds and toluene

Yellow lupine (Lupinus luteus L.)

Organism

Reference

Pseudomonas aeruginosa strain R75 (Siciliano et al., 1998) and Pseudomonas savastanoi strain CB35 P. putida VM1450 (K. J. Germaine et al., 2006) Methylobacterium populi BJ001 (Van Aken, Peres, Doty, Yoon, and Schnoor, 2004) Methylobacterium populi BJ001 (Van Aken et al., 2004) Pseudomonas sp. (K. Germaine et al., 2004) (Moore et al., 2006) B. cepacia Bu61(pTOM-Bu61) (Taghavi et al., 2005) Herbaspirillum sp. K1 (Männistö, Tiirola, and Puhakka, 2001) Burkholderia cepacia G4 (Barac et al., 2004)

TNT, 2,4,6-trinitrotoluene; 2,4-D, 2,4-dichlorophenoxyacetic acid; TNT, 2,4,6-trinitrotoluene; RDX, hexahydro-1,3,5-trinitro-1,3,5-triazene; HMX, octahydro-1,3,5,7-tetranitro-1,3,5-tetrazocine; NDAB, aliphatic nitramine 4nitro-2,4-diazabutanal; BTEX, benzene, toluene, ethylbenzene, and xylene; TCP, 2,3,4,6-tetrachlorophenol; PCB, polychlorinated biphenyl. Secondary Metabolites Various phytohormones (Holland and Polacco, 1994)(Koenig, Morris, and Polacco, 2002; Y A Trotsenko, Ivanova, and Doronina, 2001) and salicylic acid, have been isolated from endophytic bacteria. An endophytic ﬂuorescent bacterium Pseudomonas viridiﬂava reported on leaves of grasses species produces a novel antifungal lipopeptides named ecomycins, which contain some unusual amino acids such as hom*oserine and β-hydroxyaspartic acid. (van Loon et al., 1998) Methylobacterium extorquens and Pseudomanas synxantha produces adenine derivatives which may have a role as precursors in cytokinin biosynthesis which were isolated from Scots pine (Pinus sylvestris L.). Various defence molecules which fight against predators, parasites and diseases called as antibiotic and antimycotic components are formed using an intermediate components called as microbial volatile organic compounds

214

Microbes: In Action

(MVOCs) from endophytes (e.g. (Karlshoej, Nielsen, and Larsen, 2007; Lemfack, Nickel, Dunkel, Preissner, and Piechulla, 2014). Recently (Stoppacher, Kluger, Zeilinger, Krska, and Schuhmacher, 2010) identified a MVOC and isolated from Trichoderma atroviride by HS-SPME-GC-MS. BIO-MACROMOLECULES PRODUCTION Fungal endophytes are seldom reported to produce polysaccharides, enzymes or proteins, in contrast to other endophytes. Lipase from Endophyte Lipases are involve in hydrolysis, inter-esterification, alcoholysis, acidolysis, esterification and aminolysis (Joseph, Ramteke, and Thomas, 2008)) while the enzymes are more effective catalysts for various inter-esterification and transesterification reactions in the presence of organic solvents. Therefore, many potential industrial applications, depends on their temperature stability (Jaeger, Dijkstra, and Reetz, 1999). Endophytic fungi produces various hydrolytic enzymes pectinases, xylanase, cellulases and lipases, whilst proteases and phenol oxidase (Maria, Sridhar, and Raviraja, 2005; Tan and Zou, 2001; Torres, Dolcet, Sala, and Canela, 2003), necessary for penetrating and colonizing their plant hosts (Boyle et al., 2001)). Lipases, were produced by Acremonium sp., Alternaria sp., Aspergillus sp., Fusarium sp. and Pestalotiopsis sp., while amylase and protease were produced by a few of them From the Mediterranean plant Foeniculum vulgare a endophyte Rhizopus oryzae, with active lipases active over the pH range 3–8, and was thermostable, with maximal activity at 60°C. Fusarium oxysporum isolate PTM7, isolated from the leaves of Croton oblongifolius Roxb (Tuangp*rn Panuthai, 2012) GLUCOAMYLASE FROM ENDOPHYTE From the Philippine endemic tree (Torres et al., 2003) a novel glucoamylase with a strong amylopectin hydrolysing activity was reported from Acremonium sp., and stability up to pH 3.0–7.0 and also up to 600C. (Marlida, Saari, Hassan, and Radu, 2000). CELLULASE FROM ENDOPHYTE Most commercial cellulases are produced by the filamentous fungus Trichoderma reesei and Aspergillus niger. However, due to low β-glucosidase (BGL) activity relative to the total cellulase activity (filter paper activity), conversion of cellulose to glucose is not feasible (Bernstein, Foody, and Tolan, 1999; Duff and Murray, 1996) therefore, extra β- glucosidase activity has to be supplied from other sources, e.g., Aspergillus. This issue has been averted by isolating endophytic fungal strain secreting high concentration of BGL along with adequate amount of cellulase activity has been reported from Himalayan regions plant. There are some species which has been recognised has hypersecretion of cellulase and BGL such as Sordariahumana from Himalayan region of Kashmir valley out of 22 strains with BGL activity 2.5 IU/ml, FPase (0.82 IU/ml) activity when cellulose was used as substrate and 11 IU/ml CMCase activity. (Qadri et

Endophytes Diversity

215

al., 2013). Some species of Penicillium sp. has been reported for high cellulase production. NANOPARTICLES FROM ENDOPHYTE Endophytic fungus can produce larger amounts of nanoparticles as compared to bacteria because of larger amounts of proteins secreted important for nanoparticles (Mohanpuria, Rana, and Yadav, 2008). TABLE 9: Endophytes as source of antimicrobial components Silver nanoparticles

Plants for endophytes

Useful Against

References

Aspergillus clavatus Penicillium

Azadirachta indica Centella asiatica

(V. C. Verma, Kharwar, and Gange, 2010) (Nameirakpam, Dheeban, and Sutha, 2012).

Pestalotia sp.

leaves of Syzygium cumini

Candida albicans, Pseudomonas fluorescens and E. coli Klebsiella pnemoniae, Staphylococcus aureus, Proteus mirabilis, Shigella dysentriae and Candida albicans Staphylococcus aureus and Salmonalla typhi

Amylomyces rouxii

roots of date palm (Phoenix dactylifera)

against Shigella dysentriae type 1, S. aureus, Citrobacter sp, E. coli, P. aeruginosa, B. subtilis, C. albicans and Fusarium oxysporum

(Mohammed Fayaz, Girilal, Rahman, Venkatesan, and Kalaichelvan, 2011). (Musarrat et al., 2010).

ENDOPHYTE PLANT HOST INTERACTION MECHANISM Endophytic bacteria may be helpful in understanding their mode of expression in natural niches or habitats (inside plants), in this regard a perfect model selection is must. However, some endophytic bacteria, such as Azoarcus sp. (Battistoni et al., 2005), Herbaspirillum sp., Gluconacetobacter diazotrophicus, and Klebsiella spp., have been studied in great detail as per their occurrence in almost every habitat (Rediers, Rainey, Vanderleyden, and De Mot, 2005) including the rhizosphere (Ramos-González, Campos, and Ramos, 2005). It is well known that most of the bacteria has quorum sensing in which a soluble signal molecules controls overall gene expression as per bacterial population density (quorum) (Swift, Throup, Williams, Salmond, and Stewart, 1996). Phytopathogenic bacteria produces large number of antibiotics as well as plant cell wall–degrading exo-enzymes in response to quorum (Von Bodman, Bauer, and Coplin, 2003). Interestingly, plants responds to these soluble signal (Bauer and Mathesius, 2004; Mathesius et al., 2003). Arabidopsis thaliana can be a useful model plant to study its interactions with endophytes like Azorhizobium caulinodans and enterobacteria. Iniguez and associates (Iniguez et al., 2005) used Medicago truncatula and Arabidopsis thaliana mutants to establish plant defense-response pathways where, ethylene, induces systemic resistance in plants. PLANT BACTERIA INTERACTION FOR SECONDARY METABOLITE SECRETION Various (Barry and Challis, 2009) secondary metabolite had been reported to be

216

Microbes: In Action

secreted only after interaction of plant with bacteria for starting nutritional uptake. Mostly siderophores are responsible for these metabolite secretions e.g. Sorbactin ABC is produced by entophyte Herbaspirillum seropedicae colonising in grasses. Most of the phytohormones released by these endophytes also play crucial role in signalling as a result plant is more capable of combating the stress and fighting the pathogens as a systemic defence response (Durbak, Yao, and McSteen, 2012; Robert-Seilaniantz, Grant, and Jones, 2011) e.g. Abscisic and gibberellic acid produced by endophytes Azospirillum lipoferum showed to enhance drought resistance effectively in maize (Bottini, Cohen, Travaglia, and Piccoli, 2009). Various research reports regarding secondary metabolite production shows that there are several gene clusters present which are responsible for these protein secretions e.g. Burkholdriade kirkii. Psychotria interacts with these Burkholdriade species in leaf nodules, as a result several important defence molecule is released which is helpful in combating insects, pests, fungus and other microbes (via release of insecticidal, antifungal, antibiotics) (Mahmud, 2003). There are various other mechanism of defence in the plant in which endophytes releases several toxins e.g. Rhizoxin from Rhizopus microsporous is released after interaction with Burkholdriade endofungumand helps rice in combating the seedling blight disease. Thus microbial endophytes have immense scope, specially those of endophytic fungus which produces large number of secondary metabolite as compared to bacterial endophyte which has been less explored for secondary metabolic production (Aly, Debbab, and Proksch, 2011; Mousa and Raizada, 2013). Various researchers believe that difference in secondary metabolite production pattern by bacteria is decided by their colonisation behaviour as compared to fungi (Compant, Clément, and Sessitsch, 2010; Rosenblueth and Martínez-Romero, 2006). Only a few bacteria have been studied in great detail such as Pseudomonas and Bacillus and some species of Actinobacteria (Qin, Xing, Jiang, Xu, and Li, 2011; Raaijmakers, de Bruijn, and de Kock, 2006) e.g. Actinobacteria mostly secretes large number of secondary metabolites such as multi cyclic indolo-sesquiterpenes (by Streptomyces sp. HKI0595) which is reported over mangrove tree (Kandelia candel) (Kaewkla and Franco, 2013). Another Actinomycetes streptosporangium oxa azolinicum K07-0450 found in orchids (Inahashi, Matsumoto, Omura, and Takahashi, 2011), secretes antitrypanosomal alkaloids spoxazomicins AC. CONCLUSIONS Nevertheless, to say, endophytes have immense potential, open avenues, and solutions to many issues, from metabolites to drug, from biomass to fuel, from enzymes to degradations, from synthesis to conversion. János Bérdy,(Bérdy, 2012) truly endorse these symbiotic microbial population as most promising for improving higher plants and robust marine metabolites owing to their incredible adaptability.

Endophytes Diversity

217

REFERENCES Adhikari TB, Joseph CM, Yang G, Phillips DA and Nelson LM (2001). Evaluation of bacteria isolated from rice for plant growth promotion and biological control of seedling disease of rice. Canadian Journal of Microbiology. 47: 916-924 Ahamed A and Ahring BK (2011). Production of hydrocarbon compounds by endophytic fungi Gliocladium species grown on cellulose. Bioresource Technology. 102: 9718-9722 Ahmed SU, Singh SK, Pandey A, Kanjilal S and Prasad RBN (2006). Effects of various process parameters on the production of gamma-linolenic acid in submerged fermentation. Food Technology and Biotechnology. 44: 283-287 Altalhi AD (2009). Plasmids profiles, antibiotic and heavy metal resistance incidence of endophytic bacteria isolated from grapevine (Vitis vinifera L.). African Journal of Biotechnology. 8: 5873-5882. Aly AH, Debbab A and Proksch P (2011). Fungal endophytes: Unique plant inhabitants with great promises. Applied Microbiology and Biotechnology. doi:10.1007/s00253-011-3270-y Andrews JH and Harris RF (2000). the Ecology and Biogeography of Microorganisms on Plant Surfaces. Annual Review of Phytopathology. 38: 145-180. Araujo, JM de Silva AC da and Azevedo JL (2000). Isolation of endophytic actinomycetes from roots and leaves of maize (Zea mays L.). Brazilian Archives of Biology and Technology. doi:10.1590/S1516-89132000000400016 Araujo WL, Maccheroni W, Aguilar-Vildoso CI, Barroso PA, Saridakis HO and Azevedo JL (2001). Variability and interactions between endophytic bacteria and fungi isolated from leaf tissues of citrus rootstocks. Canadian Journal of Microbiology. 47: 229-236 Araujo WL, Marcon J, Maccheroni W, Van Elsas JD, Van Vuurde JWL and Azevedo JL (2002). Diversity of endophytic bacterial populations and their interaction with Xylella fastidiosa in citrus plants. Applied and Environmental Microbiology. 68: 4906-4914 Asis CA and Adachi K (2004). Isolation of endophytic diazotroph Pantoea agglomerans and nondiazotroph Enterobacter asburiae from sweetpotato stem in Japan. Letters in Applied Microbiology. 38: 19-23 Bacon CW and White JF (2000). Microbial Endophytes. Marcel Dekker Inc., New York. 4-5. Bai HJ, Zhang ZM, Yang GE and Li BZ (2008). Bioremediation of cadmium by growing Rhodobacter sphaeroides: Kinetic characteristic and mechanism studies. Bioresource Technology. 99:7716-7722 doi:10.1016/j.biortech.2008.01.071 Bai Y, D'Aoust F, Smith DL and Driscoll BT (2002). Isolation of plant-growth-promoting Bacillus strains from soybean root nodules. Canadian Journal of Microbiology. 48: 230-238 Barac T, Taghavi S, Borremans B, Provoost A, Oeyen L, Colpaert JV and van der Lelie D (2004). Engineered endophytic bacteria improve phytoremediation of water-soluble, volatile, organic pollutants. Nature Biotechnology. 22: 583-588 Barry SM and Challis GL (2009). Recent advances in siderophore biosynthesis. Current Opinion in Chemical Biology. doi:10.1016/j.cbpa.2009.03.008 Bary A (1884). Vergleichende Morphologie und Biologie der Pilze, Mycetozoen und Bacterien. Wilhelm Engelmann. Battistoni F, Bartels D, Kaiser O, Reamon-Buettner SM, Hurek T and Reinhold-Hurek B (2005). Physical map of the Azoarcus sp. strain BH72 genome based on a bacterial artificial chromosome library as a platform for genome sequencing and functional analysis. FEMS Microbiology Letters. 249: 233-240 Bauer WD and Mathesius U (2004). Plant responses to bacterial quorum sensing signals. Current Opinion in Plant Biology. doi:10.1016/j.pbi.2004.05.008 Beatty PH and Jensen SE (2002). Paenibacillus polymyxa produces fusaricidin-type antifungal antibiotics active against Leptosphaeria maculans, the causative agent of blackleg disease of canola. Canadian Journal of Microbiology. 48: 159-169 Beck HC, Hansen AM and Lauritsen FR (2003). Novel pyrazine metabolites found in polymyxin biosynthesis by Paenibacillus polymyxa. FEMS Microbiology Letters. 220: 67-73 Bell CR, Dickie GA, Harvey WLG and Chan JWYF (1995). Endophytic bacteria in grapevine. Canadian Journal of Microbiology. doi:10.1139/m95-006

218

Microbes: In Action

Berdy J (2012). Thoughts and facts about antibiotics: Where we are now and where we are heading. The Journal of Antibiotics. doi:10.1038/ja.2012.54 Bernstein JD Foody B and Tolan JS (1999). Pretreatment process for conversion of cellulose to fuel ethanol. Google Patents. Bhatt SM and Srivastava SK (2012). High yield of Lactic acid production by Mutant Strain of L. delbrueckii U12-1 and Parameter Optimization by Taguchi methodology. Annals of Biological Research. 325(6): 2579-2592 Bottini R, Cohen AC, Travaglia CN and Piccoli PN (2009). Participation of abscisic acid and gibberellins produced by endophytic Azospirillum in the alleviation of drought effects in maize. Botany-Botanique. 87: 455-462 Bouarab K, Potin P, Correa J and Kloareg B (1999). Sulfated Oligosaccharides Mediate the Interaction between a Marine Red Alga and Its Green Algal Pathogenic Endophyte. The Plant Cell. 11: 1635-1650 Boyle C, Goetz M, Dammann-Tugend U and Schulz B (2001). Endophyte-host interactions III. Local vs. systemic colonization. Symbiosis. 31: 259-281 Brader G, Compant S, Mitter B, Trognitz F and Sessitsch A (2014). Metabolic potential of endophytic bacteria. Current Opinion in Biotechnology. doi:10.1016/j.copbio.2013.09.012 Brigham CJ, Kurosawa K, Rha C and Sinskey AJ (2011). Bacterial Carbon Storage to Value Added Products. Microbial and Biochemical Technology. doi:10.4172/1948-5948.S3-002 Brown K, Hyde K and Guest D (1998). Preliminary studies on endophytic fungal communities of Musa acuminata species complex in Hong Kong and Australia. Fungal Diversity. 1: 27-51 Cao L, Qiu Z, You J, Tan H and Zhou S (2005). Isolation and characterization of endophytic streptomycete antagonists of Fusarium wilt pathogen from surface-sterilized banana roots. FEMS Microbiology Letters. 247: 147-152 Castillo UF, Strobel GA, Ford EJ, Hess WM, Porter H, Jensen JB and Yaver D (2002). Munumbicins, wide-spectrum antibiotics produced by Streptomyces NRRL 30562, endophytic on Kennedia nigriscans. Microbiology. 148: 2675-2685 Castillo U, Harper JK, Strobel GA, Sears J, Alesi K, Ford E and Teplow D (2003). Kakadumycins, novel antibiotics from Streptomyces sp. NRRL 30566, an endophyte of Grevillea pteridifolia. FEMS Microbiology Letters. 224: 183-190 Cavalcante VA and Dobereiner J (1988). A new acid-tolerant nitrogen-fixing bacterium associated with sugarcane. Plant and Soil. 108: 23-31 Chaintreuil C, Giraud E, Prin Y, Lorquin J, Ba A, Gillis M and Dreyfus B (2000). Photosynthetic bradyrhizobia are natural endophytes of the African wild rice Oryza breviligulata. Applied and Environmental Microbiology. 66(12): 5437-5447 Chanway CP (1996). Endophytes: they're not just fungi! Canadian Journal of Botany. 74(3): 321-322 Chelius MK and Triplett EW (2000). Diazotrophic endophytes associated with maize. Prokaryotic Nitrogen Fixation: A Model System for the Analysis of a Biological Process. 779-791 Chen C, Bauske EM, Musson G, Rodriguez-Kabana R and Kloepper JW (1995). Biological Control of Fusarium Wilt on Cotton by Use of Endophytic Bacteria. Biological Control. 5: 83-91 Compant S, Clement C and Sessitsch A (2010). Plant growth-promoting bacteria in the rhizoand endosphere of plants: Their role, colonization, mechanisms involved and prospects for utilization. Soil Biology and Biochemistry. doi:10.1016/j.soilbio.2009.11.024 Conn VM and Franco CMM (2004). Analysis of the Endophytic Actinobacterial Population in the Roots of Wheat (Triticum aestivum L.) by Terminal Restriction Fragment Length Polymorphism and Sequencing of 16S rRNA Clones. Applied and Environmental Microbiology. 70:1787-1794 Cooley MB, Miller WG and Mandrell RE (2003). Colonization of Arabidopsis thaliana with Salmonella enterica and enterohemorrhagic Escherichia coli O157:H7 and competition by Enterobacter asburiae. Applied and Environmental Microbiology. 69: 4915-26 Coombs JT and Franco CMM (2003). Isolation and identification of actinobacteria from surface-sterilized wheat roots. Applied and Environmental Microbiology. 69: 5603-5608

Endophytes Diversity

219

Dalton DA, Kramer S, Azios N, Fusaro S, Cahill E and Kennedy C (2004). Endophytic nitrogen fixation in dune grasses (Ammophila arenaria and Elymus mollis) from Oregon. FEMS Microbiology Ecology. 49:469-479 Dey P, Banerjee J and Maiti MK (2011). Comparative lipid profiling of two endophytic fungal isolates Colletotrichum sp. and Alternaria sp. having potential utilities as biodiesel feedstock. Bioresource Technology. 102: 5815-5823 Downing KJ, Leslie G and Thomson JA (2000). Biocontrol of the sugarcane borer Eldana saccharina by expression of the Bacillus thuringiensis cry1Ac7 and Serratia marcescens chiA genes in sugarcane-associated bacteria. Applied and Environmental Microbiology. 66: 2804-2810 Duff SJB and Murray WD (1996). Bioconversion of forest products industry waste cellulosics to fuel ethanol: a review. Bioresource Technology. 55(1): 1-33 Durbak A, Yao H and McSteen P (2012). Hormone signaling in plant development. Current Opinion in Plant Biology. doi:10.1016/j.pbi.2011.12.004 Engelhard M, Hurek T and Reinhold-Hurek B (2000). Preferential occurrence of diazotrophic endophytes, Azoarcus spp., in wild rice species and land races of Oryza sativa in comparison with modern races. Environmental Microbiology. 2: 131-141 Evans CT and Ratledge C (1983). Biochemical activities during lipid accumulation in Candida curvata. Lipids. 18: 630-635 Ezra D, Castillo UF, Strobel GA, Hess WM, Porter H, Jensen JB and Yaver D (2004). Coronamycins, peptide antibiotics produced by a verticillate Streptomyces sp. (MSU-2110) endophytic on Monstera sp. Microbiology. 150: 785-793 Fakas S, Papanikolaou S, Batsos A, Galiotou-Panayotou M, Mallouchos A and Aggelis G (2009). Evaluating renewable carbon sources as substrates for single cell oil production by Cunninghamella echinulata and Mortierella isabellina. Biomass and Bioenergy. 33: 573-580 Fakas S, Papanikolaou S, Galiotou-Panayotou M, Komaitis M and Aggelis G (2008). Organic nitrogen of tomato waste hydrolysate enhances glucose uptake and lipid accumulation in Cunninghamella echinulata. Journal of Applied Microbiology. 105: 1062-1070 Farhadian M, Vachelard C, duch*ez D and Larroche C (2008). In situ bioremediation of monoaromatic pollutants in groundwater: a review. Bioresource Technology. 99(13):5296308 Forchetti G, Masciarelli O, Alemano S, Alvarez D and Abdala G (2007). Endophytic bacteria in sunflower (Helianthus annuus L.): Isolation, characterization, and production of jasmonates and abscisic acid in culture medium. Applied Microbiology and Biotechnology. 76: 1145-1152 Gagne S, Richard C, Rousseau H and Antoun H (1987). Xylem-residing bacteria in alfalfa roots. Canadian Journal of Microbiology. 33(11): 996-1000 Gardner JM, Feldman AW and Zablotowicz RM (1982). Identity and behavior of xylemresiding bacteria in rough lemon roots of Florida citrus trees. Applied and Environmental Microbiology.43:1335-1342 Germaine KJ, Liu X, Cabellos GG, Hogan JP, Ryan D and Dowling DN (2006). Bacterial endophyte-enhanced phytoremediation of the organochlorine herbicide 2,4dichlorophenoxyacetic acid. FEMS Microbiology Ecology. 57: 302-310 Germaine K, Keogh E, Garcia-Cabellos G, Borremans B, Van Der Lelie D, Barac T and Dowling DN (2004). Colonisation of poplar trees by gfp expressing bacterial endophytes. FEMS Microbiology Ecology. 48: 109-118 Gill CO, Hall MJ and Ratledge C (1977). Lipid accumulation in an oleaginous yeast (Candida 107) growing on glucose in single stage continuous culture. Applied and Environmental Microbiology. 33: 231-239 Goraj W, Kuzniar A, Urban D, Pietrzykowska K and Stkepniewska Z (2013). Influence of plant composition on methane emission from Moszne peatland. J Ecol Eng. 14: 53-57 Gouda MK, Omar SH and Aouad LM (2008). Single cell oil production by Gordonia sp. DG using agro-industrial wastes. World Journal of Microbiology and Biotechnology. 24: 17031711

220

Microbes: In Action

Graner G, Persson P, Meijer J and Alstrom S (2003). A study on microbial diversity in different cultivars of Brassica napus in relation to its wilt pathogen, Verticillium longisporum. FEMS Microbiology Letters. 224: 269-276 Guo B, Dai JR, Ng S, Huang Y, Leong C, Ong W and Carte BK (2000). Cytonic acids A and B: Novel tridepside inhibitors of hCMV protease from the endophytic fungus Cytonaema species. Journal of Natural Products. 63: 602-604 Guo H, Luo S, Chen L, Xiao X, Xi Q, Wei W, and He Y (2010). Bioremediation of heavy metals by growing hyperaccumulaor endophytic bacterium Bacillus sp. L14. Bioresource Technology. 101:8599-8605 Guo X, Van Iersel MW, Chen J, Brackett RE and Beuchat LR (2002). Evidence of association of salmonellae with tomato plants grown hydroponically in inoculated nutrient solution. Applied and Environmental Microbiology. 68: 3639-3643 Gyaneshwar P, James EK, Mathan N, Reddy PM, Reinhold-Hurek B and Ladha JK (2001). Endophytic colonization of rice by a diazotrophic strain of Serratia marcescens. Journal of Bacteriology. 183:2634-2645 Hallmann J, Kloepper JW and Rodriguez-Kabana R (1997). Application of the Scholander pressure bomb to studies on endophytic bacteria of plants. Canadian Journal of Microbiology. doi:10.1139/m97-058 Hallmann J, Quadt-Hallmann A, Mahaffee WF and Kloepper JW (1997). Bacterial endophytes in agricultural crops. Canadian Journal of Microbiology. doi:10.1139/m97-131 Hallmann J, Rodriguez-Kabana R and Kloepper JW (1999). Chitin-mediated changes in bacterial communities of the soil, rhizosphere and within roots of cotton in relation to nematode control. Soil Biology and Biochemistry. 31(4): 551-560 Hardoim PR, Hardoim CCP, van Overbeek LS and van Elsas JD (2012). Dynamics of seedborne rice endophytes on early plant growth stages. PLoS ONE. 7. doi:10.1371/journal.pone.0030438 Hinton DM and Bacon CW (1995). Enterobacter cloacae is an endophytic symbiont of corn. Mycopathologia. 129: 117-125. doi:10.1007/BF01103471 Hirsch G, Braun U and Winterhoff W (1992). Communities of parasitic microfungi. Fungi in Vegetation Science 19. Holdsworth JE and Ratledge C (1991). Triacylglycerol synthesis in the oleaginous yeast Candida curvata D. Lipids. 26: 111-118 Holland MA and Polacco JC (1994). PPFMs and other covert contaminants: is there more to plant physiology than just plant? Annual Review of Plant Biology. 45(1): 197–209 Hui L, Wan C, Hai-Tao D, Xue-Jiao C, Qi-Fa Z and Yu-Hua Z (2010). Direct microbial conversion of wheat straw into lipid by a cellulolytic fungus of Aspergillus oryzae A-4 in solid-state fermentation. Bioresource Technology. 101: 7556-7562 Hurek T, Reinhold-Hurek B, Van Montagu M and Kellenberger E (1994). Root colonization and systemic spreading of Azoarcus sp. strain BH72 in grasses. Journal of Bacteriology. 176: 1913-1923 Illman AM, Scragg AH and Shales SW (2000). Increase in Chlorella strains calorific values when grown in low nitrogen medium. Enzyme and Microbial Technology. 27: 631-635 Inahashi Y, Matsumoto A, Omura S and Takahashi Y (2011). Streptosporangium oxazolinicum sp. nov., a novel endophytic actinomycete producing new antitrypanosomal antibiotics, spoxazomicins. The Journal of Antibiotics. 64: 297-302 Ingham SC, Fanslau MA, Engel RA, Breuer JR, Breuer JE, Wright TH and Zhu J (2005). Evaluation of fertilization-to-planting and fertilization-to-harvest intervals for safe use of noncomposted bovine manure in Wisconsin vegetable production. Journal of Food Protection. 68: 1134-1142 Iniguez AL, Dong Y, Carter HD, Ahmer BMM, Stone JM and Triplett EW (2005). Regulation of enteric endophytic bacterial colonization by plant defenses. Molecular Plant-Microbe Interactions. 18:169-178 Iniguez AL, Dong Y and Triplett EW (2004). Nitrogen fixation in wheat provided by Klebsiella pneumoniae 342. Molecular Plant-Microbe Interactions. 17: 1078-1085

Endophytes Diversity

221

Islam M, Morgan J, Doyle MP, Phatak SC, Millner P and Jiang X (2004). Fate of Salmonella enterica Serovar typhimurium on Carrots and Radishes Grown in Fields Treated with Contaminated Manure Composts or Irrigation Water. Applied and Environmental Microbiology. 70:2497-2502 Ivanova EG, Fedorov DN, Doronina NV and Trotsenko YA (2006). Production of vitamin B 12 in aerobic methylotrophic bacteria. Microbiology. 75(4): 494-496 Jacobs MJ, Bugbee WM and Gabrielson DA (1985). Enumeration, location, and characterization of endophytic bacteria within sugar beet roots. Canadian Journal of Botany. 63(7): 1262-1265 Jaeger KE, Dijkstra BW and Reetz MT (1999). Bacterial biocatalysts: molecular biology, threedimensional structures, and biotechnological applications of lipases. Annual Review of Microbiology. 53:315-351 Jimenez-Salgado T, Fuentes-Ramirez LE, Tapia-Hernandez A, Mascarua-Esparza MA, MartinezRomero E and Caballero-Mellado J (1997). Coffea arabica L., a new host plant for Acetobacter diazotrophicus, and isolation of other nitrogen-fixing acetobacteria. Applied and Environmental Microbiology. 63: 3676-3683 Johannes Hallmann GB (2006). Microbial Root Endophytes. (BJE Schulz, CJC Boyle, and TN Sieber, Eds.) Microbial Root Endophytes (1st ed., Vol. 9, pp. pp15–31). Berlin, Heidelberg: Springer Berlin Heidelberg. doi:10.1007/3-540-33526-9 Joseph B, Ramteke PW and Thomas G (2008). Cold active microbial lipases: Some hot issues and recent developments. Biotechnology Advances. doi:10.1016/j.biotechadv.2008.05.003 Kaewkla O and Franco CMM (2013). Rational Approaches to Improving the Isolation of Endophytic Actinobacteria from Australian Native Trees. Microbial Ecology. 65: 384-393 Karlshoej K, Nielsen V and Larsen TO (2007). Fungal volatiles: Biomarkers of good and bad food quality. Mycol. Ser. 25: 279-302 Khan Z and Doty S (2011). Endophyte-assisted phytoremediation. Plant Biology. 12: 97-105 Kip N, Fritz C, Langelaan ES, Pan Y, Bodrossy L, Pancotto V and Op Den Camp HJM (2012). Methanotrophic activity and diversity in different Sphagnum magellanicum dominated habitats in the southernmost peat bogs of Patagonia. Biogeoscience. 9: 47-55 Kobayashi DY and Palumbo JD (2000). Bacterial endophytes and their effects on plants and uses in agriculture. Microbial Endophytes. 199-233 Koenig RL, Morris RO and Polacco JC (2002). tRNA is the source of low-level trans-zeatin production in Methylobacterium spp. Journal of Bacteriology. 184: 1832-1842 Krechel A, Faupel A, Hallmann J, Ulrich A and Berg G (2002). Potato-associated bacteria and their antagonistic potential towards plant-pathogenic fungi and the plant-parasitic nematode Meloidogyne incognita (Kofoid and White) Chitwood. Canadian Journal of Microbiology. 48: 772-786 Kuklinsky-Sobral J, Araujo WL, Mendes R, Geraldi IO, Pizzirani-Kleiner AA and Azevedo JL (2004). Isolation and characterization of soybean-associated bacteria and their potential for plant growth promotion. Environmental Microbiology. 6: 1244-1251 Kuklinsky-Sobral J, Araujo WL, Mendes R, Pizzirani-Kleiner AA and Azevedo JL (2005). Isolation and characterization of endophytic bacteria from soybean (Glycine max) grown in soil treated with glyphosate herbicide. Plant and Soil. 273: 91-99 Kumaran RS, Kim HJ and Hur BK (2010). Taxol promising fungal endophyte, Pestalotiopsis species isolated from Taxus cuspidata. Journal of Bioscience and Bioengineering. 110: 541546 Lalande R, Bissonnette N, Coutlee D and Antoun H (1989). Identification of rhizobacteria from maize and determination of their plant-growth promoting potential. Plant and Soil. 115(1): 7-11 Lemfack MC, Nickel J, Dunkel M, Preissner R and Piechulla B (2014). MVOC: A database of microbial volatiles. Nucleic Acids Research. 42. doi:10.1093/nar/gkt1250 Li HY, Wei DQ, Shen M and Zhou ZP (2012). Endophytes and their role in phytoremediation. Fungal Diversity. doi:10.1007/s13225-012-0165-x

222

Microbes: In Action

Li J, Beatty PK, Shah S and Jensen SE (2007). Use of PCR-targeted mutagenesis to disrupt production of fusaricidin-type antifungal antibiotics in Paenibacillus polymyxa. Applied and Environmental Microbiology. 73: 3480-3489 Magnani GS, Didonet CM, Cruz LM, Picheth CF, Pedrosa FO and Souza EM (2010). Diversity of endophytic bacteria in Brazilian sugarcane. Genetics and Molecular Research. 9: 250-258 Mahmud T (2003). The C7N aminocycl*tol family of natural products. Natural Product Reports. 20: 137-166 Mannisto MK, Tiirola MA and Puhakka JA (2001). Degradation of 2,3,4,6-tetrachlorophenol at low temperature and low dioxygen concentrations by phylogenetically different groundwater and bioreactor bacteria. Biodegradation. 12: 291-301 Maria GL, Sridhar KR and Raviraja NS (2005). Antimicrobial and enzyme activity of mangrove endophytic fungi of southwest coast of India. Technology. 1: 67-80 Marler MJ, Zabinski CA and Callaway RM (1999). Mycorrhizae indirectly enhance competitive effects of an invasive forb on a native bunchgrass. Ecology. 80: 1180-1186 Marlida Y, Saari N, Hassan Z and Radu S (2000). Improvement in raw sago starch degrading enzyme production from Acremonium sp. endophytic fungus using carbon and nitrogen sources. Enzyme and Microbial Technology. 27: 511-515 Marques MV, Naciuk FF, Mello, AM de S, Seibel NM and Fontoura LAM (2010). Fatty ester content determination in soybean methyl biodiesel by gas chromatography using ethyl oleate as internal standard. Química Nova. 33(4): 978-980 Martinez L, Caballero-Mellado J, Orozco J and Martínez-Romero E (2003). Diazotrophic bacteria associated with banana (Musa spp.). Plant and Soil. 257: 35-47 Mastretta C and Taghavi S (2009). Endophytic bacteria from seeds of Nicotiana tabacum can reduce cadmium phytotoxicity. International Journal of Phytoremediation. 11: 251-267 Mathesius U, Mulders S, Gao M, Teplitski M, Caetano-Anolles G, Rolfe BG and Bauer WD (2003). Extensive and specific responses of a eukaryote to bacterial quorum-sensing signals. Proceedings of the National Academy of Sciences USA. 100: 1444-1449 McInroy JA and Kloepper JW (1995). Survey of indigenous bacterial endophytes from cotton and sweet corn. Plant and Soil. doi:10.1007/BF00011472 Medrano EG and Bell AA (2007). Role of Pantoea agglomerans in opportunistic bacterial seed and boll rot of cotton (Gossypium hirsutum) grown in the field. Journal of Applied Microbiology. 102: 134-143 Mei C and Flinn BS (2010). The use of beneficial microbial endophytes for plant biomass and stress tolerance improvement. Recent Patents on Biotechnology. 4: 81-95 Meng X, Yang J, Xu X, Zhang L, Nie Q and Xian M (2009). Biodiesel production from oleaginous microorganisms. Renewable Energy. doi:10.1016/j.renene.2008.04.014 Mercado-Blanco J and Bakker PAHM (2007). Interactions between plants and beneficial Pseudomonas spp.: Exploiting bacterial traits for crop protection. Antonie van Leeuwenhoek, International Journal of General and Molecular Microbiology. doi:10.1007/s10482-007-9167-1 Miller CM, Miller RV, Garton-Kenny D, Redgrave B, Sears J, Condron MM and Strobel GA (1998). Ecomycins, unique antimycotics from Pseudomonas viridiflava. Journal of Applied Microbiology. 84: 937-944 Misaghi IJ (1990). Endophytic Bacteria in Symptom-Free Cotton Plants. Phytopathology. doi:10.1094/Phyto-80-808 Misko AL and Germida JJ (2002). Taxonomic and functional diversity of pseudomonads isolated from the roots of field-grown canola. FEMS Microbiology Ecology. 42: 399-407 Miyamoto T, Kawahara M and Minamisawa K (2004). Novel endophytic nitrogen-fixing clostridia from the grass Miscanthus sinensis as revealed by terminal restriction fragment length polymorphism analysis. Applied and Environmental Microbiology. 70: 6580-6586 Mohammed Fayaz A, Girilal M, Rahman M, Venkatesan R and Kalaichelvan PT (2011). Biosynthesis of silver and gold nanoparticles using thermophilic bacterium Geobacillus stearothermophilus. Process Biochemistry. 46: 19581962. doi:10.1016/j.procbio.2011.07.003

Endophytes Diversity

223

Mohanpuria P, Rana NK and Yadav SK (2008). Biosynthesis of nanoparticles: Technological concepts and future applications. Journal of Nanoparticle Research. doi:10.1007/s11051007-9275-x Moore FP, Barac T, Borremans B, Oeyen L, Vangronsveld J, van der Lelie D and Moore ERB (2006). Endophytic bacterial diversity in poplar trees growing on a BTEX-contaminated site: The characterisation of isolates with potential to enhance phytoremediation. Systematic and Applied Microbiology. 29: 539-556 Mousa WK and Raizada MN (2013). The diversity of anti-microbial secondary metabolites produced by fungal endophytes: an interdisciplinary perspective. Frontiers in Microbiology. 4: 65. doi:10.3389/fmicb.2013.00065 Munif A (2001). Studies on the importance of endophytic bacteria for the biological control of the root-knot nematode Meloidogyne incognita on tomato.Dissertation, Rheinische FriedrichWilhelms-Universitat, Bonn, Germany. Musarrat J, Dwivedi S, Singh BR, Al-Khedhairy AA, Azam A and Naqvi A (2010). Production of antimicrobial silver nanoparticles in water extracts of the fungus Amylomyces rouxii strain KSU-09. Bioresource Technology. 101: 8772-8776 Nameirakpam ND, Dheeban SP and Sutha S (2012). Biomimetic synthesis of silver nanoparticles from an endophytic fungus and their antimicrobial efficacy. International Journal of Biomedical and Advance Research 3(5): 409-415 Newman LA and Reynolds CM (2005). Bacteria and phytoremediation: New uses for endophytic bacteria in plants. Trends in Biotechnology. doi:10.1016/j.tibtech.2004.11.010 Olivares FL, Baldani VLD, Reis VM, Baldani JI and Dobereiner J (1996). Occurrence of the endophytic diazotrophs Herbaspirillum spp. in roots, stems, and leaves, predominantly of Gramineae. Biology and Fertility of Soils. 21: 197-200 Osono T and Takeda H (1999). Decomposing ability of interior and surface fungal colonizers of beech leaves with reference to lignin decomposition. European Journal of Soil Biology. 35: 51-56 Palnayak S and Sree A (2005). Screening of bacterial associates of marine sponges for single cell oil and PUFA. Letters in Applied Microbiology. 40: 358-363 Papanikolaou S, Galiotou-Panayotou M, Fakas S, Komaitis M and Aggelis G (2007). Lipid production by oleaginous Mucorales cultivated on renewable carbon sources. European Journal of Lipid Science and Technology. 109(11): 1060-1070 Papanikolaou S, Komaitis M and Aggelis G (2004). Single cell oil (SCO) production by Mortierella isabellina grown on high-sugar content media. Bioresource Technology. 95: 287291 Peng XW and Chen HZ (2007). Microbial oil accumulation and cellulase secretion of the endophytic fungi from oleaginous plants. Annals of Microbiology. doi:10.1007/BF03175213 Phillips DA, Martinez-Romero E, Yang GP and Joseph CM (2000). Release of nitrogen: a key trait in selecting bacterial endophytes for agronomically useful nitrogen fixation. The Quest for Nitrogen Fixation in Rice. International Rice Research Institute, Manila, The Philippines, 205-217 Pirttila AM, Joensuu P, Pospiech H, Jalonen J and Hohtola A (2004). Bud endophytes of Scots pine produce adenine derivatives and other compounds that affect morphology and mitigate browning of callus cultures. Physiologia Plantarum. 121: 305-312 Pirttila AM, Pospiech H, Laukkanen H, Myllyla R and Hohtola A (2005). Seasonal variations in location and population structure of endophytes in buds of Scots pine. Tree Physiology. 25: 289-297 Posada F and Vega FE (2005). Establishment of the fungal entomopathogen Beauveria bassiana (Ascomycota: Hypocreales) as an endophyte in cocoa seedlings (Theobroma cacao). Mycologia. 97(6): 1195-1200 Qadri M, Johri S, Shah BA, Khajuria A, Sidiq T, Lattoo SK and Riyaz-Ul-Hassan S (2013). Identification and bioactive potential of endophytic fungi isolated from selected plants of the Western Himalayas. Springer Plus. 2:8. doi:10.1186/2193-1801-2-8

224

Microbes: In Action

Qin S, Xing K, Jiang JH, Xu LH and Li WJ (2011). Biodiversity, bioactive natural products and biotechnological potential of plant-associated endophytic actinobacteria. Applied Microbiology and Biotechnology. doi:10.1007/s00253-010-2923-6 Raaijmakers JM, de Bruijn I and de Kock MJD (2006). Cyclic lipopeptide production by plantassociated Pseudomonas spp.: diversity, activity, biosynthesis, and regulation. Molecular Plant-Microbe Interactions. 19: 699-710 Raghoebarsing AA, Smolders AJP, Schmid MC, Rijpstra WIC, Wolters-Arts M, Derksen J and Strous M (2005). Methanotrophic symbionts provide carbon for photosynthesis in peat bogs. Nature. 436: 1153-1156 Ramos-Gonzalez MI, Campos MJ and Ramos JL (2005). Analysis of Pseudomonas putida KT2440 gene expression in the maize rhizosphere: In vitro expression technology capture and identification of root-activated promoters. Journal of Bacteriology. 187: 4033-4041 Rediers H, Rainey PB, Vanderleyden J and De Mot R (2005). Unraveling the secret lives of bacteria: use of in vivo expression technology and differential fluorescence induction promoter traps as tools for exploring niche-specific gene expression. Microbiology and Molecular Biology Reviews. 69: 217-261 Reiter B, Burgmann H, Burg K and Sessitsch A (2003). Endophytic nif H gene diversity in African sweet potato. Canadian Journal of Microbiology. 49: 549-555 Robert-Seilaniantz A, Grant M and Jones JDG (2011). Hormone Crosstalk in Plant Disease and Defense: More Than Just JASMONATE-SALICYLATE Antagonism. Annual Review of Phytopathology. 49: 317-343. Rosenblueth M and Martinez-Romero E (2004). Rhizobium etli maize populations and their competitiveness for root colonization. Archives of Microbiology. 181: 337-344 Rosenblueth M and Martinez-Romero E (2006). Bacterial endophytes and their interactions with hosts. Molecular Plant-Microbe Interactions. 19: 827-837 Sandhiya GS, Sugitha TCK, Balachandar D and Kumar K (2005). Endophytic colonization and in planta nitrogen fixation by a diazotrophic Serratia sp. in rice. Indian Journal of Experimental Biology. 43(9): 802 Santos-Fo FC, Fill TP, Nakamura J, Monteiro MR and Rodrigues-Fo E (2011). Endophytic fungi as a source of biofuel precursors. Journal of Microbiology and Biotechnology. 21: 728733 Sardi P, Saracchi M, Quaroni S, Petrolini B, Borgonovi GE and Merli S (1992). Isolation of endophytic Streptomyces strains from surface-sterilized roots. Applied and Environmental Microbiology. Siciliano SD, Goldie H and Germida JJ (1998). Enzymatic activity in root exudates of Dahurian wild rye (Elymus dauricus) that degrades 2-chlorobenzoic acid. Journal of Agricultural and Food Chemistry. 46(1): 5-7 Simons M, Permentier HP, Weger, LA De, Wijffelman CA and Ben JJ (1997). Amino Acid Synthesis Is Necessary for Tomato Root Colonization by Pseudomonas fluorescens Strain. Molecular Plant-Microbe Interactions. 10: 102-106 Sona Janarthine SR, Eganathan P, Balasubramanian T and Vijayalakshmi S (2011). Endophytic bacteria isolated from the pneumatophores of Avicennia marina. African Journal of Microbiology Research. 5(26): 4455-4466 Sprent JI and James EK (1995). N2-fixation by endophytic bacteria: questions of entry and operation. In Azospirillum VI and Related Microorganisms (pp. 15-30). Springer. Stoppacher N, Kluger B, Zeilinger S, Krska R and Schuhmacher R (2010). Identification and profiling of volatile metabolites of the biocontrol fungus Trichoderma atroviride by HSSPME-GC-MS. Journal of Microbiological Methods. 81: 187-193 Strobel G and Daisy B (2003). Bioprospecting for microbial endophytes and their natural products. Microbiology and Molecular Biology Reviews. 67: 491-502 Strobel G, Daisy B, Castillo U and Harper J (2004). Natural Products from Endophytic Microorganisms. Journal of Natural Products. doi:10.1021/np030397v Sturz AV (1995). The role of endophytic bacteria during seed piece decay and potato tuberization. Plant and Soil. doi:10.1007/BF00011362

Endophytes Diversity

225

Sturz AV, Christie BR, Matheson BG and Nowak J (1997). Biodiversity of endophytic bacteria which colonize red clover nodules, roots, stems and foliage and their influence on host growth. Biology and Fertility of Soils. 25: 13-19 Sturz AV and Kimpinski J (2004). Endoroot bacteria derived from marigolds (Tagetes spp.) can decrease soil population densities of root-lesion nematodes in the potato root zone. Plant and Soil. 262: 241-249 Sturz AV and Nowak J (2000). Endophytic communities of rhizobacteria and the strategies required to create yield enhancing associations with crops. Applied Soil Ecology. 15: 183190 Surette MA, Sturz AV, Lada RR and Nowak J (2003). Bacterial endophytes in processing carrots (Daucus carota L. var. sativus): their localization, population density, biodiversity and their effects on plant growth. Plant and Soil. 253(2): 381-390 Suto M, Takebayashi M, Saito K, Tanaka M, Yokota A and Tomita F (2002). Endophytes as producers of xylanase. Journal of Bioscience and Bioengineering. 93: 88-90 Swift S, Throup JP, Williams P, Salmond GPC and Stewart GSAB (1996). Quorum sensing: A population-density component in the determination of bacterial phenotype. Trends in Biochemical Sciences. doi:10.1016/0968-0004(96)10027-X Taghavi S, Barac T, Greenberg B, Borremans B, Vangronsveld J and Van Der Lelie D (2005). Horizontal gene transfer to endogenous endophytic bacteria from poplar improves phytoremediation of toluene. Applied and Environmental Microbiology. 71: 8500-8505 Tan RX and Zou WX (2001). Endophytes: a rich source of functional metabolites. Natural Product Reports. 18(4): 448-459 Tejesvi MV, Mahesh B, Nalini MS, Prakash HS, Kini KR, Subbiah V and Shetty HS (2005). Endophytic fungal assemblages from inner bark and twig of Terminalia arjuna W and A. (Combretaceae). World Journal of Microbiology and Biotechnology. 21: 1535-1540 Ting ASY, Mah SW and Tee CS (2009). Prevalence of endophytes antagonistic towards Fusarium oxysporum f. sp. cubense race 4 in various plants. American-Eurasian Journal of Sustainable Agriculture. 3(3): 399-406 Torres M, Dolcet MM, Sala N and Canela R (2003). Endophytic fungi associated with Mediterranean plants as a source of mycelium-bound lipases. Journal of Agricultural and Food Chemistry. 51: 3328-3333 Trotsenko YA, Ivanova EG and Doronina NV (2001). Aerobic methylotrophic bacteria as phytosymbionts. Microbiology. 70: 623-632 Trotsenko YA and Khmelenina VN (2002). Biology of extremophilic and extremotolerant methanotrophs. Archives of Microbiology. doi:10.1007/s00203-001-0368-0 Tuangp*rn P (2012). An extracellular lipase from the endophytic fungi Fusarium oxysporum isolated from the Thai medicinal plant, Croton oblongifolius Roxb. African Journal of Microbiology Research. doi:10.5897/AJMR11.965 Turner JT, Lampel JS, Stearman RS, Sundin GW, Gunyuzlu P and Anderson JJ (1991). Stability of the δ-endotoxin gene from Bacillus thuringiensis subsp. kurstaki in a recombinant strain of Clavibacter xyli sub sp. cynodontis. Applied and Environmental Microbiology. 57: 3522-3528 Van Aken B, Peres CM, Doty SL, Yoon JM and Schnoor JL (2004). Methylobacterium populi sp. nov., a novel aerobic, pink-pigmented, facultatively methylotrophic, methane-utilizing bacterium isolated from poplar trees (Populus deltoides x nigra DN34). International Journal of Systematic and Evolutionary Microbiology. 54: 1191-1196 Van Loon LC, Bakker PA and Pieterse CM (1998). Systemic resistance induced by rhizosphere bacteria. Annual Review of Phytopathology. 36: 453-483 Venkata Subhash G and Venkata Mohan S (2014). Lipid accumulation for biodiesel production by oleaginous fungus Aspergillus awamori : Influence of critical factors. Fuel. 116: 509-515 Verma SC, Singh A, Chowdhury SP and Tripathi AK (2004). Endophytic colonization ability of two deep-water rice endophytes, Pantoea sp. and Ochrobactrum sp. using green fluorescent protein reporter. Biotechnology Letters. 26: 425-429

226

Microbes: In Action

Verma VC, Kharwar RN and Gange AC (2010). Biosynthesis of antimicrobial silver nanoparticles by the endophytic fungus Aspergillus clavatus. Nanomedicine. 5: 33-40 Vicente G, Bautista LF, Gutierrez FJ, Rodríguez R, Martínez V, Rodriguez-Frometa RA and Garre V (2010). Direct transformation of fungal biomass from submerged cultures into biodiesel. Energy and Fuels. 24: 3173-3178 Von Bodman SB, Bauer WD and Coplin DL (2003). Quorum sensing in plant-pathogenic bacteria. Annual Review of Phytopathology. 41: 455-482 Weber OB, Baldani VLD, Teixeira KRS, Kirchhof G, Baldani JI and Dobereiner J (1999). Isolation and characterization of diazotrophic bacteria from banana and pineapple plants. Plant and Soil. 210:103-113 Yanni YG, Rizk RY, Corich V, Squartini A, Ninke K, Philip-Hollingsworth S and Dazzo FB (1997). Natural endophytic association between Rhizobium leguminosarum bv. trifolii and rice roots and assessment of its potential to promote rice growth. Plant Soil. 194: 99-114 Yusuf C (2007). Biodiesel from microalgae. Biotechnology Advances. 25: 294-306 Zinniel DK, Lambrecht P, Harris NB, Feng Z, Kuczmarski D Higley P and Vidaver AK (2002). Isolation and characterization of endophytic colonizing bacteria from agronomic crops and prairie plants. Applied and Environmental Microbiology. 68: 2198-2208

CHAPTER 14 Microbial Carbon Sequestration Loveleen Kaur, Robinka Khajuria and Aditi Kaushik Department of Biotechnology, School of Biotechnology and Bioscience, Lovely Professional University, Phagwara, Punjab – 144411 India Corresponding author: [emailprotected]

INTRODUCTION Past century and a half has witnessed a gradual increase of about 30% in the amount of atmospheric carbon dioxide and there is a common understanding among the scientists that this increase in the level of atmospheric carbon dioxide is directly related to the rising global temperature. Rising global temperature is not the only outcome of this increased carbon dioxide level, it has also led to a rise of 15–23 cm in the sea-levels during the twentieth century (IPCC 2007), notable shifts in ecosystems (Greene and Pershing 2007) and increased frequency and intensity of occurrence of wild fires (Running 2006; Westerling et al., 2006). U.S. Environment Protection Act, defines these gases that trap heat in the atmosphere as greenhouse gases. Among these greenhouse gasses, the main gases that enter the atmosphere as a result of human activities include carbon dioxide (CO2), Methane, Nitrous Oxide, and flourinated gases with CO2 being the most abundant anthropogenic greenhouse gas. Carbondioxide and greenhouse gases (GHGs) present in the Earth's atmosphere serve as a protective layer that retains heat and thus is responsible for maintaining habitable temperatures. Significant drop in the levels of atmospheric CO2 would lead to a rapid decrease in the global temperatures. On the contrary, increase in CO2 levels will result in increased global temperatures as increasing amounts of solar radiation will betrapped inside the "greenhouse." Carbon dioxide level in the atmosphere is maintained by a continuous flow among the stores of carbon in the atmosphere, the ocean, the earth's biological systems, and itsgeological materials. As long as the amount of carbon flowing into the atmosphere (as CO2) and out (inthe form of plant material and dissolved carbon) are in balance, the level of carbon in the atmosphereremains constant (Fig.1). However, this balance is disrupted by human activities such as extraction and burning of fossil fuels and the depletion offorests in particular leading to an increase of 0.880C in the global surface temperatures. In the late nineteenth century and 11 out of the 12 warmest years on record have occurred since 1995 (IPCC 2007).

228

Microbes: In Action

FIG 1: Basic Carbon cycle

The following example speaks volumes about how human activities temper with the carbon dioxide levels. Human activities primarily fossil fuel combustion and land-use changes contribute approximately 5.5 gigatons and 1.1 gigatons of carbon per year into the atmosphere. While the oceans and earth's ecosystems absorb approximately 2 gigatonsand 1.2 gigatons of carbon annually, thereby creating an excess of around 3.4 gigatons of carbon annually in the atmosphere (Stavins and Richards 2005). While the annual net increase in atmospheric carbon may not sound large compared with thetotal amount of carbon stored in the atmosphere—750 gigatons—it adds up over time. The rate at which human activity contributesto increases in atmospheric carbon is accelerating. Emissions from land-use change have been growingat the global level, though not nearly as rapidly as emissions from fossil fuel combustion. Most of the strategies developed till date to control global climate change are based on reducing emissions of carbon dioxide and other greenhouse gases (GHGs). Much less attention has beengiven to the concept of sequestering carbon in forests and otherecosystems as an alternative means of offsetting the effect of future emissions on GHG concentrations inthe atmosphere. One of the possible ways to increase the rate of remove CO2removal from the atmosphere is through ecosystems that can store the carbon in plant material, decomposing detritus, and organic soil. In this way, forests and other highly productive ecosystems can become biological scrubbers by sequestering CO2from the atmosphere. One of the proposed methods to reduce atmospheric carbon dioxide is to increase the global storage of carbon in soils. Mitigating the risk of Global warming has generated a worldwide interest in methods that can be used to stabilize the atmospheric abundance of CO2and other GHGs. (Kerr 2007; Kintisch2007b). There are three strategies of lowering CO2emissions to mitigate climate change (Schrag2007): 1. Reducing the global energy use 2. Developing low or no-carbon fuel, and 3. SequesteringCO2from point sources or atmosphere through natural and engineering techniques.

Microbial Carbon Sequestration

229

CARBON SEQUESTRATION Carbon sequestration refers to both natural and deliberate processes by which CO2 is either removed from the atmosphere or diverted from emission sources and stored in the ocean, terrestrial environments (vegetation, soils, and sediments), and geologic formations. Before human-caused CO2 emissions began, the natural processes that make up the global carbon cycle maintained a near balance between the uptake of CO2 and its release back to the atmosphere. However, existing CO2 uptake mechanisms are insufficient to offset the accelerating pace of emissions related to human activities. Controlling atmospheric CO2 will require deliberate mitigation with an approach that combines reducing emissions and increasing storage. Carbon dioxide (CO2) capture and sequestration (CCS) could play an important role in reducing greenhouse gas emissions, while enabling low-carbon electricity generation from power plants. NEED FOR CARBON SEQUESTRATION Evidence is mounting that carbon dioxide's heat-trapping power has already started to boost average global temperatures. The multinational Arctic Climate Impact Assessment (ACIA) report concludes that in Alaska, western Canada, and eastern Russia, average temperatures have increased as much as 4 to 7 degrees Fahrenheit (3 to 4 degrees Celsius) in the past 50 years. If carbon dioxide levels continue upward, further warming could have dire consequences, resulting from rising sea levels, agriculture disruptions, and stronger storms (e.g. hurricanes) striking more often. But choking off the stream of carbon dioxide entering the atmosphere does not have a simple solution. Fossil fuels, which provide about 85 percent of the world's energy, are made of hydrocarbons, and burning them releases huge quantities of carbon dioxide. Even as renewable energy sources emerge, fossil-fuel burning will remain substantial. And the fossil fuel in greatest supply — coal — is the worst carbon dioxide emitter per unit of energy produced. A grand challenge for the 21st century's engineers will be developing systems for capturing the carbon dioxide produced by burning fossil fuels and sequestering it safely away from the atmosphere. CAPTURING CO2 Methods already exist for key parts of the sequestration process. A chemical system for capturing carbon dioxide is already used at some facilities for commercial purposes, such as beverage carbonation and dry ice manufacture. The same approach could be adapted for coal-burning electric power plants, where smokestacks could be replaced with absorption towers. One tower would contain chemicals that isolate carbon dioxide from the other gases (nitrogen and water vapor) that escape into the air and absorb it. A second tower would separate the carbon dioxide from the absorbing chemicals, allowing them to be returned to the first tower for reuse. Methods of Carbon Sequestration There are several technological options for sequestrationof atmospheric CO2into

230

Microbes: In Action

one of the other globalpools (Fig. 3). The choice of one or a combination ofseveral technologies is important for formulatingenergy policies for future economic growth anddevelopment at national and global scales. These options can be grouped into two broad categories abiotic and biotic sequestration.

FIG 2: Abiotic and Biotic processes used for Carbon Sequestration

(a) Abiotic Sequestration Abiotic sequestration is based on physical and chemical reactions and engineering techniques without intervention of living organisms (e.g. plants, microbes). The abiotic strategy of C sequestration in oceanic and geological structures has received considerable attention (Freund and Ormerod 1997) because theoretically abiotic sequestration has a larger sink capacity than biotic sequestration. Rapid progress is being made in developing/testing technologies for CO2 capture, transport and injection (Table 1 and 2)(Kerr 2001). TABLE 1: Estimates of Carbon Reservoirs in Biospheres Reservoir Size Oceans Terrestrial Atmosphere

Gt (Billion tonnes) Carbon 44000 2200 750

Microbial Carbon Sequestration

231

TABLE 2: Carbon Sequestration Potential of Various Ecosystems Sequestration Potential Oceans Deep Saline Formations Terrestrial Depleted Oil and Gas Reservoirs

Gt (Billion tonnes) Carbon 1000s 100-1000s 10s 100s

1. Oceanic injection: Injection of a pure CO2 stream deep in the ocean is a possibility that has been widely considered by engineers for about three decades. Following the initial proposal in the late 1970s, there has been considerable progress in oceanic injection of CO2. To be stable and minimize outgassing, CO2 must be injected at great depths. Therefore, liquefied CO2 separated from industrial sources can be injected into the ocean by one of the following four techniques: (i) it is injected below 1000 m from a manifold lying at the ocean floor, and being lighter than water, it rises to approximately 1000 m depth forming a droplet plume; (ii) it is also injected as a denser CO2–seawater mixture at 500–1000 m depth, and the mixture sinks into the deeper ocean; (iii) it is discharged from a large pipe towed behind a ship; and (iv) it is pumped into a depression at the bottom of the ocean floor forming a CO2 lake. Liquefied CO2 injected at approximately 3000 m depth is believed to remain stable (O'Connor et al., 2001). The oceanic sink capacity for CO2 sequestration is estimated at 5000–10 000 Pg C, exceeding the estimated fossil fuel reserves (Herzog et al., 2002). However, CO2 injection may also have some adverse effects on deep sea biota (Lal 2008). In addition to the economics; the issue of stability of such an injection must be addressed owing to the increased stratification of the ocean water column and its turn over through natural processes. 2. Geological injection: This involves capture, liquefaction, transport and injection of industrial CO2 into deep geological strata. The CO2 may be injected in coal seams, old oil wells (to increase yield), stable rock strata or saline aquifers (Lal 2008). Saline aquifers are underground strata of very porous sediments filled with brackish (saline) water. In general, saline aquifers are located below the freshwater reservoirs with an impermeable layer in between. Industrial CO2 can be pumped into the aquifer, where it is sequestered hydrodynamically and by reacting with other dissolved salts to form carbonates. Carbon dioxide is injected in a supercritical state that has much lower density and viscosity than the liquid brine that it displaces. In situ, it forms a gas-like phase and also dissolves in the aqueous phase, creating a multiphase multicomponent environment. Injecting CO2into reservoirs in which it displaces oil or gas could be an economic strategy of enhanced oil recovery (EOR). Production from oil and gas fields, which has been in decline, is raised by CO2-enhanced recovery (Klusman 2003). This strategy of CO2 sequestration is used in Texas, USA, to inject 20 million Mg of CO2 yr-1 at a price of $10–$15 Mg-1 (Lackner 2003). The technique is also used in offshore oil wells in Norway. In a strict sense, however, this is not sequestration when the CO2 injected is extracted from underground wells. The CO2 can also be injected into unmineable coal seams where CH4

232

Microbes: In Action

is absorbed. Injected CO2 is absorbed onto coal twice as much as CH4, and the process enhances the gas recovery of coal bed CH4 (CBM). Principal concerns about geological sequestration, similar to that of the oceanic, are (Kintisch2007a; Schrag 2007): (i) reliability of storage of vast quantities of CO2 in geological strata and (ii) the cost. Some have argued that risks of leakage are low. However, to date, a few direct injection of CO2have been made on a commercial scale although the Regional Carbon Sequestration Partnership project of US DOE is planning for several demonstrations during 2008–2009. Similar to oceanic injection, cost and leakage are principal issues of geological sequestration which need to be resolved. Owing to the low density and viscosity and injection under supercritical conditions, the risks of CO2 leakage through confining strata may be higher than currently injected liquid wastes (Tsang et al., 2002). In addition, the chemical interactions of CO2 with the geological formations may have to be considered in formulating guidelines for appropriate regulatory and monitoring controls. The potential quantities which may be stored by any given ocean or geological 3. Mineral sequestration:Carbon, in the form of CO2 can be removed from the atmosphere by chemical processes, and stored in stable carbonate mineral forms. This process is known as 'carbon sequestration by mineral carbonation' or mineral sequestration. The process involves reacting carbon dioxide with abundantly available metal oxides–either magnesium oxide (MgO) or calcium oxide (CaO)–to form stable carbonates. These reactions are exothermic and occur naturally (e.g., the weathering of rock over geologic timeperiods (Herzog 2002; Goldberg et al., 2009). Calcium and magnesium are found in nature typically as calcium and magnesium silicates (such as forsterite and serpentinite) and not as binary oxides. The following table lists principal metal oxides of Earth's crust. Theoretically up to 22% of this mineral mass is able to form carbonates. It has been suggested that this process can be enhanced to carry out natural mineralization of CO2 (Kelemen and Matter 2008; Gardner 2008). (b) Biotic Sequestration Biotic sequestration is based on managed intervention of higher plants and micro-organisms in removing CO2 from the atmosphere. However, it is different from processes that reduce offset emission. Some biotic sequestration options are briefly described below. 1. Oceanic sequestration: The world's oceans are the primary long-term sink for anthropogenic CO2 emissions, currently accounting for a global net uptake of about 2 gigatons of carbon annually. However this uptake is not a consequence of human intervention for sequestration, but occurs naturally through chemical reactions between seawater and CO2 in the atmosphere. As the oceans absorbmore of atmospheric CO2, they become more acidic. Increase in acidity results in dissolution of various carbonate skeletons and sediments produced by many marine organisms and ecosystems. Various experiments carried out in laboratory and fieldindicate that CO2-induced acidification may eventually cause the rate of dissolution of carbonate to

Microbial Carbon Sequestration

233

exceed its rate of formation in these ecosystems. However, the impacts of ocean acidification on coastal and marine food webs and other resources are poorly understood and many efforts are underway to study the effects of oceanic carbon sequestration on these important environments. There are several biological processes which cause carbon sequestration in the ocean through photosynthesis. Phytoplankton photosynthesis is one such mechanism (Rivkin and Legendre 2001), which fixes approximately 45 Pg C yr-1 (Falkowski et al., 2000). Some of the particulate organic material formed by phytoplankton is deposited at the ocean floor and is thus sequestered (Raven and Falkowski 1999). Availability of Fe is one of the limiting factors on phytoplankton growth in oceanic ecosystems. Thus, several studies have assessed the importance of Fe fertilization on biotic CO2sequestration in the ocean (Martin et al., 2002; Boyd et al., 2004). Similar to deep injection, ocean fertilization may also change the ecology of the ocean (Chisholm et al., 2001). 2. Terrestrial sequestration: Transfer of atmospheric CO2into biotic and pedologic C pools is called terrestrial C sequestration. Of the 8.6 Pg C yrK-1 emitted into the atmosphere, only 3.5 Pg or 40% of the anthropogenically emitted CO2 remains in the atmosphere primarily owing to unspecified terrestrial sinks which sequester atmospheric CO2 and play an important role in the global C cycle (Lal2008). Terrestrial ecosystems act as a major C sink primarly because of photosynthesis and storage of CO2 in live and dead organic matter. Terrestrial C sequestration offers numerous advantages in terms of improved soil and water quality, restoration of degraded ecosystems and increased crop yield without the threat of global climate change. Terrestrial carbon sequestration takes place to a large extent in forests, soils and wetlands. 3. Biofuels: A sustainable alternative strategy to reduce the use of fossil fuels is the conversion of biomass-derived sugars to ethanol and plant-derived oils and fats into bio-diesel (Wald 2007). According to an estimate, of the world's total primary energy supply of 11.2Pg of oil equivalent in 2004, 35.03% came from oil, 24.6% from coal, 20.44% from gas, 6.33% from nuclear and 13.61% from renewable sources (Goldemberg2007). Of the renewable sources, 2.48% was contributed by the traditional biofuels (e.g. animal dung, crop residues, wood products), and 1.91% by modern biofuels while only 3.22% of the primary energy was contributed by hydro, solar, wind and geothermal sources. Biofuels, which have gained a lot of attention in the past few decades, are related to C sequestration in two distinct but interrelated aspects: 1. Soil C sequestration through restoration of the depleted soil organic carbon (SOC) pool, especially when agriculturally degraded soils are converted to energy plantations. 2. Recycling of atmospheric CO2 into biomass based biofuels. Biofuels produced from energy plantations established by dedicated crops such as poplar, willow, switch grass, miscanthus, karnal grass can sequester C in soil and reduce fossil fuel emissions and rate of abundance of atmospheric CO2 and other GHGs in the atmosphere. This might lead to an increase in

234

Microbes: In Action

competition between energy plantations and food/feed crops for land and water. TABLE 3: Comparison between Biotic and Abiotic Carbon Sequestration Parameters

Biotic

Abiotic

Process Sink Capicity Time Cost NPP and Biomass yield Reduction Human Health Environment Leakage Monitoring and Verification Regulatory Measures

Photosynthesis, Humification 50-100 Pg Immediate (Next 25-50 Years) None Low

Capture and Injection Thousands of Pg For long period (10-20 years from now) High NA

Minor to Low Positive Effect None to Small Simple and Routine method Monetary incentive may be helpful

High High Complex and expensive methods Complex and expensive methods Legislative and Policy measures essential

ROLE OF MICROORGANISMS IN CARBON SEQUESTRATION The decomposition of plant and animal residues in the soil constitutes a basic biological process. In this process, carbon is recycled as carbon dioxide (CO2), nitrogen is converted to ammonium, and other associated elements appear in forms required by higher plants (McGill and Cole 1981). Microorganisms perform a key role in nutrient cycling for sustaining the productivity of the soils, because they are the source and sink for mineral nutrition and can carry out biochemical transformations (Jenkinson and Ladd 1981). The nutrients produced by decomposition of organic matter are assimilated by microorganisms and incorporated into biomass, immobilized in the form of soil biomass or mineralized (Wani and Lee 1995). Microbial Communities and the Carbon Cycle The global carbon cycle is heavily dependent on microbial communities. These microorganism play pivotal roles in fixing atmospheric carbon, promoting plant growth, and degrading or transforming organic material in the environment. Large amounts of organic carbon are currently locked in high-latitude permafrost, grassland soils, tropical forests, and other ecosystems. Soil microbes play key roles in determining the longevity and stability of this carbon in these ecosystems and whether or not it is released into the atmosphere as greenhouse gas (GHG). Microbial Carbon Transformations in Soils Soils contain more than twice as much carbon as the atmosphere and are considered as the most stable reservoir of carbon in terrestrial ecosystems. Greater than two-thirds of the organic C stored in terrestrial ecosystems is contained in soil organic material (SOM) (Schlesinger, 1997). Both soil bacteria and fungi play significant roles in carbon transformations in soil. Organic C taken up by the microbial biomass is partitioned between microbial cell biomass production, metabolite excretion, and respiration. It has been observed that

Microbial Carbon Sequestration

235

there is a quantitative and qualitative improvement of SOM agroecosystems which favors a fungal-dominated community. The degree to which microbial organic material (MOM) accumulates in soil depends on a balance between production and decomposition of microbial products, that is the efficiency with which substrates are incorporated into bacterial and fungal biomass and byproducts and the rate at which bacterial and fungal byproducts are decomposed by other microorganisms (Six et al., 2006). Soil microbial communities help in the conversion of dead plant tissue and organic compounds into CO₂ or soil organic matter which can reside in terrestrial ecosystems for many years. Soil microbes also improve soil aggregation, which physically protects SOM thereby indirectly influencing the carbon cycle. Consequently, interactions between the amount of microbial biomass, microbial community structure, microbial byproducts, and soil properties such as texture, clay mineralogy, pore-size distribution, and aggregate dynamics influence microbial carbon sequestration in terrestrial ecosystems. According to the US Department of energy, understanding the microbial community reactions and environmental conditions controlling the transformation of organic carbon in soil could lead to opportunities for sequestering vast quantities of carbon in ways that improve soil quality and benefit the environment. Microbial Carbon Transformations in Permafrost Permafrost is the permanently frozen subsoil which represents about 20% of Earth's surface. Permafrost holds one-third of global soil organic carbon. It is estimated that the warming in the arctic circle in the future will be much higher than the global average which may trigger permafrost thawing and increase the soil microbial activity therein. This may lead to rapid release of large quantities of CO₂, methane (CH₄), and other GHGs into the atmosphere. There is an increased concern about understanding the systems biology of important classes of microorganisms in changing permafrost ecosystems in order to understand and possibly mitigate the effects of such ecosystems. Microbial Carbon Pump in Oceans The generally accepted biogeochemical mechanism of long-term carbon sequestration in the ocean is the biological pump. Biological carbon pump (BCP) is the downward flux of organic carbon from the surface ocean to depth which might be mediated by passive sinking of particles, active transport by animals, and mixing of dissolved organic matter (DOM). The microbial carbon pump (MCP) is a conceptual component of the BCP, used to describe the microbial production of refractory DOM (RDOM) which can be stored for thousands of years in the deep sea, rather than being respired to dissolved inorganic carbon and returned to the atmosphere (Jiao et al., 2011). In contrast to the biological pump, which emphasizes the vertical transport of carbon from the euphotic zone to the deep sea for carbon sequestration, the MCP emphasizes the formation of RDOC for carbon sequestration. RDOC can persist at any depth in the water column, including the surface ocean. Compared with the solubility pump, which depends on solubility of CO2 in seawater and thus has negative

236

Microbes: In Action

impacts, such as ocean acidification, for marine organisms, the MCP does not appreciably alter the buffering capacity of seawater and has no known negative impacts on marine organisms (Jio and Zheng 2011). According to an estimate the Dissolved Organic Carbon (DOC) pool in the ocean contains approximately the same amount of carbon as is stored as CO2 in the atmosphere. This DOC, which would otherwise be lost from the rest of the foodweb, is primarily consumed by heterotrophic prokaryotes (Bacteria and Archaea). These prokaryotes are subsequently consumed by protists, connecting the DOM to the foodweb (Azam et al., 1983). The microbially generated RDOM is resistant to biological decomposition and assimilation and thus persists in the water column. The known bacterium-derived RDOC compounds include cell wall components, such as peptidoglycan, lipopolysaccharides, lipoprotein, aromatic or olefinic components, and D-enantiomer amino acids (Jiao and Zheng 2011). Better understanding the molecular nature and global scope of the MCP calls for a multidisciplinary approach and the development of new tools to chemically characterize RDOM produced by marine microorganisms.

FIG 3: Microbial Carbon Pump operating in Ocean Ecosystem

Microbial Transformations of DOM The contributions of bacteria to marine DOM has gained attention over the past few years following the observation that bacteria contribute to marine dissolved organic nitrogen based on the abundance of D-enantiomers of specific amino acids (D-Ala, D-Glu, D-Asp) in marine DOM (McCarthy et al., 1998). The Lenantiomers of amino acids are common to all organisms and are the building blocks of proteins. However, D-enantiomers are specifically synthesized by bacteria and incorporated into a variety of unusual cell wall and membrane molecules (Asano and Lubbehusen 2000; Kaiser and Benner 2008). The Damino acids have been found to be ubiquitous in marine DOM and particulate organic matter. They are of utmost importance for tracing bacterial contributions because they can be measured directly in seawater without pre-concentration, they are found in all marine bacteria and bacterially derived DOM, they occur in a variety of biochemical components of bacterial cells, and they are not known to occur in combined form in any marine organisms besides bacteria (Jiao et al., 2011). Various other bacterial biomarkers have been observed in DOM such as

Microbial Carbon Sequestration

237

muramic acid (Benner and Kaiser 2003), diaminopimelic acid (Jorgensen et al., 2003), and short-chain 3-hydroxy fatty acids (Wakeham et al., 2003). Role of Heterotrophs in MCS Heterotrophic bacteria and Archaea generate RDOM through degradation and transformation of particulate and dissolved organic matter, exudation, and cell lysis (Nagata et al., 2000). In addition, prokaryotes also degrade 'older' DOM (Cherrier et al., 1999) derived from photochemically transformed DOM (Obernosterer et al., 1999). Hence, understanding the magnitude and variability of the production and respiration of bacteria and Archaea is important not only for quantifying the efficiency of the BCP (Robinson2008) and the role of prokaryotes in regulating carbon fluxes (Gasol 2010), but also for constraining the flow of DOM through the MCP. As discussed above, heterotrophic bacteria process about half of net primary production and thereby play a dominant role in the microbial carbon pump (MCP) by altering and transforming labile forms of organic matter into refractory forms that persist in the ocean. Brophy and Carlson (1989), Stoderegger and Herndl (1998) demonstrated that the microbial production of refractory DOM from labile substrates were conducted in natural seawater samples amended with simple 14C-labeled compounds, such as glucose and leucine in two separate bioassay experiments and found that bacterial capsular material is an important component of the DOM produced during these experiments. More recent bioassay experiments using labile substrates, such as glucose and glutamate, as the sole carbon sources to artificial seawater inoculated with natural microbial assemblages demonstrated that bacteria rapidly metabolized these substrates to produceslabile and refractory DOM that was chemically complex and included combined forms of neutral sugars, amino acids, and amino sugars. It is believed that nonspecific enzyme activities could play an important role in producing chemically complex and biologically refractory DOM (Ogawa et al.2001). With changing global climate, it is assumed that climate-driven increases in DOC supply may also impact the plankton community photosynthesis to respiration (P:R) ratio. This is because climate change will likely affect precipitation, river flow, ice melt, atmospheric deposition and so may significantly change the supply of inorganic and organic substrates to marine prokaryotes. Concomitant increases in sea surface temperature and decreases in pH and carbonate ion concentration could lead to changes in phytoplankton and zooplankton community structure, subsequently impacting foodwebderived DOC (Hoegh-Guldberg and Bruno 2010) In addition to heterotrophs, photoheterotrophs also influence the microbial carbon pump. Their ability to use light energy can reduce their carbon requirement, which means that less organic matter would be respired and converted into CO2. This might be especially important in the oligotrophic regions of the ocean, which are generally considered to be carbon sinks (Jiao et al.2011). The additional energy from light may also help to fuel various energydemanding processes such as active transport of substrates and nutrients across membranes, production of ectoenzymes, breakdown of complex organic

238

Microbes: In Action

molecules, and cell motility. Role of Viruses in Carbon Sequestration in Oceans As illustrated above, heterotrophic microbes generate RDOC while taking up LDOC. The resulting RDOC may be species specific or group specific and might be recalcitrant to some microbes but could be available to some others. Successive microbial processes would make the carbon increasingly recalcitrant in the environment (Jiao et al., 2011). In fact, the above-mentioned bacterial excretion of RDOC is only one of the pathways of the MCP. Another important mechanism releasing the bacterial organic carbon is viral lysis, which redistributes organic carbon across a continuum of dissolved to particulate organic materials (Weinbauer et al., 2011). While the majority of these lysis products can be rapidly assimilated again by heterotrophs, some of the lysis products are resistant to further microbial use. Viruses are the most abundant "life" forms in the ocean (Bergh et al., 1989) and some studies suggest that they significantly impact the mortality rates of marine prokaryotes and eukaryotic algae (Suttle et al., 1990), releasing cellular material from infected hosts into the environment. This release of lysis products as dissolved organic matter (DOM) and particulate organic matter (POM) has been termed the "viral shunt" (Weinbauer et al., 2011). The composition of virus-generated lysis products is poorly studied. Overall, viral lysis predictably increases the DOM pool, particularly the polymeric and colloidal components. Another consequence of virus activity is the potential to influence the aggregation of organic matter. The role of viruses within the MCP and the biological pump is potentially environment and condition specific. CONCLUSION Incessant human activities have disturbed the balance of carbon dioxide flow in the atmosphere leading to rising global temperatures, elevated sea-levels, shifts in ecosystems and increased occurrence of wild fires. These changes have forced the scientific community to search and develop methods to ensure that the levels of carbon dioxide and other greenhouse gases in the atmosphere are not allowed to increase beyond a threshold value. One of the ways to do so is to reduce global energy usage or develop low carbon fuels, but this process will take time to develop. An immediately available option of bringing down CO2 levels is Carbon sequestration. Using biotic and abiotic methods excess carbon dioxide can be removed from the atmospheres are stored in marine or terrestrial ecosystems. Biotic sequestration is based on managed intervention of higher plants and micro-organisms in removing CO2 from the atmosphere. The global carbon cycle is heavily dependent on microbial communities such as phytoplanktons, heterotrophic prokaryotes, archea and viruses which are known to sequester carbon in oceans. Currently, the anthropogenically derived increase in atmospheric CO2 has become a global challenge. However, microbial carbon pumps in the world's oceans as well as terrestrial ecosystems can serve as a potential solution for the mitigation of this problem.

Microbial Carbon Sequestration

239

REFERENCES Asano Y and Lubbehusen TL (2000). Enzymes acting on peptides containing D-amino acid. J Biosci. Bioeng. 89: 295-306 Azam F, Fenchel T, Field JG et al. (1983). The ecologicalrole of water-column microbes in the sea. Mar. Ecol. Prog. Ser.10:257-259 Benner R Kaiser K (2003). Abundance of amino sugars and peptidoglycan in marine particulate and dissolved organic matter. Limnol. Oceanogr. 48: 118-128 Bergh O, Borsheim KY, Bratbak G et al. (1989) High abundance of viruses found in aquatic environments. Nature. 340: 467-468 Boyd PW, Law CS, Wong CS et al. (2004). The decline and fate of an ironinducedsub-arctic phytoplankton bloom. Nature. 428: 549-553 Brophy JE and Carlson DJ (1989). Production ofbiologically refractory dissolved organic carbonby natural seawater microbial populations. Deep-Sea Res. 36: 497 Cherrier J, Bauer JE, Druffel ERM et al. (1999). Radiocarbon in marine bacteria: Evidence for the ages of assimilatedcarbon. Limnol Oceanogr. 44: 730 Chisholm SW, Falkowski PG and Cullen JJ (2001). Discreditingocean fertilization. Science. 294: 309-310 Falkowski P, Scholes RJ, Boyle E et al. (2000). The global carbon cycle: a test of ourknowledge of earth as a system. Science. 290: 291-296 Freund P and Ormerod WG (1997). Progress towards storageof carbon dioxide. Energy Convers Manage. 38: 198-205 Gardner T (2008). Scientists say a rock can soak up carbon dioxide Reuters. Uk.reuters.com. Gasol JM, Pinhassi J, Alonso-Saez L et al. (2008). Towards a better understanding of microbialcarbon flux in the sea. Aquat Microb Ecol. 53:21-38 Goldberg P, Zhong-Ying C, O'Connor W et al. (1998). CO2 Mineral Sequestration Studies in US National Energy Technology Laboratory. Goldemberg J (2007). Ethanol for a sustainable energy future. Science. 315: 808-810 Greene CH and Pershing AJ (2007). Climate drives sea change. Science. 315: 1084-1085 Herzog H (2002). Carbon Sequestration via Mineral Carbonation: Overview and Assessment. Massachusetts Institute of Technology. Herzog H, Drake E and Adams EE (1997). CO2 capture, reuse and storage technologies for mitigating climate change. A white paper prepared for USDOE by the MITEnergy Lab. See web.mit.edu/energylab/www/. Herzog H, Eliasso B and Kaarstad O (2002). Capturing greenhouse gases. Sci Am. 282: 72-80 Hoegh-Guldberg O and Bruno JF (2010). The Impact of Climate Change on the World's Marine Ecosystems. Science. 328:1523-1528 Jenkinson DS and Ladd JN (1981). Microbial Biomass in Soil Measurement and Turnover. Pages 415-471. In: Soil Biochemistry (Paul EA and Ladd JN, eds.). New York, USA: Marcel Dekker. Jiao N, Azam F and Sanders S (2010). Microbial Carbon pump in the ocean. Science AAAS. Jiao N, Herndl GJ, Hansell DA, et al. (2010). Microbial production of recalcitrant dissolved organic matter: long-term carbon storage in the global ocean. Nat Rev Microbiol. 8:593-599 Jiao N and Zheng Q (2011). The Microbial Carbon Pump: from Genes to Ecosystems. Appl Environ Microbiol. 77(21):7439 Jorgensen NOG, Stepanaukas R, Pedrson AGU et al. (2003). Occurrence and degradation of peptidoglycan in aquatic environments. FEMS Microbiol Ecol. 46:269-280 Kaiser K and Benner R (2008). Major bacterial contribution to the ocean reservoir of detrital organic carbon and nitrogen. Limnol Oceanogr. 53: 99-112 Kelemen PB and Matter J (2008). In situ carbonation of peridotite for CO2 storage. Proc Natl Acad Sci USA. 105(45): 172 Kerr RA (2001). Bush backs spending for a Global problem. Science. 292: 1978 Kerr RA (2007). Scientists tell policy makers we're allwarming the world. Science 315: 754-757 Kintisch E (2007a). Report backs more projects to sequester CO2 from coal. Science. 315: 1481.

240

Microbes: In Action

Kintisch E (2007b). New congress may be warming up to plansfor capping emissions. Science. 315: 444 Klusman RW (2003). Evaluation of leakage potential CO2 EOR/sequestration project. Energy Convers Manage. 33:1921-1940 Lackner KS (2003). A guide to CO2 sequestration. Science 300: 1677-1678 Lal R (2008) Carbon sequestration. Phil Trans R Soc B. 2008:363 Martin JH, Coale KH, Johnson KS et al. (2002) Testing the iron hypothesis in ecosystems of the equatorial Pacific Ocean. Nature. 371: 123-129 McCarthy MD, Hedges JI and Benner R (1998). Major bacterial contribution to marine dissolved organic nitrogen. Science. 281: 231-234 McGill WB and Cole CV (1981). Comparative aspects of organic C, N, S and P cycling through organic matter during pedogenesis. Geoderma. 26: 267-286 MIT (2007). The Future of Coal: Options for a Carbon-Constrained World, Massachusetts Institute of Technology. Nagata T (2000). Microbial Ecology of the Oceans. KirchmanDL Ed., John Wiley and Sons, Inc. New York, 1st Edition, pp. 121-152 Obernosterer I, Reitner B and Herndl GJ (1999). Contrasting effects of solar radiation on dissolved organic matter and its bioavailability to marine bacterioplankton. Limnol Oceanogr. 44:1645-1654 O'Connor WK, Dahlin DC, Nilsen DN et al. (2001) Carbon dioxidesequestration by direct mineral carbonation: results fromrecent studies and current status. See. www.netl.doe.gov/publications/proceedings/o1/carbon_seq/bC2.pdf. Ogawa H, Amagi Y, Koike I et al. (2001) Production of refractory dissolved organic matter by bacteria. Science. 292: 917-920 Raven JA and Falkowski PG (1999). Oceanic sinks for atmospheric CO2. Plant Cell Environ. 22: 741-755 Rivkin RB and Legendre L (2001). Biogenic carbon cycling inthe upper ocean: effects of microbial respiration. Science. 291:2398-2400 Robinson C (2008). Microbial Ecology of the Oceans DL Kirchman Ed. John Wiley and Sons, Inc. ed. 2, pp. 299-334 Running SM (2006). Is global warming causing more large wild fires? Science 313: 927-928 Schlesinger WH (1997). Biogeochemistry: An analysis of global change. 2nd ed. Academic Press Inc., San Diego, CA. Schrag DP (2007). Preparing to capture carbon. Science. 315:812-813 Six J, Frey SD, Thiet RK and Batten KM (2006). Bacterial and Fungal Contributions to Carbon Sequestration in Agroecosystems. Soil Sci Soc Am J. 70: 555-569 Stavins RN and Kenneth RR (2005). The cost of US Forest-based Carbon Sequestration. A Report Prepared by the Pew Center on Global Climate Change. pp.3 Stoderegger K and Herndl GJ (1998). Production and release of bacterial capsular material and its subsequent utilization by marine bacterioplankton. Limnol Oceanogr. 43: 877-884 Suttle CA, Chan AM and Cottrell MT (1990). Infection of phytoplankton by viruses and reduction of primary productivity. Nature. 347: 467-469 Tsang CF, Benson SM, Kogelski B et al. (2002). Scientific considerations related to regulation developmentfor CO2 sequestration in brine formations. Environ Geol. 42: 275-281 Wakeham SG, Pease TK and Benner R (2003). Hydroxy fatty acids in marine dissolved organic matter as indicators of bacterial membrane material. Org Geochem. 34: 857-868 Wald ML (2007). Is ethanol for the long haul? Sci Am. pp. 42-49 Wani SP and Lee KK (1995). Microorganisms as biological inputs for sustainable agriculture. In: Organic Agriculture (Thampan PK ed.). Cochin, India: Peekay Tree Crops Development Foundation. pp. 39-76 Weinbauer MG, Chen F and Wilhelm SW (2011). Virus-mediated redistribution and partitioning of carbon in the global oceans. In: Jiao N, Azam F, Sanders S (eds.), Microbial carbon pump in the ocean. Science/AAAS, Washington, DC. pp. 54-56 Westerling AL, Hidalgo HG, Cayan DR et al. (2006) Warming and earlier spring increase westernU.S. forest wildfire activity. Science. 313:940-943

CHAPTER 15 Microbial Biofilms Surendra Kumar, Dilip Singh Solanki and Praveen Gehlot Department of Botany, Jai Narain Vyas University, Jodhpur-342001 India Corresponding author: [emailprotected]

INTRODUCTION A biofilm is a complex aggregation of microorganisms growing on a solid substrate, varying in thickness from a mono cell layer to 6 – 8 cm thick, but mostly on an average of about 100 μm in thickness. It is an assemblage of microbial cells that is irreversibly associated with a surface and enclosed in a matrix of primarily polysaccharide material. In other words, it is complex aggregation of microorganism marked by the section of a proactive and adhesive matrix. In their natural environment, biofilm commonly consists of aggregates of bacteria, encased in a mucoid polysaccharide structure, often growing as populations attached to surfaces. It represents microbial societies with their own defense and communication system. It may be a pure culture derived from a single type of microorganism or more often, a mixed culture of multiple microorganisms (Kumar and Prasad, 2006). Biofilms contain many different types of microorganism, e.g. bacteria, archaea, actinobacteria, cyanobacteria, algae, fungi and protozoa; each group performing specialiazed metabolic functions. However, some organisms form monospecies film in uncertain condition. Bacterial biofilms formed by Pseudomonas aeruginosa, P. fluorescens, Escherichia coli, Staphylococcus spp. and Vibrio cholerae have been studied in detailed. In some hardy microbial communities, bacteria like nontuberculous mycobacteria, Pseudomonas aeruginosa, Legionella pneumophila etc. not only survive but proliferate and wait for susceptible hosts (Stewart and Costerton, 2001). Biofilms are characterized by structural heterogeneity, genetic diversity, complex community interaction and a hydrated extracellular matrix (ECM) of polymeric substances (Donlan, 2002). The first colonists facilitate, the arrival of other cells by providing more diverse adhesion sites and building the matrix that holds the biofilm together. Only some species are able to attach to a surface on their own while others usually anchor themselves to the matrix or directly to the earlier colonists. Once colonization has begun, the biofilm grows through cell division (Deibel, 2001). A single bacterial species can form a biofilm, but in natural environment, it often comprises various species of bacteria, fungi, algae, protozoa and debris along with corrosion products (Deibel, 2001). Noncellular materials such as mineral crystals, corrosion particles, clay or silt particles, or blood components, depending on the environment in which the biofilm has

242

Microbes: In Action

developed, may also be found in the biofilm matrix. Biofilm associated organisms also differ from their planktonic (freely suspended) counterparts with respect to the genes that are transcribed. Biofilms may form on a wide variety of surfaces, including living tissues, medical devices, industrial machines, water system piping, or natural aquatic systems. The water system biofilm is highly complex, containing corrosion products, clay material, fresh water diatoms and filamentous bacteria. The biofilm on the medical device, appears to be composed of a single, coccoid organism and the associated extracellular polymeric substance (EPS) matrix. Biofilms are not simply passive assemblages of cells that are stuck to surfaces, but are structurally and dynamically complex biological system. DISTRIBUTION OF BIOFILM Biofilms are appears in everywhere in more than one form. (Donlan, 2002). Biofilm are usually found on solid substrates submerged in or exposed to some aqueous solution, although they can form as floating mats on liquid surfaces and also on the surface of leaves, particularly in high humidity climates. Many human being will host a biomaterial, and will therefore be at risk of biofilm infection. The surfaces for biofilm growth include rocks in water, surface of aquatic plants, water debris, food stuff, teeth, and various biomedical implants like joint replacements, artificial hearts, contact lenses, prosthetic devices, vascular prostheses, intrauterine devices, orthopedic implants, heart valves, dental implants, temporary indwelling, intravascular catheters and reverse osmosis membrane filters (Donlan, 2001; Donlan, 2002). These devices are mostly made of inert metals, plastics and other synthetic products like polyethylene terepthalate (dacron), polyethylene, silicone rubber, polymethyl methacrylate, polytetra fluoroethylene (Teflon) and polyvinylchloride. After the biomaterial is implanted, either tissue cells or microorganisms will begin to colonize it. If the tissue cells colonize first, the implant will most likely be successful. If the bacteria colonize first, many microorganisms can adhere to the surface of the implant, leading to colonization (Costerton and Lappin– Scott, 1995). Microbial infections can form on biomaterial that are totally inside the human body or partially exposed to the outside. In industrial environment, biofilms are encountered on the interior of slime clogging drainpipes. Biofilm consists microbes and extracellular polymeric substance (EPS). EPS is an abbreviation for either extracellular polymeric substance or exopolysaccharide. EPS may accounts more than 70% of the total organic materials of biofilms and can be considered the primary template for the biofilm (Flemming et al., 2000). EPS may vary in physical and chemical properties, but it is mainly composed of polysaccharides. Some of these polysaccharides are neutral or polyanionic. The EPS of gram negative bacteria, the presence of uronic acids (such as D–glucuronic, D–galacturonic and mannuronic acids) or ketal– linked pyruvates confers the anionic property (Sutherland 2001). This property is important because it allows association of divalent cations such as magnesium and calcium which have been shown to cross–link with the polymer strand and provide greater binding force in a developed biofilm. In the case of some gram positive bacteria, such as the Staphylococci, the chemical composition of EPS may

Microbial Biofilms

243

be quite different and may be primarily cationic. Hussain et. al. (1993) found that the slime of coagulate negative bacteria consists of a teichoic acid mixed with small quantities of proteins. EPS is also highly hydrated because it can incorporate large amounts of water into its structure by hydrogen bonding. Although most types of EPS are both hydrophilic and hydrophobic. EPS may also vary in its solubility. Sutherland ((2001) noted two important properties of EPS that may have a marked effect on the biofilm. First, the composition and structure of the polysaccharides determine their primary conformation. For example, many bacterial EPS possess backbone structure that contain 1,3 or 1,4– –linked hexose residues and tend to be more rigid, less deformable, and in certain cases poorly soluble or insoluble. Second the EPS of biofilm is not generally uniform but may vary spatially and temporally (Leriche et. al. 2000). Use the binding specificity of lectins to simple sugars to evaluate bacterial biofilm development by different organisms. It is noticed that different organism produce differing amounts of EPS and that the amount of EPS increases with age of the biofilm. EPS production is known to be affected by nutrients status of the growth medium excess available carbon and limitation of nitrogen, potassium or phosphate promote EPS synthesis. Slow bacterial growth will also enhance EPS production (Sutherland 2001). Because EPS is highly hydrated, it prevents desiccation in some natural biofilms. EPS may also contribute to the antimicrobial resistance properties of biofilms by impeding the mass transport of antibiotics through the biofilm, probably by binding directly to these agents (Donlan, 2000). MECHANISM OF BIOFILM FORMATION Biofilm development is conceived as a developmental process in which free swimming cells attach to a surface, first transiently and then permanently, as a single layer. This monolayer of immobilized cells gives rise to larger cell clusters that eventually develop into a three dimensional structure, consisting of large pillars of bacteria, interspersed with water channels (Costerton and Lappin– Scott, 1995). Comprehensive studies in recent times have been made with respect to V. cholera. The V. cholera monolayer, a distinct stage in biofilm development, requires a combination of pili, flagella and exopolysaccharide. The environmental signals, bacterial structures and transcription profiles that induce and stabilize the monolayer state are unique. The cells in a monolayer are specialized to maintain their attachment to a surface. The surface itself activates mannose sensitive haemagglutinin types IV pilus (MSHA) mediated attachment, which is accompanied by the repression of flagellar gene transcription. (Moorthy and Watnick 2004). In contrast, the cells in a biofilm are specialized to maintain intercellular contacts. The progression to this stage occurs when exopolysaccharide synthesis is induced by environmental monosaccharides. Thus, the proposed model for biofilm development in natural environment is (i) cells form a stable monolayer on a surface (ii) when biotic surfaces are degraded with the subsequent release of carbohydrates, the monolayer develop into a biofilm (Davey and Otoole 2000). Usually the methodology involved glass slides into natural environments

244

Microbes: In Action

and observing the biofilm developed, under microscope. The adhesion and attraction of the bacteria to the surface may be brought about by different mechanism, including surface charge, gravity, Brownian motion and chemo attraction, provided the surface has nutrients. After attraction, the attachment of bacteria to the surface occurs by a two step process, comprised of reversible binding (Jenkinson and Lappin–Scott, 2001). The reversible binding is usually brought about by weak Vander Waals forces to hold the bacterium. Close to the surface, before a stronger attachment can arise by a combination of both physical and chemical forces. The production of exogenous polysaccharides, containing the material exuded by bacteria is one of such chemical substances implicated, also called as the glycocalyx. The bacteria divide and grow freely within this glycocalyx to form microcolonies, eventually forming a biofilm (Kumar and Prasad, 2006). The biofilm formation is partially controlled by quorum sensing, an inter bacterial communication mechanism dependent on population density. The adhesion capability of the invading microbes depend on the nature and type of surface shape, environment, hom*ogeneity, charge, electrolyte concentration, hydrophobicity, flux materials, hydrodynamics, flow characteristics, nutrient availability at the surface, nutrient concentration, proper pH and temperature availability etc. (Marshall, 1994). The sequence of events that occur during biofilm formation can be summarized as follows (i) one or more bacterial organisms are attracted to a surface, influenced by the factors, (ii) The primary colonizing bacteria attaches to the surface and multiplies, producing an altered microenvironment around the established microcolony by its metabolic activity, (iii) hom*ogeneous one, which, in turn, attracts other bacterial species, (iv) A succession of colonizing bacteria attach on to the surface, resulting in the formation of a biofilm, until a series of complex communities result (Deibel, 2001; Jenkinson and Lappin– Scott, 2001). Study also revealed that bacteria use quorum sensing to coordinate population or community behavior in biofilm development. Quorum sensing helps as a indicator of population density. A variety of different molecules use as signals. Common classes of signaling molecules are oligopeptides in gram positive bacteria, N–Acyl hom*oserine Lactones (AHL) in gram negative bacteria, and a family of autoinducers known as autoinducer–2 (AI–2) in both gram negative and gram positive bacteria. FACTORS EFFECTING BIOFILM FORMATION Donlan (2002) reviewed factors effected biofilm formation are presented here for better understanding of biofilm formation. These are substratum effects, attachment, characteristic of the aqueous medium, conditioning films, hydrodynamics, properties of the cell etc. Substratum Effects The solid surface have several characteristics that are important in the attachment process. Characklis et. al. (1990) observed that the extent of microbial colonization appears to increase as the surface roughness increases. This is because shear forces are diminished, and surface area is higher on

Microbial Biofilms

245

rougher surfaces. The physico-chemical properties of the surface may also exert a strong influence on the rate and extent of attachment. Most investigators have found that microorganisms attach more rapidly to hydrophobic, non polar surfaces such as Teflon and other plastics than to hydrophilic materials such as glass or metals. Even though results of these studies have at times been contradictory because no standardized methods exist for determining surface hydrophobicity, some kind of hydrophobic interaction apparently occurs between the cell surface and the substratum that would enable the cell to overcome the repulsive forces active within a certain distance from the substratum surface and irreversibly attach. Attachment Surface The solid–liquid interfare between a surface and an aqueous medium provides an ideal environment for the attachment and growth of microorganisms. A clear picture of attachment cannot be obtained without considering the effects of the substratum, conditioning films forming on the substratum, hydrodynamics of the aqueous medium, characteristics of the medium, and various properties of the cell surface. Characteristic of the Aqueous Medium Characteristics of the aqueous medium, such as nutrient levels, pH, temperature, ionic strength, play a role in the rate of microbial attachment to a substratum Cowan et. al. (1991) proved in a laboratory study that an increase in nutrient concentration correlated with an increase in the number of attached bacterial cells. Several studies have shown a seasonal effect on bacterial attachment and biofilm formation in different aqueous systems (Donlan et al., 1994; Fera et al., 1989). This effect may be due to water temperature or to other unmeasured, seasonally affected parameters. Fletcher (1988) found that an increase in the concentration of several cations (calcium, sodium, lanthanum, terric iron) affected the attachment of Pseudomonas fluorescens to glass surfaces, presumably by reducing the repulsive forces between the negatively charged bacterial cells and the glass surfaces. Conditioning Films A material surface exposed in an aqueous medium will inevitably and almost immediately become conditioned or coated by polymers from that medium, and the resulting chemical modification will effects the rate and extent of microbial attachment. Loeb and Neihof (1975) were the first to report the formation of these conditioning films on surfaces exposed in seawater. These researchers found that films were organic in nature, formed within minutes of exposure, and continued to grow for several hours. The nature of conditioning films may be quite different for surfaces exposed in the human host. A prime example may be the proteinaceous conditioning film called "acquired pellicle", which develops on tooth enamel surfaces in the oral cavity. Pellicle comprises albumin, lysozyme, glycoproteins, phosphoproteins, lipids and gingival crevice fluid. Marsh (1995) observed that bacteria from the oral cavity colonize pellicle conditioned surfaces within hours of exposure to these surfaces. Mittelman

246

Microbes: In Action

(1996) noted that a number of host–produced conditioning films such as blood, tears, urine, saliva, intervascular fluid, and respiratory secretions influence the attachment of bacteria biomaterials. Ofek and Doyle (1994) also noted that the surface energy of the suspending medium may affect hydrodynamic interaction of microbial cells with surfaces by altering the substratum characteristics. Hydrodynamics In theory, the flow velocity immediately adjacent to the substratum / liquid interface is negligible. This zone of negligible flow is termed the hydrodynamic boundary layer. Its thickness is dependent on linear velocity, the higher the velocity, the thinner the boundary layer. The region outside the boundary layer is characterized by substantial mixing or turbulence. For flow regimes characterized as laminar or minimally turbulent, the hydrodynamic boundary layer may substantially affect cell substratum interactions cells behave as particles in a liquid, and the rate of setting and association with a submerged surface will depend largely on the velocity characteristics of the liquid. Under very low linear velocities, the cells must traverse the sizeable hydro dynamics boundary layer, and association with the surface will depend in large part on cell size and cell motility. As the velocity increases, the boundary layer decreases, and cells will be subjected to increasingly greater turbulence and mixing. Higher linear velocities would therefore be expected to equate to more rapid association with surface, at least until velocities become high enough to exert substantial shear forces on the attaching cells, resulting in detachment of these cells (Characklis, 1990). This finding has been confirmed in studies by Rijnaarts et. al.(1993) and Zheng et. al. (1994). Properties of the Cell Cell surface hydrophobicity, presence of fimbriae and flagella, and production of EPS all influence the rate and extent of attachment of microbial cells. The hydrophobicity of the cell surface is important in adhesion because hydrophobic intractions tend to increase with an increasing nonpolar nature of one or both surface involved (i.e., the microbial cell surface and the substratum surface). Most bacteria are negatively charged but contain hydrophobic surface components. Fimbriae play a role in cell surface hydrophobicity and attachment. ADVANTAGE OF BIOFILM FORMATION TO MICROBES Choudhury et. al. (2013) reviewed advantage of biofilm formation to microbes. These advantages are as follow: Protection from Antimicrobial Agents The exopolysaccharide glycocalyx in the form of extra cellular matrix (ECM) is considered as physical barrier which not allowing the antimicrobial agents to reach the microcolonies. The antimicrobial agents are not capable of easily pass through matrix. However, latest information showed that the antibiotics are able to penetrate the biofilm rapidly and reach the surface below the film, they are incapable to penetrate effectively the sessile cells located in clumps or microcolonies. The antibiotics being effective against the planktonic population

Microbial Biofilms

247

and a few sessile cells on the outer edges of microcolonies, the inner cells remain viable after cessation of the antibacterial treatment. Biofilm sessile organisms can require 50 to 6000 times the planktonic minimal bactericidial concentration (MBC) to control an infection. Gene Transfer Biofilms also provide an ideal niche for the exchange of extrachromosomal DNA (plasmids). Conjugation (the mechanism of plasmid transfer) occurs at a greater rate between cells in biofilms than between planktonic cells. Ghigo, (2001) suggested that medically relevant strains of bacteria that contain conjugative plasmids more readily develop biofilms. F Conjugative pilus (encoded by the tap operon of the F plasmid) acts as an adhesion factor. For both cell surface and cell cell interactions, resulting in a three dimensional biofilm of E. coli. Plasmid carrying strains have also been shown to transfer plasmids to recipient organisms, resulting in biofilm formation; without plasmids these same organisms produce only microcolonies without any further development. The probable reason for enhanced conjugation is that the biofilm environment provides minimal shear and closer cell to cell contact. Since plasmids may encode for resistance to multiple antimicrobial agents, biofilm association also provides a mechanism for selecting for and promoting the spread of, bacterial resistance to antimicrobial agents. It also warrants transfer of plasmid DNA and acquisition of new genetic trait, thereby conferring beneficial capabilities to the recipient. The altered gene expression and increased opportunities for horizontal gene transfer are recognized as consequence of the association of microbes with surfaces. Nutrient Exchange The concentration of available nutrients in the biofilm directly affects the growing cells within it. The polyanionic exopolysaccharide matrix, surrounding the microcolonies of sessile bacteria, serves as an ion exchange column, concentrating nutrients and ions, especially cations, from the surrounding fluid, leading to an increased availability of nutrients for growth. The presence of concentrated nutrients in the biofilm helps the sessile bacteria to tide over adverse bulk fluid conditions which directly hamper planktonic growth. The multispecies microconsortia facilitate interspecies substrate exchange or removal and allocation of metabolic products. Dehydration Free The presence of highly hydrated Extracellular matrix containing water, protects the microorganisms within it from the effect of desiccation. The same safeguard is unavailable to the planktonic bacteria, which are directly dependent on the availability of water in the immediate surroundings. Higher Metabolic Activity Microorganisms attached to a surface are more metabolically active than planktonic bacteria. A consortium of bacterial species within the biofilm interact with each other in several ways, such as removal of toxins produced by one

248

Microbes: In Action

species, degradation of complex substrates by other species. Compounds like cellulose to be utilized as an energy or carbon sources, recycling of substances etc. Microbial colonies ensures combined metabolic capabilities in bringing about rapid substrate degradation, leading to the enhancement of previously mentioned advantages. APPLICATION OF BIOFILM A. Positive Effect Human have made considerable beneficial use of microbial biofilms, primarily in the area of habitat remediation. 1. Biofilm can be used for water treatment, in that they can break down undesirable compounds, thereby purifying the water. Many sewage treatment plants include a treatment stage, in which waste water passes over biofilm grow on filters, which extract and digest harmful organic compounds. 2. Some reactors designed to promote biofilm growth are very effective for treating environmental wastes such as sewage, industrial waste streams or contaminated groundwater. 3. A biofilter is one of several air pollution control technologies that use microorganisms to treat odorous air. The air passes from the plenum through the biofilter media where the microorganisms treat it before it exhausts to the atmosphere. A well managed biofilter can reduce emission of 85%, hydrogen sulfide, 90% ammonia. The emission reductions can vary widely from 20% to nearly 100%. 4. Biofilm can help eliminate petroleum oil from contaminated ocean or marine system. The oil is eliminated by the hydrocarbon degrading activities of microbial communities, in particular by a remarkable recently discovered group of specialists, the so called hydrocarbonoclastic bacreria (HCB). 5. Biofilms can be used to produce a wide variety of biochemical that are then purified and utilized for public good, including medicines, food addictives, or chemical additives for cleaning products. 6. Biofilms attracted to particles of contaminated soils and aquatic sediments help degrade soil bound contaminants occuring from accidental chemical releases into the environment. 7. Biofilm attached to the plant roots of some crops help cycle nutrients to and from the plant, resulting in increased agricultural productivity. B. Negative Effect 1. The physical presence of biofilm either damages surfaces or causes obstruction so that the efficiency of the surface is reduced. This kind of surface damage is collectively termed as "biofouling". Biofouling is also commonly found in shipping industry. The microorganisms like bacteria or algae can form a microfilm on the hull of a ship. This biofilm can then serve as an attractive substrate for the attachment of macroorganisms like seaweed or barnacles. This macrocoating fouls the null, and can retard the efficiency of the vessel.

Microbial Biofilms

249

2. It causes corrosion or deterioration of the interior of metal pipelines, storage tanks or vessels, computer chips, contamination of food, pharmaceutical and medical products, equipment failure, energy loss through inefficient energy transfer and decreased productivity. 3. The biofilms on floors and counters can make sanitation difficult in food preparation areas. 4. Clinical and Public health microbiologists recognition that microbial biofilms are ubiquitous in nature has resulted in the study of a number of infectious disease processes from a biofilm perspective. 5. Medical devices or other devices used in the health care environment have been shown to harbor biofilms, resulting in measurable rates of device associated infections. 6. Due to resistance to antimicrobial agents, biofilm often cannot be removed from biomedical devices, causing significant morbidity or occasional mortality. In a medical set up, a range of apparatuses, which are in contact with water, find several applications. 7. The body surfaces, especially skin, have a wide range of microbial flora, being dominated by Staphylococcus epidermidis. Such bacteria quickly invade the implants and form extensive biofilm. 8. The dental plaques or dental diseases are another common clinical sign of the occurrence of biofilm. It is less clear is an understanding of how interaction and growth of pathogenic organisms in a biofilm result in an infectious disease process. 9. Biofilm associated gram negative bacteria may produce endotoxins. FUTURE PROSPECTUS 1. Research on microbial biofilms is proceeding on many ways, with particular emphasis formation of biofilm, quorum sensing, nature of biofilm, genes expression in biofilm associated organisms, role of biofilms in chronic diseases, role of biofilms in antimicrobial resistance, biofilm as a reservoir for pathogenic organisms. etc. 2. Research also focus on the Preventing biofilm colonization of medical devices and development of new methods for assessing the efficacy of these treatments. Evaluation of various control strategies including medical devices treated with antimicrobial agents and antimicrobial compounds. 3. Researchers in the fields of clinical, food and water, and environmental microbiology have begun to investigate microbiologic processes from a biofilm perspective. 4. As the pharmaceutical and health care industries embrace this approach, novel strategies for biofilm prevention and control will undoubtedly emerge. TABLE 1: Microorganisms commonly associated with biofilms on medical devices. S. No.

Microorganism

Biofilm

(1)

Pseudomonas aeruginosa Staphylococcus aureus

Urinary catheter, Artificial hip prosthesis, Central venous catheter

(2)

Central venous catheter, Prosthetic heart valve, Artificial hip prosthesis, Intrauterine device

250

Microbes: In Action

S. No.

Microorganism

Biofilm

(3) (4)

Klebsiella pneumoniae Enterococcus spp.

(5) (6)

Candida albicans Coagulase negative Staphylococci

Central venous catheter, Urinary catheter Urinary catheter, Intrauterine device, Artificial hip prosthesis, Central venous catheter, Prosthetic heart valve central venous catheter, Artificial voice prosthesis, Intrauterine device Urinary catheter, Artificial hip prosthesis, Prosthetic heart valve, Artificial voice prosthesis, Central venous catheter, Intrauterine device

ACKNOWLEDGEMENT The book chapter microbial biofilm is written from other good review articles and source of good information during seminar presentation of Post Ggraduate degree course. Authors presented all the information in well defined topics in a brief without any claim of original thought. REFERENCES Characklis WG, McFeters GA and Marshall KC (1990). Physiological ecology in biofilm system. In: Characklis WG, Marshall KC, editors. Biofilms, New York: John Wiley and Sons; pp 341-394 Characklis WG (1990). Microbial fouling. In: Characklis WG, Marshall. KC, editors. Biofilms, New York: John Wiley and Sons. pp. 523-584 Choudhury AR, Chakraborty M and Bhattacharya S (2013). Formation and importance of biofilm. Everyman's Science 48(4): 298-304 Costerton JW and Lappin-Scott HM (1995). Introduction of microbial biofilm. In: HM Lappin-Scott and JW Casterton (eds.), Microbial biofilms, Cambridge University Press, Cambridge, United Kingdom, pp. 1-11 Cowan MM, Warren TM and Fletcher M (1991). Mixed species colonization of solid surfaces in laboratory biofilms. Biofouling. 3: 23-34 Davey EM and Otoole AG (2000). Microbial biofilms from ecology of molecular genetics. Microbiol. Mol. Biol. 64: 847-867 Deibel V (2001). Biofilm. J. Food Safety 1: 6-7 Donlan RM, Pipes WO and Yohe TL (1994). Biofilm formation on cast iron substrata in water distribution system. Water Res. 28: 1497-1503 Donlan RM (2000). Role of biofilms in antimicrobial resistance. ASAIO J. 46: 547-552 Donlan RM (2001). Biofilms and device- associated infection. Emerging Infectious Diseases. 7: 227-281 Donlan RM (2002). Biofilm: Microbial life on surfaces. Emerging Infectious Diseases. 8: 881890 Fera P, Siebel MA, Characklis WG and Prieur D (1989). Seasonal variation in bacterial colonization of stainless steel, aluminum, and polycarbonate surfaces in a seawater flow system. Biofouling 1: 251-61 Flemming HC, Wingender J and Griegbe MC (2000). Physico-chemical properties of biofilms. In: Evans LV, editor. Biofilms: recent advances in their study and control. Amsterdam: Harwood Academic Publishers; pp. 19-34 Fletcher M (1988). Attachment of Pseudomonas fluorescens to glass and influence of electrolytes on bacterium substratum separation distance. J. Bacteriol. 170: 2027-2030 Ghigo JM (2001). Natural conjugative plasmids induce bacterial biofilm development. Nature. 412: 442-445 Hussain M, Wilcox MH and White PJ (1993). The slime of coagulase negative staphylococci: biochemistry and relation to adherence. FEMS Microbiol. Rev. 104: 191-208 Jenkinson HF and Lappin-Scott HM (2001). Biofilms adhere to stay. Trends Microbiol. 9: 9-10 Kumar A and Prasad R (2006). Biofilms. J. K. Sci. 8: 14-17

Microbial Biofilms

251

Leriche V, Sibille P and Carpentier B (2000). Use of an enzyme-linked lectinosorbent assay to monitor the shift in polysaccharide composition in bacterial biofilms. Appl. Environ. Microbial. 66: 1851-856 Loeb GI and Neihof RA (1975). Marine conditioning films. Advances in Chemistry. 145: 319335 Marsh PD (1995). Dental Plaque. In: Lappin-Scott HM, Costerton JW, editors. Microbial biofilms, Cambridge: Cambridge University Press. pp. 282-300 Marshall KC (1994). Microbial adhesion in biotechnological processes. Curr. Opin. Biotechnol. 5: 296-301 Mittelman MW (1996). Adhesion to biomaterials. In: Fletcher M, editor Bacterial adhesion: Molecular and Ecological Diversity, New York: Wiley- Liss, Inc. pp. 89-127 Moorthy S and Watnick PI (2004). Genetic evidence that the Vibrio cholera monolayer is a distinct stage in biofilm development. Mol. Microbiol. 52: 573-587 Ofek I and Doyle RJ (1994). Bacterial adhesion to cells and tissues. In: Ofek, I and Doyle RJ editors, New York: Chapman and Hall. Rijnaarts HH, Norde W, Bouwer EJ and Lyklema J (1993). Bacterial adhesion under static and dynamic conditions. Appl. Environ. Microbiol. 59: 3255-3265 Stewart PS and Costerton JW (2001). Antibiotic resistance of bacteria in biofilms. Lancet. 358: 135–138 Sutherland IW (2001). Biofilm oxopolysaccharides: a strong and sticky frame work. Microbiol. 147: 3-9 Zheng D, Taylor GA and Gyananath G (1994). Influence of laminar flow velocity and nutrient concentration on attachment of marine bacterio plankton. Biofouling 8: 107-20

CHAPTER 16 Metagenomics Dilip Singh Solanki, Surendra Kumar and Praveen Gehlot Department of Botany, Jai Narain Vyas University, Jodhpur-342001 India Corresponding author: [emailprotected]

INTRODUCTION The biodiversity on Earth is dominated by highly diverse microorganisms. The total number of prokaryotes on earth has been estimated to be approximately 46 X 1030. Out of it, only 1% microbial diversity have been assessed by studies of their cultivation (culture) and gene sequencing (often 16S rDNA gene) but 99% microbes are found in complex, interdependent communities is still uncultivable and therefore, still uncharacterized which donot represent a true picture of the genome of microbes species diversity (Rapper et al., 2003). Metagenomics is the ultimate tool to assess non-culturable microbial diversity. The term Metagenomics is derived from the statistical concept of meta- analysis (the process of statistically combining separate analyses) and genomics (the comprehensive analysis of an organism's genetic material), (Randon et al., 2000). Metagenomics is the analysis of DNA sequences of microorganisms recovered from an environment, without isolation and culture. It is also called as environmental genomics or ecogenomics or community genomics. In other words, it is the study of metagenomes, genetic material recovered directly from environmental samples. Pachter (2005) defined metagenomics as the application of modern genomics techniques to the study of communities of microbial organism directly in their natural environments, without isolation and cultivation of individual species. Metagenomics describes the functional and sequence based analysis of collective microbial genomes contained in an environmental samples. Handelsman et al. (1998) defined that sequence data taken directly from the environment denotes metagenome, and the study of these sequence data directly from environment encompasses metagenomics. The term Metadata refers to the temporal, spatial and physicochemical data associated with the sampling site from which organisms are derived for the metagenomic study. The purpose of making such metadata available to enable correlation of deciphered ecology with the environmental conditions that may favour one population structure over another. Metadata includes, Place, latitude, longitude, altitude date, time, soil type, depth, salinity, PH, light intensity, vegetation type etc. Metagenomic libraries are database of bacterial clones, usually E. coli carrying DNA fragments that originate from collective genomes of all the organisms present in the particular environment habitat and assemblage.

254

Microbes: In Action

Metagenomics approach is the assessing of non-culturabe bacterial diversity based on the isolation of DNA from environmental samples (metagenomics DNA), PCR amplification of 16S rDNA gene using universal bacterial primers, cloning of amplified products into a vector, sequencing and phylogenetic studies. It offers insights into the evolutionary history as well as previously unrecognized metabolism abilities of microbial communities specialized to live in a particular environmental niche. It is emerging as a powerful method to study the function and metabolism of the unexplored microbial biosphere, and it is basic foundation and principle to re-evaluate microbial ecology and evolution. Such studies also revealed that the vast majority of microbial biodiversity had been missed by cultivation based methods. In other words that metagenomics studies have greatly expanded our knowledge of what organisms occur in the wild and what collection of functions they possess, how do they contribute to our understanding of microbial community organization? Comparative analyses between metagenomes can provide additional insight into the function of complex microbial communities and their interaction (pathogenic/ mutualistic or plant growth promoting) and role in host health. Pairwise or multiple comparison between metagenomes can be made at the level of sequences composition (comparing GC content or genome size), taxonomic diversity, or functional complement. Comparisons of population structure and phylogenetic diversity can be made on the basis of 16S and other phylogenetic marker genes or in the case of low diversity communities by genome reconstruction from the metagenomic dataset. Functional comparisons between metagenomes may be made by comparing sequences against reference databases such as COG or KEGG and tabulating the abundance by category and evaluating any differences for statistical significance. The gene centric approach emphasizes the functional complement of the community as a whole rather than taxonomic groups, and show that the functional complements are analogous under similar environmental condition. AIMS OF METAGENOMICS 1. To reveal vast diversity of uncultured microbes. 2. Assessment of evolution history and their phylogeny using 16S rDNA gene. 3. Whole genome sequencing for comparative genomics and functional genomics. 4. Barcoding of uncultured wealth of microbes. 5. Examining signal transduction for community behavior of microbes. 6. Monitoring and predicting environmental conditions and change. 7. Examining metabolic pathway. A comprehensive understanding of this may lead to a directed approach towards designing culture media for the growth of previously uncultured microbes. 8. Examining bacteriophage or plasmid sequences. These potentially influence diversity and structure of microbial communities. 9. Investigate genes for desirable pharmaceutical and nutraceutical products. 10. Discovery of novel biocatalysts gene for industrial and medical applications.

Metagenomics

255

DEVELOPMENT OF METAGENOMICS In the 1980s, Norman Pace's lab introduced that microorganisms can be studied by the extraction of mixed microbial nucleic acid (DNA) from environmental samples and then analysis of the sequences (Olsen et al., 1986 and Pace, 1997). Ribosomal gene is use for analysis of for this study because rRNA gene (16S gene) are universally present in prokaryotic cellular life and allow every organism to be placed on a single phylogenetic tree (Pace, 1997). With such an approach, any organism, even uncultured and distantly related to culturable microbes could be put into phylogenetic context. Handelsman et al. (1998) coined the term "metagenome" to describe the collective genomes of soil microflora, and now "metagenome" is used to describe the collective genomes of any sample (usually microbial). Handelsman's lab and Delong's lab were among the first to examined large cloned fragments of genomic DNA extracted from nature with a purpose of linking organisms and functions. In contrast to metagenomics with large DNA fragments, random shotgun sequencing method is use for studies, where the DNA is fragmented into pieces a few thousand bases long, cloned and sequenced (form both ends), and assembled. Assembly is on the basis of overlapping identical sequences and the knowledge that the two ends of a single fragment are connected. Venter et. al. (2004) used shotgun assembly approach for the ocean survey, yielded many discoveries. One such assembled fragment pointed to the possibility that the marine archaea oxidize ammonia to nitrite, a key step in the worldwide nitrogen cycle, a function previously thought confined to terrestrial microbes. Metagenomics further explain that this unexpected archaeal function, with a fosmid based study in soils that showed an ammonia oxidation gene unambiguously connected to archaeal genes, and this functionally was confirmed by cultivation of an ammonia oxidizing archaeon, whose isolation was driven by metagenomics discoveries (Schleper et al., 2005 and Konneke et al., 2005). Now it recognized that such archaea, unknown until 1992, are main bacteria globally in the nitrogen cycle of waters and soils, with many implications for ecology and agriculture. Metagenomics can also be used complete genomes of uncultivated organisms and bioinformatics allow the whole genome to compare with many functional genes which further use for metabolic engendering. Initially, this was done from low diversity samples like acid mine drainage where only a few taxa dominated, making the job easier (Tyson, et al., 2004). Next generation sequencing of metagenomes which requires no cloning step, has now enabled such work in very complex environments like cow rumen, where 268 Gbp of DNA sequences were used to assemble 15 microbial genomes (Hess et al., 2011) and 58 Gbp of mate–paired short read sequences allowed assembly of several near complete genomes from uncultivated, relatively minor constituents of complex marine samples (Iverson et al., 2012). The first extensive large scale environmental sequencing project was carried out by the J. Craig Venter institute in 2004 in which they sequenced fragments of DNA derived from the entire microbial population of the nutrient limited Sargasso sea, an intensively studied region of the Atlantic ocean close to

256

Microbes: In Action

Bermuda (Venter et. al., 2004). A shotgun sequencing approach yielded over 1.6 billion base pairs of DNA and led to the discovery of 1.2 million new genes. A total of 794 061 of those genes were assigned to a conserved hypothetical protein group, the functions of which are unknown. A significant number of genes discovered from the phosphorous such as polyphosphates, phosphonates, pyrophosphates as well as other inorganic phosphorous (Riesenfeld et. al., 2004). Such an extensive sequencing project contributed greatly to the sequence richness of 16 S rRNA gene detabase, indeed special database (GenBank) provisions had to be made so that this metagenomic data would not overwhelm the ordinary monogenomic data already deposited in the databank, skewing subsequent comparative analysis (Galperin 2004). Tyson et. al., (2004) chose a much simpler community in acid mine drainage (AMD) in the Richmond mine at Iron Mountain, California one of the most extreme environments on earth. In this environment the microbiota exists as a pink biofilm that forms on the surface of the mine water. The biofilm has a pH of 0.83, a temperature of 43 °C and contains high concentrations of iron, zinc, copper and aspartate. The acid mine drainage microbiota was found to contain three bacterial and three archaeal species (Schloss and Handelsman 2005). The three dominant bacterial genera included Leptospirillum, sulfobacillus, Acidomicrobium and the dominant archaeal species was Ferraplasma acidomicrobium (Handelsman 2004). The simplicity of the community structure allowed to sequence almost entire microflora with a high degree of coverage (Tyson et. al. 2004). It was noted that the G + C content of the genomes of the dominant taxonomic groups differed to a large extent and thus provided a means to source each of the clones (Bond et. al., 2000). As demonstrated by the metagenomic study of the Sargasso Sea, increased complexity of the environment under study increase the complexity of metagenomic analysis (Venter et. al., 2004). Complex and diverse environment results in more genomic DNA and results in more DNA clones, therefore, creates the problems of assembly shotgun cloning. Microbial environments are compounded when even more diverse ecosystems are targeted by this approach (Kowalchuk et. al., 2007). This was clearly demonstrated by Tringle et. al. (2005) in their analysis of a soil metagenomic library. Soil born microorganisms are one of the earth's greatest sources of biodiversity (Curtis et. al., 2002), with estimates ranging between 3000 and 11,000 microbial genomes per gram of soil (Schmeisser et. al., 2007). Moreover, nearly 140 megabases of sequence taken from Minnesota farmland soil contained < 1% of sequences with any overlaps and formed no contigs (assemblies of overlapping individual clones), demonstrating that complete sequencing of highly diverse environments is virtually impossible with current technologies (Kowalchuk et. al., 2007). However, because of the huge diversity of soil and its history as a source of commercially important molecules in agriculture, chemical, industrial and pharmaceutical industries, it remains the most common target for studies of functional metagenomics (Mac Neil et. al., 2001; Courtois et. al., 2003; Daniel 2005). The marine environment has recently been pursued as a target of metagenomic studies (Li and Qin 2005; Pedros–Alio, 2006). It is the largest

Metagenomics

257

contiguous ecosystem on earth occupying 71% of the earth's surface with an average depth of 4 Km (Karl, 2007). The earth's oceans represent one of the most significant yet least understood microbial driven natural environments on the planet (Martin–Cuadrado et. al., 2007). Two large scale metagenomic analyses of deep sea communities have been carried out to date: the pacific gyre water column at the A long–term oligotrophic habitat Assessment station (ALOHA; 22 °4 5' N, 158 °00' W located 1ocated 100 Km north of Oahu, Hawaii), and more recently a single depth of 3000 m was sampled in the Ionion Sea located south–east of Sicily in the deep Mediterranean (Martin–Caudrado et al., 2007). A fosmid library was constructed from the 3000m deep Mediterranean plankton and analyzed by phylogenetic analysis of 16S rRNA genes and fosmid end sequencing. Sequence analysis revealed a high similarity with genomes from Rhizobiales within the alpha proteobacteria, Cenarchaem symbiorum, Planctomycetes, Acidobacteria, Chloroflexi and gamma proteobacteria (Martin–Cuadrado et. al., 2007). With the exclusion of the Crenarchaeoto, deep sea microbes assume a heterotrophic lifestyle, a presumption further verified by the detection of metabolic genes that function in the catabolism, transport and degradation of organic matter. A strongly similar community structure was found in the subtropical ALOHA water column of the Pacific. A considerable proportion of genes encoding dehydrogenases, including cox genes, involved in aerobic carbon monoxide oxidation have also been detected in the warm Mediterranean. Carbon monoxide dehydrogenase genes are more frequent in deep layers of the ALOHA water column, indicating that they play a significant role as an additional energy source in deep sea communities. Comparative studies of the Pacific gyre water column data and the deep Mediterranean Sea revealed that the bathypelagic (4000 m–deep) Mediterranean microbes correspond to the mesopelagic (500 – 700 m–deep) Pacific microbes, suggesting that (with disregard to light) temperature serves as a principal stratifying determinant of community structure (Martin – Cuadrado et. al., 2007). Several metagenomic studies have been carried out on the hindgut and midgut of the wood feeding 'higher' termite and the gypsy moth (Lymantrisexia dispar) respectively. Termites are widely known as economically important wood degrading organisms (Sugimoto et. al., 2000) with essential environmental roles in the turnover of carbon as well as serving as prospective sources of biochemical catalyst which can be used in the conversion of wood to biofuels (Warnecke et. al., 2007). Significant data have recently emerged which suggests that the symbiotic bacteria resident in the hindgut of the termite play a functional role in the hydrolysis of both cellulose and xylan (Tokuda and Watanabi 2007). In order to gain a greater appreciation of the diversity of biological mechanisms governing, lingocellulose degradation, metagenomic analysis of the microbiota of the hindgut paunch of a wood feeding 'higher' Nasutitermes (which do not contain hindgut flagellate protozoa) species was carried out in search of a large, complex set of bacterial genes commonly employed for cellulose and xylan hydrolysis (Warnecke et. al., 2007). The complete microbial community DNA of the paunch hindgut compartment was extracted, cloned and sequenced. Fifteen fosmids were chosen for further analysis after the initial end sequencing screen. A total of 1750 bacterial rRNA genes were amplified by PCR identifying a vast

258

Microbes: In Action

array of bacteria categorized into 12 phyla and 216 phylotypes. Following PCR, the genus Treponeme and the phylum Fibrobacters comprised the most frequently recovered phylotypes with Treponemes being the most dominant making up 68% of marker genes and Fibrobacters comprising 13% of recovered fragments. A conservative analysis based on global alignment techniques identified more than 100 gene modules analogous to catalytic domains of glycoside hydrolases. This study also illustrated other potentially important functions of the microbial population of the paunch hindgut of the 'higher' wood–feeding termite, such as hydrogen metabolism, carbon dioxide reductive acetogenesis and nitrogen fixation (Warnecke et. al., 2007). Microbial communities occupy all surfaces of the human body with a combined microbial cell population approximately 10 times that of human cells (Kurokawa et. al., 2007). The distal colon has been identified as the most densely populated natural bacterial ecosystem, encompassing more bacterial cells than all of our microbial communities combined (Marchesi and Shanahan 2007; Frank and Pace 2008). The total number of genes encoded by their collective genomes (the gut microbiome) surpasses that of the human genome by at least one order of magnitude (Backhed et. al., 2005). It comes as no surprise then that the human gastrointestinal microbiota is essential; bestowing metabolic functions that are otherwise absent in the host, such as improved strategies of energy harvest from ingested foods, synthesis of essential vitamins and the degradation of complex plant polysaccharides (Gill et. al., 2006; Kurokawa et. al., 2007). Indeed it is not uncommon for imbalances to occur in this intestinal microbial community structure with the potential for causing diseases such as Crohn's disease inflammatory bowel disease, allergy, obesity and cancer (Manichanh et. al., 2006; Kurokawa et. al., 2007). The first comprehensive mining effort of the human gut metagenome was undertaken by members of the Relman lab and The Institute for Genomic Research (TIGR) in 2005 in an effort to uncover the diversity within the gastrointestinal microflora, or to at least expand our understanding of it (Eckburg et. al., 2005). 13335 16S rRNA sequences (11831 bacterial sequences, 1524 archael sequences) from a single study of any environmental with the identification of 395 bacterial phylotypes and one archael phylotype (Eckburg et. al., 2005). The PCR amplified 16 S rDNA products were cloned and sequenced bi–directionally, revealing that the vast majority of the 395 bacterial phylotypes discovered are members of the Bacteriodetes (48%) and the Firmicutes (51%) with the remaining phylotypes being represented by proteobacteria, Verrucomicrobia, Fusbacteria, Cyanobacteria, Spirochetes and VadinBE9V. In an effort to identify genomic features common to all human gut microbiomes Kurokawa et. al., (2007) recently carried out a comparative metagenomic analysis of faecal samples from 13 healthy individuals of various ages, including unweaned infants. This study revealed that the gut microbiota from adults and children are diverse and exhibit high functional uniformity regardless of age. A total of 273 gene families were identified to be rich in adult– type microbiomes and 136 families in infant type microbiomes with a small overlap.

Metagenomics

259

HOW TO DO A METAGENOMICS PROJECT A model metagenomics project start with the isolation of genomic DNA from a mixed microbial population collected from any given environment (e.g., agricultural lands, forest areas, decomposing materials, sewage, dental plaque, termite gut, medical implant, electronic items etc). Isolated DNA is then subject to direct amplified with 16S gene for phylogenetic analysis. Isolated DNA may also be used for restriction digestion with restriction enzyme for DNA fragments that are used in construction of a DNA clone library. Clone libraries are either small or medium insert (2-15 kb insert size) libraries or large insert bacterial artificial chromosome (BAC) or fosmid libraries (upto 150 kb insert size), fragment may be sequenced directly after amplification with specific primers in either a random or targeted fashion. In a random sequencing approach, the clones are randomly chosen and sequences are assembled into larger contiguous pieces (contigs) by matching up overlapping sequences. The resulting data are contigs of different lengths as well as shorter unassembled fragments. The availability of completely sequenced reference genomes may assist in the assembly process for closely related genomes. In the absence of this, contigs may be assigned to various "bins" based on their G + C content, codon usage, sequence coverage, presence of short n– mers (nucleotide frequency), and other parameters, allowing them to be sorted into groups that can be viewed as a species. Coding sequences (CDSS, or colloquially genes) are then predicted from these sequence data using various methods. Often in the random sequencing approach, identified genes may not be attributable to a particular microbial species (i.e. there is no taxonomic or phylogenetic affiliation). In a targeted sequencing approach, clones are first screened for the presence of a desirable gene (e.g., by PCR amplification) or a gene function (by functional assay). Sequencing targeted large–insert clones in their entirely allows the possibility of recovering complete operons, e.g., those encoding metabolic pathways. A common approach is to target fosmids bearing phylogenetically informative genes such as 16S rRNA. In this method, known as phylogenetic anchoring, if a 16S rRNA gene is detected, the large fosmid insert is sequenced entirely, allowing us to assign the genomic DNA sequence to a specific phylotype. So, unlike random sequencing, this approach helps affiliate phylogeny (rRNA) with putative functional genes (predicted from flanking insert sequences). A classic example of this was the discovery of rhodopsin–like photoreceptor genes (light driven proton pumps for energy production) in Monterey Bay BAC clones harboring 16S rRNA genes (Beja et al., 2000). Where previously rhodopsins (and rhodopsin–based phototrophy) were thought to be exclusively archaeal in origin, metagenome data from phylogenetically anchored clones indicated that this functionally exists in marine gamma and alpha proteobacteria as well (Beja, et. al., 2000; Sabehi et. al., 2004; Sabedi, et. al., 2005). An obvious limitation of these approaches is that PCR primers or probes are designed based on consensus sequences of known genes. Random sequencing of clones on the other hand offers the potential to discover completely unknown genes or genes that are too different from currently known

260

Microbes: In Action

genes to be amplified by PCR or hybridize with probes. The optimal strategy may be to combine both random and targeted approaches. In this strategy, genes of interest i.e. 16S rDNA gene used for identify linking clones and expand genome coverage. Data is obtained in the form of numerous sequence fragments, and near complete genomes can be reassembled from overlapping sequence data, particularly for DNA samples from low complexity environments. Complete genome sequences are not always necessary for a meaningful understanding of microbial communities' metabolic pathway and interactions can still be pieced together from fragmentary data (Tringe, et. al., 2005). These types of studies also provide a surplus of novel genes and molecular structures that may have potential in development of novel biocatalysts for industrial and medical applications. Despite these methodologies, many genes may go unnoticed due to their unclonability in a heterologous or non–native host like Escherichia coli (most commonly used host for cloning libraries). Failure to produce clone representing these novel genes arises primarily due to their toxicity in E. coli. Basically, these genes may be too foreign and their expressed protein may causes failures in the operation of their host cell. Direct sequencing technologies can address this problem because it has eliminated the cloning step. TECHNIQUES OF METAGENOMICS STUDY Sample Collection The soil samples collect from diverse localities. Samples taken from humus layer of soil where most of the microbial activities take place and thus where most of the bacterial populations concentrated (10-15 cm depth). Soil samples collect by using clean, dry and sterile polythene bags along with sterile spatula. The site selection will be done by taking care of the point where widely varying characteristics as possible with regard to the organic matter, moisture content and particle size and color of soil and to avoid contaminations far as possible. Samples will be stored in ice boxes and transported to the laboratory where they keep in refrigerator at 4 oC until analysis. The site features viz., latitude, longitude, altitude, weather, vegetation and others will be recorded for each observation. DAPI Staining and FISH DAPI staining and FISH technologies are used for detection of cultivated and non- cultivated bacteria in soil samples. Dokic et al. (2010) used technique for metagenomic analysis of soil microbial communities are describing here. The soil samples fix in 4% paraformaldehyde in phosphate–buffered saline (PBS) for 3 hours at 4°C. The fix samples wash three times in PBS to remove excess fixative. The pellets first resuspended in 4, 6 diamidino–2–phenylindole (DAPI) solution and incubated for 5 minute. Excess DAPI remove by washing in PBS. The experiments carry out in duplicates. Subsequently one soil sample hybridized with rhodamine–labeled 16 S rRNA probe, EUB 338 (Lee et. al., 1999) and the other with rhodamine–labeled nonsense probe (NONEUB 338). Bacteria collect by membrane filtration of the samples through a 0.2 μm pore

Metagenomics

261

size Millipore polycarbonate filter. The cells transferred from the filters by placing them face down on to microscope slides containing a drop of sterile water. After being air dried for about 30 minute, the filters remove from the slides, and the slides treated with methanol: formalin solution (90: 10 vol/vol) for 15 minute, rinsed with distilled water, and air dried. Bacteria counted under a fluorescent microscope. The DAPI staining and FISH analysis are perform to monitor the size and metabolic activity of the microbial community. DAPI nonspecifically binds to DNA, thereby detecting living, dormant and dead bacteria. The metabolically active bacteria in the soil samples estimate using a rhodamine labeled universal probe for the domain bacteria (EUB 338). In order to compensate for the nonspecific staining, a nonsense probe (NONEUB 338) is use. As nonspecific staining may result from the binding of either the oligonucleotide or the flurochrome component of probe, correction is made by subtracting counts obtained by the non-specific nonsense probe from counts obtained by specific staining. Control experiments perform with excess unlabeled probe. FISH and DAPI staining results have shown that only 1 to 5% bacteria growing while the others are dormant in the form of spores or dead. The FISH analysis results can also compare with the traditional counting of colony forming unit (CFU) method. Extraction of Metagenomic DNA Extraction of metagenomic DNA requires specific protocols for each sample source. DNA extraction from soil sample is challenging due to presence of various contaminants like negatively and positively charged clay particles, inorganic ions, biochemical contaminants, such as humic acids, and DNAses etc. There are various robust methods as well as several commercial kits are available for extraction of high quality DNA from different environmental sources. The DNA extracted should be of high-quality and must represent all cells present in the sample. This high isolated DNA is used for subsequent library production and sequencing. In market, commercial kits are also available for the extraction and purification of soil metagenomic DNA (Rajendhran et al., 2008). Some kits are PowerMax™ (Mo Bio Laboratories Inc., Carlsbad, CA, USA), SoilMaster™ (Epicentre Biotechnologies, Madison, WI, USA), FastDNA® Spin kit for soil (MP Biomedicals, Solon, Oh, USA), UltraClean™ and PowerSoil™. WaterMasterTM DNA purification kit from (Epicentre Biotechnologies, Madison, WI, USA) use for isolates total DNA from water samples. Recently, FastRNA® Pro soil-direct kit (MP Biomedicals) and RNA PowerSoil™ (Mo Bio) are introduced for the isolation of soil metagenomic RNA. Gene Sequencing The characterization of microbial metagenome is done by selective amplification and sequencing of phylogenetic marker genes (e.g. 16S rRNA, rpoB, etc., in the case of prokaryotic) or Internal Transcribed Spacer (ITS) regions (for fungal species) Clarridge 2004, Santamaria et al., 2012). 16S rRNA gene and other marker gene can be easily amplified using standard sets of universal primers. This amplicon sequencing is limited function of taxonomy and phylogeny for the microbes for which taxonomically informative genetic markers are known.

262

Microbes: In Action

Novel or highly diverged microbes, especially viruses, are difficult to study using this approach. Also the novel gene and gene function of these microbes in not possible to determine. On the other hand characterization of this diversity can also be done by the whole genome sequencing using the shotgun sequencing based approach or through NGS technology (Tyson et al., 2004). Shotgun metagenomics is also used of sequencing nearly complete microbial genomes directly from the environment. Instead of targeting a specific genomic locus for amplification, all DNA is subsequently sheared into tiny fragments that are independently sequenced. Some of these sequenced fragments must have taxonomically informative genomic marker like 16S rRNA gene, while other sequenced DNA fragments having coding part of various genes which provide insight into the biological functions encoded in the genome. As a result, by this approach metagenomic data provides information about microbial diversity as well as their functional aspects. Over the past few years metagenomic shotgun sequencing has gradually shifted from classical Sanger sequencing technology to next-generation sequencing (NGS). The rapid and substantial cost reduction in next-generation sequencing has dramatically accelerated the development of sequence-based metagenomics. Sequence Pre–Filtration and Blast (Bioinformatics) The data generated by metagenomics experiments are both enormous and inherently noisy, containing fragmented data representing as many species. Therefore, the first step of metagenomic data analysis requires the execution of certain pre–filtering steps, including the removal of redundant, low quality sequences and sequences of probable eukaryotic origin. The methods available for the removal of contaminating eukaryotic genomic DNA sequences include Eu–Detect and DeConseq (Mohammed et al., 2011 and Schmeider and Edwards, 2011). Specific filter Amplified products are either cloned into the specific vector or direct sequences. The sequences are compared with those available at GenBank and Ribosomal Database Project (RDP) to determine their approximate phylogenetic affiliation (Cole et al., 2009). Species Diversity Gene annotations provide the measurement of species diversity. In order to connect community composition and function in metagenomes, sequences must be binned. Binning is the process of associating a particular sequence with an organism. In similarity based binning, methods such as BLAST are used to rapidly search for phylogenetic markers or otherwise similar sequences in existing public databases. This approach is implemented in MEGAN (Hudson et al., 2007). Another tool PhymmBL, uses interpolated Markov models to assign reads. MetaPhlAn is another method based on unique species – specific markers for estimating organism relative abundances with improved computational performances. In composition based binning, methods use intrinsic features of the sequence, such as oligonucleotide frequencies or codon usage bios (Wooley et al., 2010).

Metagenomics

263

Gene Prediction Metagenomic analysis pipelines use two approaches in the annotation of coding regions in the assembled contigs (Kuvin et al., 2008). The first approach is to identify genes based upon hom*ology with genes that are already publicly available in sequence databases, usually by simple BLAST searches. This method relies on comparing metagenomic sequences to a reference database of known sequences; it is not useful for identifying novel types of proteins. But, it can reveal diverged hom*ologs of known proteins. The second, ab initio, uses intrinsic features of the sequence to predict coding regions based upon gene training sets (e.g., length, codon usage, GC bias) from related organisms and does not rely on sequence similarity to a reference database. As a result, these methods can identify genes in the metagenome that share common properties with other microbial genes but that may be highly diverged from any gene that has been discovered to date (Sharpton, 2014). This is the approach taken by programs such as MetaGene (Noguchi et al., 2006), Glimmer-MG (Kelley et al., 2012), MetaGeneMark (Zhu et al., 2010), FragGeneScan (Rho et al., 2010), Orphelia (Hoff et al., 2009), and MetaGun (Liu et al., 2013). The main advantage of ab initio prediction is that it enables the detection of coding regions that lack hom*ologs in the sequence databases; however it is most accurate when there are large regions of contiguous genomic DNA available for comparison. Data Integration The massive amount of exponentially growing sequence data is a daunting challenge that is complicated by the complexity of the metadata associated with metagenomic projects. Metadata includes detailed information about the three dimensional (including depth, or height) geography and environmental features of the samples, physical data about the sample site, and the methodology of the sampling. This information is necessary both to ensure replicability and to enable downstream analysis. Because of its importance, metadata and collaborative data review and curation require standardized data formats located in specialized databases, such as the Genomes OnLine database (GOLD). Several tools have been developed to integrate metadata and sequence data, allowing downstream comparative analyses of different datasets using a number of ecological indices. Applications of Metagenomics Metagenomics has the potential to advance information in a wide diversity of fields. It can also be applied to solve practical challenges in agriculture, medicine, engineering, sustainability and ecology. (I) Agriculture The soils in which plants grow are inhabited by microbial communities, with one gram of soil containing around 109–1010 microbial cells which comprises about one gigabases of sequence information. The microbial communities which inhabit soils are some of the most complex. Known to science, and remain poorly understood despite their economic importance. Microbial consortia perform a wide variety of ecosystem services necessary for plant

264

Microbes: In Action

growth, including fixing atmospheric nitrogen, nutrient cycling, and disease suppression and sequester iron and other metals. Functional metagenomics strategies are being used to explore the interactions between plants and microbes through cultivation independent study of these microbial communities. Metagenomics studies also permit the role of uncultivated or rare community members in nutrient cycling and the promotion of plant growth. Metagenomic approaches can also contribute to improved disease detection in crops and livestock and the adaptation of enhanced farming practices which improve crop health by harnessing the relationship between microbes and plants. (II) Industries Metagenomics has the potential to substantially impact industrial production. It has led to the discovery of new enzymes and small molecules, such as antibiotics. Advancement in metagenomics during the last few years has led to the development of entirely new industries based on the use of metagenomics driven genes. Metagenomics has been very productive in the discovery of industrial important genes from soil. Applying metagenomics to surveying industrial important genes in soil is of particular interest because industrial important determinants are believed to be abundant in the environment where various compounds are produced. Many soil microorganisms are difficult to culture, and although some products is a growing health concern, little is known about its origins in the environment and even less is known about the role of the unculturable microorganisms as reservoirs of important genes. Industrial important genes are ideal candidate for metagenomic analysis because clonal carrying the genes can be readily detected in large libraries. The metagenomics helps in discovery of novel genes, entire metabolic pathways and potentially valuable end-products. (III) Biotechnology Microbial communities produce a vast array of biologically active chemicals that are used in competition and communication. Many of the drugs in use today were originally discovered in microbes. Recent progress in mining the rich genetic resource of non–culturable microbes has led to the discovery of new genes, enzymes, and natural products. The application of metagenomics has allowed the development of community and fine chemicals, agrochemicals, vitamins, steroids, proteins, enzymes and pharmaceuticals etc. for benefit of human kinds. (IV) Environmental Remediation Non culturable bacteria are good pollution fighters. They clean up the pollutants and toxic wastes produced by various industrial processes. They either turn these pollutants into energy source which they use themselves or produce enzymes that break down toxins into less harmful substances. It is need to improve strategies for monitoring the impact of pollutants on ecosystems and for cleaning up contaminated environments by using of Metagenomics. Some metagenomics derived genes are being used for cleanup pollutants from environments. Increased understanding of how microbial communities cope

Metagenomics

265

with pollutants improves assessments of the potential of contaminated sites to recover from pollution and increases the chances of bioaugmentation or biostimulation trials to succeed. (V) Ecology Metagenomics can provide valuable insights into the functional ecology of environmental communities. Metagenomic analysis of the bacterial consortia found in different ecosystem suggested that nutrient profile of soils of ecosystem is largely deplaned upon microbial communities. This is due to conversion of unusual complex organic compound into simple and inorganic compound into macro and micro nutrient form. (IV) Medicine Microbial communities play a key role in preserving human health, but their composition and the mechanism by which they do so remains mysterious. Metagenomic sequencing is being used to characterize the microbial communities from 15–18 body sites from at least 250 individuals. This is part of the human microbiome initiative with primary goals to determine if there is a core human microbiome, to understand the changes in the human microbiome that can be correlated with human health, and to develop new technological and bioinformatics tools to support those goals. Metagenomics are also source of many antibiotics. Turbomycin, one of the first antibiotics discovered by metagenomics, was identified by accident in a clone that had hemolytic activity as part of a basic study directed toward rationalizing the prevalence of hemolysins among cultured soil bacteria. (VII) Biofuel Metagenomic microbes produce a variety of sources of bioenergy including ethanol, methane and hydrogen. The conversion of plant residue cellulose into sugars and followed by the fermentation of the sugar into ethanol. In general practices, production of ethanol are complex metabolic pathways which controlled by large numbers of gene. Therefore Metagenomic approaches are being studied to analysis of microbial communities that targeted screening of genes and enzymes with higher productivity and lower cost industrial applications in biofuel production. Furthermore, metagenomics can also be studied on biogas production for future energy. METAGENOMICS CHALLENGES 1. Metagenomics is a rapidly increasing field with new challenges encounter at every instance, inefficiencies in sampling, DNA extraction methods, amplification, sequencing and constriction of libraries, data analysis. Sometimes, blast similarities can be assist by the availability of a existing reference genome that can serve as a blueprint for environmental genomic data together, such reference genome are presently only available for subset of cultured species, so, assembling genome of more divergent or novel species is not always facilitated. Establish standard metadata as Metagenomics consortium is still need some basic frame work for

266

Microbes: In Action

establishment of metagenome GenBank. 2. Metagenomics is requiring suitable, efficient, and cost effective approach to routinely assess microbial community organization. How consistently identity from tag sequences correlates to functionality. The phylogenetic resolution of the selected tag sequences also matters, and need widely collected shotgun data and curated database systems. 3. The advantage of metagenomic research are obvious, there are analysis of metagenomes, metatranscriptomes, metaproteomes and metametabolomes will be needed to sustain the microbial systems biology. The interdisciplinary analysis of complex biological system helps to understand new metabolites, human nutrition and health products and the emergence and management of antibiotics resistance. CONCLUSION Metagenomics is a new field of biology and is full of promise and uncertainty. The field of metagenomic gene discovery offers enormous scope and potential for both fundamental microbiology and biotechnological development. It is realized by international scientific fraternity that studies on metagenomics can help to gather information in the form of diversity of un- cultured bacteria, new genes, new enzymes, new proteins, new metabolic pathways etc. Although many advances in heterologous gene expression, library construction, vector design and screening will improve it, the current technology is sufficiently powerful to yield products for solving real world problems, including discovery of new antibiotics and enzymes. Approaches that enrich collection of metagenomic clones will enhance the power of metagenomic analysis to address targeted questions in microbial ecology and to discover new biotechnological applications. This has also resulted in the emergence of new fields like metatranscriptomics, metaproteomics and metablomics. New approaches and technological innovations are reported on a regular basis and many of the technical difficulties have yet to be fully resolved. ACKNOWLEDGEMENT The book chapter Metagenomics is written from other good review articles and source of good information during seminar presentation of Post Graduate degree course. Authors presented all the information in well defined topics in a brief without any claim of original thought. REFERENCES Backhed F, Ley RE, Sonnenburg JL, Peterson DA and Gordon JI (2005). Host-bacterial mutualism in the human intestine. Science. 307: 1915-1920 Beja O, Aravind L, Koonin EV, Suzuki MT, Hadd A, Nguyen LP, Jovanovich, Gates CM, Feldman RA, Spudich JL, Spudich EN and DeLong EF (2000). Bacterial rhodopsin: evidence for a new type of phototrophy in the sea. Science. 289: 6220-6223 Bond PL, Druschel GK and Banfield JF (2000). Comparison of acid mine drainage microbial communities in physically and geochemically distinct ecosystems. Applied and Clarridge JE III. Impact of 16S rRNA gene sequence analysis for identification of bacteria on clinical microbiology and infectious diseases. Clin. Microbiol. Rev. 2004: 17:840-862

Metagenomics

267

Clarridge JE (2004). Impact of 16S rRNA gene sequence analysis for identification of bacteria on clinical microbiology and infectious diseases. J. Clin. Microbiol. 17: 840-462 Cole JR, Wang Q, Cardenas EJ, Fish B, Chai FRJ, Kulam-Syed-Mohideen AS, McGarrell DM, Marsh T, Garrity GM and Tiedje JM (2009) The Ribosomal Database Project: improved alignments and new tools for rRNA analysis. Nucleic Acids Res. 37: D141–D145 Courtois S, Cappellano CM, Ball M, Francou FX and Normand P (2003) Recombinant environmental libraries provide access to microbial diversity for drug discovery from natural products. Appl. Environ. Microbiol. 69: 49-55 Curtis TP, Sloan NT and Scannell JN (2002). Estimating prokaryote diversity and its limits. Proc. Natl. Acad. Sci. USA. 99:10494-10499 Daniel R (2005). The metagenomics of soil. Nat. Rev. Microbiol. 3: 470-478 Dokic L, Savic M, Navancic T and Vasiljevic B (2010). Metagenomics analysis of soil microbial communities. Arch. Biol. Sci. 62: 559-564 Eckburg PB, Bik EM, Bernstein CN, Purdom E, Dethlefsen L, Sargent M, Gill SR, Nelson KE and Relman DA (2005). Diversity of the human intestinal microbial flora. Science. 308: 1635-1638 Frank DN and Pace NR (2008). Gastrointestinal microbiology enters the metagenomics era. Curr. Opin. Gastroenterol. 24: 4-10 Galperin MY (2004). Bacterial signal transduction network in a genomic perspective. Environmental Microbiology. 6:552-567 Gill SR, Pop M, DeBoy R, Eckburg PB, Taurnbaugh PJ, Samuel BS, Gordon JI, Relman DA, Fraser-Liggett CM and Nelson KE (2006). Metagenomic analysis of the human distal gut microbiome. Science. 312:1255-1359 Handelsman J, Rondon MR, Brady SF, Clardy J and Goodman RM (1998). molecular biological access to the chemistry of unknown soil microbes: A new frontier for natural products. Chemistry and Biology. 5: R245-249 Handelsman J (2004). Metagenomics: Application of genomics to uncultured microorganisms. Microbiol. Biol. Rev. 68: 669-685 Hess M, Sczyrba A, Egan R, Kim TW, Chokhawala H, Schroth G, Luo S, Clark DS, Chen F, Zhang T, Mackie RI, Pennacchio LA, Tringe SG, Visel A, Woyke T, Wang Z and Rubin EM (2011). Metagenomic discovery of biomass-degrading genes and genomes from cow rumen. Science. 331:463- 467 Hoff KJ, Lingner T, Meinicke P and Tech M (2009). Orphelia: predicting genes in metagenomic sequencing reads. Nucleic Acids Res. 37: 101-105 Hudson D, Auch A, Qi J and Schuster S (2007). MEGAN analysis of metagenomic data. Genome Res. 17:377-386 Iverson V, Morris RM, Frazer CD, Berthiaume CT, Morales RL and Armbrust EV (2012).Untangling Genomes from Metagenomes: Revealing an uncultured class of Marine Euryachaeota. Science. 335: 587-590 Karl DM (2007). Microbial oceanography: paradigms, processes and promise. Nat. Rev. Microbiol. 5: 759-769 Kelley DR, Liu B, Delcher AL, Pop M and Salzberg SL (2012). Gene prediction with glimmer for metagenomic sequences augmented by classification and clustering. Nucleic Acids Res. 40: e910 Konneke M, Bernhard AE, de la Torre JR, Walker CB, Waterbury JB and Stahl DA (2005). Isolation of an autotrophic ammonia- oxidizing marine archaeon. Nature. 437: 543-546 Kowalchuk GA, Speksnijder AGCL, Zhang K, Goodman RM and Veen JA (2007). Finding the needles in the metagenome haystack. Microb Ecol. 53: 475-485 Kurokawa K, Itoh T, Kuwahara T, Oshima K, Hoh H, Toyoda A, Takami H, Morita H, Sharma VK, Srivastava TP, Taylor TD, Noguchi H, Mori H, Ogura Y, Ehrlich DS, Itoh K, Takagi T, Sakaki Y, Ayaghi T and Hattori M (2007). Comparative metagenomics revealed commonly enriches gene sets in human gut microbiomes. DNA Res. 14: 169-181 Kuvin V, Copeland A, Lapidus A, Mavromatis K and Hugenholtz P (2008). A Bioinformatics guide to metagenomics. Microbiology and molecular Biology Reviews. 72: 557-578

268

Microbes: In Action

Lee N, Halkjaer P, Andreasen PH, Juretschko S, Nielsen JP, Schleifer KH and Wagner M (1999). Combination of fluorescent in situ hybridization and microautoradiography- a new tool for structure-function analyses in microbial ecology. Appl. Environ. Microbiol. 65: 1289-1297 Li X and Qin L (2005). Metagenomics-based drug discovery and marine microbial diversity. Trends Biotechnol. 23:539-543 Liu Y, Guo J, Hu G and Zhu H (2013). Gene prediction in metagenomic fragments based on the SVM algorithm. BMC Bioinformatics. 14(Suppl.): S12 MacNeil IA, Tiong CL, Minor C, August PR, Grossman TH, Loiacono KA, Lynch BA, Phillips T, Narula S, Sundaramoorthi R, Tyler A, Aldredge T, Long H, Gilman M, Holt D and Osburne MS (2001). Expression and isolation of antimicrobial small molecules from soil DNA libraries. J. Mol. Microbiol. Biotechnol. 3: 301-308 Manichanh C, Rigottier-Gois L, Bonnaud E, Gloux K, Pelletier E, Frangeul L, Nalin R and Jarrin C (2006). Reduced diversity of faecal microbiota in Crohn's disease revealed by a metagenomic approach. Gut. 55: 205-211 Marchesi J and Shanahan F (2007). The normal intestinal microbiota. Curr. Opin. Infect. Dis. 20: 508-513 Martin-Cuadrado AB, Lopez-Garcia P, Alba JC, Moreina D, Strittmatter A, Gottschalk G and Rodrıguez-Valera F (2007) Metagenomics of the deep editerranean, a warm Bathypelagic habitat. Microbiol. Mol. Biol. Rev. 6:669-85 Mohammed MH, Ghosh TS, Reddy RM, Reddy CV, Singh NK and Mande SS (2011). INDUS-a composition-based approach for rapid and accurate taxonomic classification of metagenomic sequences. BMC Genomics 12(S3): S4 Noguchi H, Park J and Takagi T (2006). MetaGene: prokaryotic gene finding from environmental genome shotgun sequences. Nucleic Acids Res. 34:5623-5630 Olsen GJ, Lane DL, Giovannoni SJ and Pace NR (1986). Microbial ecology and evoluction: A ribosomal RNA approach. Ann. Rev. Microbial. 40: 337-365 Pace NR, Stahl DA, Lane DL and Olsen GJ (1986). The analysis of natural microbial population by rRNA sequences. Adv. Microbiol. Ecol. 9:1-55 Pace NR (1997). A molecular view of microbial diversity and the biosphere. Science. 276: 734740 Pachter CK (2005). Bioinformatics for whole genome shotgun sequencing of microbial communities. PLoS Comput Biol. 1: 106-112 Pedros-Alio C (2006). Genomics and marine microbial ecology. Int. Microbiol. 9:191-197 Rajendhran J and Gunasekaran P (2008). Strategies for accessing soil metagenome for desired applications. Biotechnology Advances. 26: 576-590 Rapper MS and Giovannoni SJ (2003). The uncultured microbial majority. Annual Review of Microbiology. 57: 369-394 Rho M, Tang H and Ye Y (2010). Frag Gene Scan: predicting genes in short and error-prone reads. Nucleic Acids Res. 38:e191 Riesenfeld CS, Schloss PD and Handelsman J (2004). Metagenomics: genomic analysis of microbial communities. Annul. Rev. Gene. 38: 525-552 Rondon MR, August PR, Bettermann AD, Brady SF, Grossman TH, Liles MR, Loiacono KA, Lynch BA, MacNeil IA, Minor C, Tiong CL, Gilman M, Osburne MS, Clardy J, Handelsman J and Goodman RM (2000). Cloning the soil metagenome: a strategy for accessing the genetic and functional diversity of uncultured microorganisms. Appl. Environ. Microbiol. 66:2541-2547 Sabehi G, Bejj O, Suzuki MT, Preston CM and DeLong EF (2004). Different SAR86 subgroups harbour divergent proteorhodopsins. Environ. Microbiol. 6: 903-910 Sabehi G, Loy A, Jung K, Partha R, Spudich JL, Isaacson T, Hirschberg J, Wagner M and Beja O (2005). New insights into metabolic properties of marine bacteria encoding proterorhodopsins. PloS Biol. 3(8): e273 Santamaria M, Fosso B, Consiglio A, De Caro G, Grillo G, Licciulli F, Liuni S, Marzano M, Alonso-Alemany D, Valiente G and Pesole G (2012). Reference databases for taxonomic assignment in metagenomics. Brief Bioinform 13: 682-695

Metagenomics

269

Schelper C, Jurgens G and Jonscheit M (2005). Genomic studies of uncultivated archaea. Nature Reviews Microbiology. 3: 479-488 Schloss PD and Handelsman J (2005). Introducing DOTUR, a computer program for defining operational taxonomic units and estimating species richness. Appl. Environ. Microbiol. 71: 1501-1506 Schmeisser C, Steele H and Streit WR (2007). Metagenomics, biotechnology with nonculturable microbes. Appl. Microbiol Biotechnol. 75: 955-962 Schmieder R and Edwards R (2011). Fast Identification and Removal of Sequence Contamination from Genomic and Metagenomic Datasets. Science. 289:1902-1906 Sharpton TJ (2014). An introduction to the analysis of shotgun metagenomic data. Front. Plant Sci. 5:209. doi:10.3389/fpls.2014.00209 Sugimoto A, Bigneil DE and MacDonald JA (2000). Global impact of termites on the carbon cycle and atmospheric trace gases. In Termites: Evolution, Sociality, Symbiosis, Ecology. ed. Abe T, Bignell, DE and Higashi, M pp. 409-435. Dordrecht: Kluwer Academic. Tokuda G and Watanabe H (2007). Hidden cellulases in termites: revision of an old hypothesis. Biol. Lett. 3:336-339 Tringe SG, von Mering C, Kobayashi A, Salamov AA, Chen K, Chang HW, Podar M, Short JM, Mathur EJ, Detter JC, Bork P, Hugenholtz and Rubin EM (2005). Comparative metagenomics of microbial communities. Science. 308: 554-557 Tyson GW, Chapman J, Hugenholtz P, Allen EE, Ram RJ, Richardson PM, Solovyev VV, Rubin EM, Rokhsar DS and Banfield JF (2004). Community structure and metabolism through reconstruction of microbial genomes from the environment. Nature. 428: 37-43 Venter JC, Remington K, Heidelberg JF, Halpern AL, Rusch D, Eisen JA, Wu D, Paulsen I, Nelson KE, Nelson W, Fouts DE, Levy S, Knap AH, Lomas MW, Nealson K, White O, Peterson J, Hoffman J, Parsons R, Baden-Tillson H, Pfannkoch C, Rogers YH and Smith HO (2004). Environmental genome shotgun sequencing of the Sargasso Sea. Science. 304: 66-74 Warnecke F, Luginbuhl P, Ivanova N, Ghassemian M, Richardson TH, Stege JT, Cayouette M, McHardy AC, Djordjevic G, Aboushadi N, Sorek R, Tringe SG, Podar M, Martin HG, Kunin V, Dalevi D, Madejska J, Kirton E, Platt D, Szeto E, Salamov A, Barry K, Mikhailova N, Kyrpides NC, Matson EG, Ottesen EA, Zhang X, Hernández M, Murillo C, Acosta LG, Rigoutsos I, Tamayo G, Green BD, Chang C, Rubin EM, Mathur EJ, Robertson DE, Hugenholtz P and Leadbetter JR (2007). Metagenomic and functional analysis of hindgut microbiota of a wood-feeding higher termite. Nature. 450:560-565 Wooley JC and Friedberg AGI (2010). A Primer on Metagenomics. PLoS Comput Biol 6 (2) Zhu W, Lomsadze A and Borodovsky M (2010). Ab initio gene identification in metagenomic sequences. Nucleic Acids Res. 38:e132

CHAPTER 17 Progress and Recent Trends in Biofuels Ajay Kumar1, Joginder Singh1 and Chinnappan Baskar2 1

Department of Biotechnology, Lovely Professional University, Phagwara, Punjab, India. THDC Institute of Hydropower Engineering and Technology Tehri, Uttarakhand Technical University, Dehradun, Uttarakhand India. Corresponding author: [emailprotected]

INTRODUCTION The term biofuel is referred to as liquid or gaseous fuels for the transport sector that are predominantly produced from biomass. A variety of fuels can be produced from biomass resources including liquid fuels, such as ethanol, methanol, biodiesel, Fischer-Tropsch diesel, and gaseous fuels, such as hydrogen and methane (Demirbas, 2008).

FIG. 1: Extraction of the energy-containing molecules from plant biomass (source: Sanderson, 2011)

Advantages of biofuels are the following: (a) biofuels are easily available from common biomass sources, (b) they are representing a carbon dioxide-cycle in combustion, (c) biofuels have a considerable environmental friendly potential, (d) there are many benefits, towards the environment, economy and consumers in using biofuels, and (e) they are biodegradable and contribute to

272

Microbes: In Action

sustainability (Puppan, 2002). Nearly all plant matter compromises woody or straw like material, which contains sugars that are difficult to approach. Lot many approaches for release of these sugars has been investigated so that these energy-dense molecules can be changed into the fuels of the hereafter (Fig. 1). The production of 1st-generation liquid biofuels (produced primarily from food crops such as cereals, sugar crops and oil seeds) is well understood. The recently identified limitations of 1st-generation biofuels produced from food crops (with perhaps the exception of sugarcane ethanol) have caused greater emphasis to be placed on 2nd-generation biofuels produced from lignocellulosic feedstocks (Sims et al., 2010) as presented in Fig. 2.

FIG. 2: Schematic representation of biofuel production process (Bugg et al., 2011)

Typical biofuel production processes start with cellulose from plant matter. Using enzymes and chemical pretreatment processes, the cellulose is broken down into sugars like glucose or pentose. These sugars are then fed to microorganisms (such as Saccharomyces cerevisiae or Escherichia coli) that convert the sugar into biofuel (Dunlop et al., 2010). Global biofuel scenarios: Fuels represent around 70% of the total global energy requirements, particularly in transportation, manufacturing and domestic heating. Electricity only accounts at present for 30% of global energy consumption (Gouveia and Oliveira, 2009). Volatile energy costs and pressure to conserve fossil fuel resources have ignited efforts to produce biofuels and renewable commodity chemical compounds via microbial fermentation of biomass (Wargacki et al., 2012). The global economy literally runs on energy. An economic growth combined with a rising population has led to a steady increase in the global energy demands. If the governments around the world stick to current policies, the world will need almost 60% more energy in 2030 than today, of this 45% will be accounted by China and India together (Patil et al.,

Progress and Recent Trends in Biofuels

273

2008). About 95% of ethanol produced in the world is from agricultural products. Ethanol production from sugar crops such as sugarcane and sugar beet account for about 40% of the total bioethanol produced and nearly 60% corresponding to starch crops (Mussatto et al., 2010). Its market grew from less than a billion liters in 1975 to more than 39 billion liters in 2006, and is expected to reach 100 billion liters in 2015 (Licht, 2006). Nearly all fuel ethanol is produced by fermentation of corn glucose in the US or sucrose in Brazil (Lin and Tanaka, 2006). Table 1 shows the larger ethanol producer nations and the production volumes obtained in the year of 2008. TABLE 1: Worldwide ethanol production in 2008. Country

Production Mega liter

Millions of gallon

% of the total

34070 24500 1900 1000 900 568 340 317 256 250 200 150 100 94 90 627 65362

9000.0 6472.2 501.9 264.2 237.7 150.0 89.8 83.7 67.6 66.0 52.8 39.6 26.4 24.8 23.7 165.6 17266.8

52 37 3 2 1 1 1 100

United States Brazil China France Canada Germany Thailand Spain Colombia India Poland Hungary Australia Slovakia Paraguay Others Total Source: Biofuels Platform (2010)

World market for butanol is estimated 350 million gallons per year, of which 220 million gallon/year is the fraction consumed by USA. Butanol can be used instead of gasoline, even in a higher degree than ethanol due to its physical properties, economy, safety and because it can be applied without remodeling car engine (Shapovalov and Ashkinazi, 2008). Biodiesel is an alternative diesel fuel produced from a lipid feedstock and an alcohol. The current challenges of biodiesel production are its cost and limited availability of fat and oil resources. There are two aspects of the cost of biodiesel, the costs of raw material (fats and oils) and the cost of processing. The cost of raw materials accounts for 60– 75% of the total cost of biodiesel fuel (Bisen et al., 2010). BIOETHANOL Bioethanol (ethyl alcohol, grain alcohol, CH3–CH2–OH or EtOH) is a liquid biofuel has a higher octane number, broader flammability limits, higher flame

274

Microbes: In Action

speeds and higher heats of vaporization than gasoline. (Balat et al., 2008). Fermentation processes from any material that contains sugar could derive ethanol. Fuel ethanol can be produced from direct fermentation of simple sugars or polysaccharides like starch or cellulose that can be converted into sugars. Thus, carbohydrate sources can be classified into three main groups: (1) simple sugars: sugarcane, sugar beet, sorghum, whey, and molasses (2) starches: grains such as maize, wheat, root crops such as cassava, (3) lignocellulosic biomass: woody material, straws, agricultural waste, and crop residues (Mussatto et al., 2010). The most widely used sugar for ethanol fermentation is molasses which contains about 50 wt% of sugar and about 50 wt% of organic and inorganic compounds, including water (Lin and Tanaka, 2006). Fermentation of starch is somewhat more complex than fermentation of sugars because starch must first be converted into sugar and then into ethanol. Starch is first hydrolyzed by adding α-amylase to avoid gelatinization, then cooked at high temperature (140–180°C). Next, the liquefied starch is hydrolyzed to glucose with glucoamylase. The resulting dextrose is fermented to ethanol with the aid of microorganisms producing CO2 as a co-product. A summary of starch degrading enzymes is shown in Fig. 3 (Hsu et al., 1996). On the whole, several process parameters must be optimized: substrate concentration, enzyme to substrate ratio, dosage of the active components (α-glucosidase to glucanase ratio) in the enzymatic mixture, and yeast concentration. Microorganisms such as Zymomonas mobiliz and Escherichia coli, in addition to Saccharomyces cerevisiae, have been targeted through metabolic engineering for cellulosic ethanol production. Recently, engineered yeasts have been reported to efficiently ferment xylose and arabinose, as well as mixtures of xylose and arabinose (Kumar et al., 2009). Ethanol can be produced in two different ways, either by Direct Microbial Conversion (DMC) or by Simultaneous Saccharification and Fermentation (SSF) process (Singh et al., 2010). Ethanol production is usually performed in three steps: (1) obtainment of a solution of fermentable sugars, (2) fermentation of sugars into ethanol and (3) ethanol separation and purification, usually by distillation–rectification–dehydration (Demirbas, 2001).

FIG. 3: A summary of starch degrading enzymes

The first step in bioconversion of lignocellosics to bioethanol is size reduction and pre-treatment. It is required to alter the structure of cellulosic biomass to make more accessible to the enzymes that convert the carbohydrate

Progress and Recent Trends in Biofuels

275

polymers into fermentable sugars and to cellulose producing microorganisms. Pre-treatment can be carried out in different ways such as mechanical pretreatment, steam explosion, ammonia fiber explosion, supercritical CO2 treatment, alkali or acid pre-treatment, ozone pre-treatment and biological pretreatment (Balat et al., 2008). The sugars from the pre-treatment and enzymatic hydrolysis steps are fermented by bacteria, yeast or filamentous fungi, although the enzymatic hydrolysis and fermentation can also be performed in a combined step—so-called Simultaneous saccharification and fermentation (SSF) (HahnHagerdal et al., 2006). For Saccharomyces cultures SSF are typically controlled at pH 4.5 and 310K (Dien et al., 2003). Schematic diagram of the conversion of biomass feedstock to ethanol fuel is given in Fig. 4.

FIG. 4: Schematic diagram of the conversion of biomass feedstock to ethanol fuel

BIOBUTANOL There is an increasing interest in the production of chemicals and fuels from renewable resources due to the continuing price increase of fossil resources, the insecurity of the availability of fossil resources in the future, and additionally environmental concerns and legislations. Biobutanol may be produced by the acetone–butanol–ethanol (ABE) fermentation (García et al., 2011). Acetonebutanol-ethanol (ABE) fermentation is a process in which the carbohydrate substrate is converted to a mixture of solvents: acetone, butanol and ethanol, in the approximate ratio 3:6:1, at a total solvent concentration of around 20 g /l (Karakashev et al., 2007). The best-studied bacterium to perform a butanol fermentation is Clostridium acetobutylicum. Its genome has been sequenced, and the regulation of solvent formation is under intensive investigation. Clostridium beijerinckii is being explored as promising strain to produce biobutanol from cellulosic materials. Moreover, high biobutanol titer is being focused through genetic modifications of Clostridia and non-Clostridia organisms (e.g., Escherichia coli, Saccharomyces cerevisiae, Pseudomonas putida, and Bacillus subtilis) in both aerobic and anaerobic fermentation (Kumar and Gayen, 2011). During the exponential growth of C. acetobutylicum at pH values greater than about 5.6, the major fermentation products from glucose are acetate, butyrate, H2 and CO2. Accumulation of organic acids during batch fermentation is responsible for gradual growth inhibition. Solventogenesis requires the

276

Microbes: In Action

induction of a new set of enzymes catalyzing the formation of acetone, butanol and ethanol from glucose and reassimilated organic acids (Fig. 5). The shift to solventogenesis is induced by high intracellular concentrations of acids, low pH, presence of growth limiting factors (such as phosphate or sulfate depletion) and high concentrations of glucose and nitrogen compounds (Karakashev et al., 2007).

FIG. 5: Overall biochemical scheme of anaerobic breakdown of glucose to ethanol, acetone, butanol produced methabolic pathways.

Biodiesel Methyl esters synthesized from plant oil and methanol by the methanolysis reaction are potentially important as a biodiesel fuel (Kaieda et al., 2001). The lipase from Mucor miehei was most efficient for converting triglycerides to their alkyl esters with primary alcohols, whereas the lipase from Candida antarctica was most efficient for transesterifying triglycerides with secondary alcohols to give branched alkyl esters (Nelson et al., 1996). The lipases from Candida rugosa, Pseudomonas cepacia, and Pseudomonas fluorescens displayed particularly high catalytic ability. Transesterification reaction can be performed using triglycerides and short-chain alcohol by immobilized or free lipases (extracellular and the intracellular lipases) in non-aqueous conditions. The long-chain fatty acid ester, which is the product of this reaction, can be used as a diesel fuel that does not produce sulfur oxide and minimize the soot particulate (Iso et al., 2001). The nature of a lipolytic reaction catalyzed by lipases is complex as the lipid substrates are water-insoluble (Akoh et al., 2007). The need for some water to maintain and activate lipases and the immiscibility of lipids in water make the reaction media heterogeneous by forming a liquid–liquid interface. The interface activates the enzyme by adsorption, which aids the opening of the lid on the

Progress and Recent Trends in Biofuels

277

catalytic site (Akoh et al., 2007) In aqueous media, where enzymes are freely soluble, immobilization provides with a means to recover the biocatalyst by centrifugation or filtration (Bisen et al., 2010). A general procedure and steps involved in lipase catalyzed transesterification is represented in Fig. 6a–d (Ranganathan et al., 2008).

FIG. 6: (a) General reaction of enzyme-catalyzed transesterification process; (b) biodiesel production sequence by enzymatic reaction; (c) steps involved in the immobilization of extracellular enzyme; (d) steps involved in the immobilization of intracellular enzyme

CONCLUSION The production of 1st generation biofuels, mainly from traditional food crops, has increased rapidly over the past few years in response to concerns about energy supply security, rising oil prices and climate change. Due to an improved understanding of total GHG (greenhouse gas) emissions as a result of detailed life cycle analyses, and related direct and indirect land-use change issues, the perceived environmental benefits of 1st generation fuels have recently been brought into question (Sims et al., 2010). As a renewable resource, biomass represents a potentially inexhaustible supply of feedstock for biofuel production. Future increase in biomass production per unit land and fuel production per unit biomass could together result in a roughly ten-fold increase in land fuel yield compared with today, enabling scenarios in which biofuels play a large energy service supply role (Lynd et al., 2008). To achieve an optimal biological conversion of lignocellulosic biomass to biofuels, lignin must be physically removed from the plant tissue before saccharification (Weng et al., 2008). The

278

Microbes: In Action

inconsistency in the cost of enzymes for biofuel applications seriously hampers robust techno-economic analysis of biofuel production processes (Klein‐Marcuschamer et al., 2012). REFERENCES Akoh CC, Chang SW, Lee GC, and Shaw JF (2007). Enzymatic approach to biodiesel production. Journal of Agricultural and Food Chemistry. 55(22): 8995-9005 Balat M, Balat H and Oz C (2008). Progress in bioethanol processing. Progress in energy and combustion science. 34(5): 551-573 Bisen PS, Sanodiya BS, Thakur GS, Baghel RK and Prasad GBKS (2010). Biodiesel production with special emphasis on lipase-catalyzed transesterification. Biotechnology letters. 32(8): 1019-1030 Bugg TD, Ahmad M, Hardiman EM and Rahmanpour R (2011). Pathways for degradation of lignin in bacteria and fungi. Natural product reports. 28(12): 1883-1896 Demirbas A (2001). Biomass resource facilities and biomass conversion processing for fuels and chemicals. Energy conversion and Management. 42(11): 1357-1378 Demirbas A (2008). Biofuels sources, biofuel policy, biofuel economy and global biofuel projections. Energy conversion and management. 49(8): 2106-2116 Dien BS, Cotta MA and Jeffries TW (2003). Bacteria engineered for fuel ethanol production: current status. Applied microbiology and biotechnology. 63(3): 258-266 Dunlop MJ, Keasling JD and Mukhopadhyay A (2010). A model for improving microbial biofuel production using a synthetic feedback loop. Systems and synthetic biology. 4(2): 95-104 Garcia V, Pakkila J, Ojamo H, Muurinen E and Keiski RL (2011). Challenges in biobutanol production: How to improve the efficiency?. Renewable and sustainable energy reviews. 15(2): 964-980 Gouveia L and Oliveira AC (2009). Microalgae as a raw material for biofuels production. Journal of industrial microbiology and biotechnology. 36(2): 269-274 Hahn-Hagerdal B, Galbe M, Gorwa-Grauslund MF, Liden G and Zacchi G (2006). Bio-ethanol the fuel of tomorrow from the residues of today. Trends in biotechnology. 24(12): 549-556 Hsu TA, Himmel M, Schell D, Farmer J and Berggren M (1996). Design and initial operation of a high-solids, pilot-scale reactor for dilute-acid pretreatment of lignocellulosic biomass. In Seventeenth Symposium on Biotechnology for Fuels and Chemicals. Humana Press. pp. 3-18 Iso M, Chen B, Eguchi M, Kudo T and Shrestha S (2001). Production of biodiesel fuel from triglycerides and alcohol using immobilized lipase. Journal of Molecular Catalysis, B: Enzymtic. 16(1): 53-58 Kaieda M, Samukawa T, Kondo A and f*ckuda H (2001). Effect of methanol and water contents on production of biodiesel fuel from plant oil catalyzed by various lipases in a solvent-free system. Journal of Bioscience and Bioengineering. 91(1): 12-15 Karakashev D, Thomsen AB and Angelidaki I (2007). Anaerobic biotechnological approaches for production of liquid energy carriers from biomass. Biotechnology letters. 29(7): 10051012 Klein-Marcuschamer D, Oleskowicz-Popiel P, Simmons BA and Blanch HW (2012). The challenge of enzyme cost in the production of lignocellulosic biofuels. Biotechnology and bioengineering. 109(4): 1083-1087 Kumar M and Gayen K (2011). Developments in biobutanol production: new insights. Applied Energy. 88(6): 1999-2012 Kumar P, Barrett DM, Delwiche MJ and Stroeve P (2009). Methods for pretreatment of lignocellulosic biomass for efficient hydrolysis and biofuel production. Industrial and Engineering Chemistry Research. 48(8): 3713-3729 Licht FO (2006). World ethanol markets: the outlook to 2015. Tunbridge Wells, Agra Europe special report, UK.

Progress and Recent Trends in Biofuels

279

Lin Y and Tanaka S (2006). Ethanol fermentation from biomass resources: current state and prospects. Applied microbiology and biotechnology. 69(6): 627-642 Lynd LR, Laser MS, Bransby D, Dale BE, Davison B, Hamilton R, Himmel M, Keller M, McMillan JD, Sheehan J and Wyman CE (2008). How biotech can transform biofuels. Nature biotechnology. 26(2): 169-172 Mussatto SI, Dragone G, Guimaraes PM, Silva JPA, Carneiro LM, Roberto IC, Vicente A, Domingues L and Teixeira JA (2010). Technological trends, global market, and challenges of bio-ethanol production. Biotechnology advances. 28(6): 817-830 Nelson LA, Foglia TA and Marmer WN (1996). Lipase-catalyzed production of biodiesel. Journal of the American Oil Chemists Society. 73(9): 1191-1195 Patil V, Tran KQ and Giselrod HR (2008). Towards sustainable production of biofuels from microalgae. International journal of molecular sciences. 9(7): 1188-1195 Puppan D (2002). Environmental evaluation of biofuels. Social and Management Sciences. 10(1): 95-116 Ranganathan SV, Narasimhan SL and Muthukumar K (2008). An overview of enzymatic production of biodiesel. Bioresource Technology. 99(10): 3975-3981 Sanderson K (2011). Lignocellulose: a chewy problem. Nature. 474(7352): S12-S14 Shapovalov OI and Ashkinazi LA (2008). Biobutanol: Biofuel of second generation. Russian Journal of Applied Chemistry. 81(12): 2232-2236 Sims RE, Mabee W, Saddler JN and Taylor M (2010). An overview of second generation biofuel technologies. Bioresource technology. 101(6): 1570-1580 Singh A, Pant D, Korres NE, Nizami AS, Prasad S and Murphy JD (2010). Key issues in life cycle assessment of ethanol production from lignocellulosic biomass: challenges and perspectives. Bioresource Technology. 101(13): 5003-5012 Wargacki AJ, Leonard E, Win MN, Regitsky DD, Santos CNS, Kim PB, Cooper SR, Raisner RM, Herman A, Sivitz AB, Lakshmanaswamy A, Kashiyama Y, Baker D and Yoshikuni Y (2012). An engineered microbial platform for direct biofuel production from brown macroalgae. Science. 335(6066): 308-313 Weng JK, Li X, Bonawitz ND and Chapple C (2008). Emerging strategies of lignin engineering and degradation for cellulosic biofuel production. Current opinion in biotechnology. 19(2): 166-172

CHAPTER 18 Application of Enzymes in Food Processing Gautam Kumar Meghwanshi and Abhishek Vashishtha Department of Microbiology, Maharaja Ganga Singh University, Bikaner -334004 India Corresponding author: [emailprotected]

INTRODUCTION Enzymes are used in the production of many processed food products such as alcoholic and non alcoholic beverages; bakery, confectionary, cereal, dairy, meat and fish products; fruit and vegetable juices and syrups etc. (Fernandes, 2010; Meghwanshi and Vashishtha, 2012). The application of enzymes in food industries have advantages of eliminating the use of high temperatures, extremes of pH, and organic solvents while at the same time offers high reaction specificity, product purity and reduced environmental hazard (Meghwanshi and Vashishtha, 2012). The growing applications of different enzymes in food processing are dependent on constant innovation to improve product quality in terms of appearance, palatability, nutritive and health benefits as well as to reduce the cost. This innovation is driven by a rapidly increasing database of natural enzyme diversity, application of recombinant DNA and fermentation technologies that allow the production of food processing enzymes at low cost, and protein modification tools that enable enzymes' versatility and applicability to various food processing methods (Fernandes, 2010). Applications of enzymes in food processing have been in practice from the ancient times. However, earlier human beings were unaware about the role of enzymes in food processing. But, they were using microbial fermentations (may be unknowingly) to produces various food products, such as cheese, sourdough, beer, wine, pickled foods, vinegar and many other products (Copeland, 2000). The production of these processed foods relied on either enzymes produced by naturally growing microorganisms in them or enzymes preparations added to foods, such as those obtained from calves' rumen or papaya fruit (Kirk et al., 2002). In 1783, for the first time role of gastric enzymes in digestion of meat was demonstrated by Spallanzani, (Demain, 2010). In 1897 enzymatic activity of yeast extract was demonstrated to carry out alcoholic fermentation under in situ conditions by Buchner (Demain, 2010). In the late 19th century use of rennet (a mixture of chymosin and pepsin) for cheese production was reported by Christian Hansen and production of bacterial amylases was initiated at Takamine (later become part of Genencor). Pectinases were used for clarification of juices in the 1930s, and during World War II immobilized invertase was

282

Microbes: In Action

exploited for the production of invert sugar syrup (Vasic-Racki, 2006). Large-scale application of enzymes became commonplace in 1960s, when the conventional use of acid hydrolysis method for starch breakdown was replaced by the enzymatic hydrolysis using a co*cktail of amylases and amyloglucosidases (glucoamylases), and later included glucose (xylose) isomerase also (Vasic-Racki, 2006; Poulsen and Buchholz, 2003; Fernandes, 2010; Leisola, 2002). Thereafter, due to ease of handling and many advantages associated with enzyme based food processing methods, they gradually substituted the traditional non-enzymatic methods of food processing. Enzymes are currently among the well established products in biotechnology (Norus, 2006). The global market for industrial enzymes is estimated to be around $3.3 billion in 2010 and is expected to reach $4.4 billion by 2015, a compound annual growth rate (CAGR) of 6% over the 5-year forecast period. The food and beverage enzymes segment is expected to reach about $1.3 billion by 2015, from a value of $975 million in 2010, rising at a compound annual growth rate (CAGR) of 5.1%. Within the food and beverage enzymes segment, the milk and dairy market had the highest sales, with $401.8 million in 2009 (http://www.bccresearch.com/market-research/biotechnology/enzymesindustrial-applications-bio030f.html). Many companies are involved in enzyme manufacture worldwide, but major players are located in Europe, USA and Japan. Denmark is dominating the world enzyme market, with Novozymes (45%) and Danisco (17%), whereas DSM (The Netherlands) and BASF (Germany) are lagging behind, with 5% and 4% (Binod et al., 2008; Berka and Cherry, 2006; Ogawa and Shimizu, 2002). The pace of development in emerging markets suggests that companies from India and China can join this restricted party in a very near future (Chandel et al., 2007; Carrez and Soetaert, 2005; http://www.researchandmarkets.com/reportinfo.asp?cat id=0 and report id=1202421 and q=future%20of%20enzymes and p=1). PRODUCTION OF ENZYMES The development of fermentation processes during the later part of the 19th century, aimed specifically at the production of enzymes, have made it possible to manufacture enzymes as purified, well-characterized preparations even on a large scale. This development allowed the introduction of enzymes into true industrial processes and products, for instance, in the detergent, textile and starch industries. The use of recombinant gene technology has improved manufacturing processes further and enabled the commercialization of enzymes that could not be produced, previously. Furthermore, the latest developments within modern biotechnology, introducing protein engineering and directed evolution, have revolutionized the production and improvement of industrial enzymes (Fig. 1). These advances have made it possible to provide tailor-made enzymes displaying new activities and adapted to new process conditions, enabling a further expansion of their industrial use. As result a variety of enzymes are produced currently from different microorganisms as shown in Table 1.

Application of Enzymes in Food Processing

283

FIG.1: Current process for the production of microbial or recombinant enzymes TABLE 1: Some commercial enzymes and source microorganisms Enzyme

Source Microorganism

Fungal Amylases Fungal Glucosidases Fungal Proteases Fungal Pectinases Fungal Cellulase Fungal Lipase Bacterial Amylases Bacterial Proteases Bacterial Lipase Bacterial Cellulase Yeast Invertase Yeast Lactase Yeast lipase

Aspergillus oryzae, A. niger Aspergillus flavus, Trichoderma sp., Penicillium sp. Aspergillus niger, A. oryzae Aspergillus niger, Fusarium sp. Aspergillus niger, Trichoderma reesei, Fusarium solani Aspergillus niger, A. terreus, A. carneus Bacillus subtilis, B. amylolequefaciens, B. licheniformis Bacillus subtilis, Pseudomonas spp. Bacillus spp., Pseudomonas spp. Cellulomonas sp., Cytophaga sp., Bacillus pumilus Saccharomyces cerevisiae Saccharomyces fragilis Candida antarctica, C. rugosa, Hensenula sp.

APPLICATIONS Uses of enzymes in food processing industries are numerous and are increasing

284

Microbes: In Action

rapidly (Saxena et al., 1999; Buchholz et al., 2005; Saxena et al., 2005; Fernandes, 2010; Zhang and Kim, 2010; Trincone, 2011; Meghwanshi and Vashishtha, 2012). The more important current uses are listed in Table 2. Most of the industrially important microbial enzymes are hydrolases, which catalyze the hydrolysis of natural organic compounds. TABLE 2: Applications of enzymes in food processing Industry

Application

Enzyme

Source

Baking and milling

Bread baking

Beer

Mashing Chillproofing

Amylase Protease Amylase Protease

Wine

Pressing, clarification, filtration Precooked baby foods Breakfast foods Condiments

Fungal, malt Fungal Malt, bacterial Papain, bromelain, pepsin, fungal, bacterial Fungal

Cereals

Chocolate, cocoa Coffee

Tea Confectionery, candy

Syrups Coffee bean fermentation Coffee concentrates

Soft center candies and fondants Sugar recovery from scrap candy Dairy Cheese production Milk, prevention of oxidation flavor Milk, protein hydrolyzates Evaporated milk, stabilization Whole milk concentrates Ice cream and frozen desserts Whey concentrates Distilled beverages Mashing Flavors Removal of starch, clarification Fruits and fruit Clarification, filtration, juices concentration Low methoxyl pectin Starch removal from pectin

Pectinases Amylase Amylase Protease Amylase Pectinase Pectinase, hemicellulase

Malt, fungal Malt, fungal Papain, bromelain, pepsin, fungal, bacterial Fungal, bacterial Fungal Fungal

Invertase

Yeast

Amylase

Bacterial, fungal

Rennin Protease

Animal Pancreatin

Protease

Lactase Lactase

Papain, bromelain, pancreatin fungal, bacterial Pancreatin, pepsin, bromelain, fungal Yeast Yeast

Lactase Amylase Amylase

Yeast Malt, fungal, bacterial Fungal

Pectinases

Fungal

Pectinesterase Amylase

Fungal Fungal

Protease

Application of Enzymes in Food Processing

285

Industry

Application

Enzyme

Source

Vegetables

Liquefying purees and soups Meat tenderizing Tenderizing casings Condensed fish soluble Corn syrup Production of glucose

Amylase

Fungal

Protease Protease Protease Amylase, dextrinase Amylase, amyloglucosidase

Papain, bromelain, fungal Papain, bromelain, fungal Papain, bromelain, fungal Fungal Fungal

Meat, fish

Starch and syrup

ENZYMES IN STARCH PROCESSING In the early 19th century, it was found that starch could be converted into glucose when it was boiled in acid (http://www.mapsenzymes.com/Enzymes_Starch.asp). Since then acids have been used widely for breaking down starch into glucose. However, this technique does have a number of disadvantages e.g., lots of acid which is used in this process needed neutralization, again using lots of alkali for the neutralization process. Furthermore, it could cause caramelization of sugar, resulting in wastage of product (http://www.mapsenzymes.com/Enzymes_Starch.asp). Enzymatic starch hydrolysis operates under mild reaction conditions with no use of acids and extremely high temperature (Meghwanshi and Vashishtha, 2012). With the advent of enzymatic starch processing these problems have been solved. In the last 25 years, as new and efficient enzymes are available, starch hydrolysis technology has moved away from acids to enzymes. Enzymatic starch conversion to syrups, depending on the enzymes used, produces syrups with different compositions and physical properties. There are three basic steps in enzymatic starch conversion: liquefaction, saccharification and isomerization. Starch Liquefaction First step is the liquefaction process. A 30-40% (w/v) starch suspension is first gelatinized and liquefied. A heat-stable bacterial α-amylase is then used to convert starch to maltodextrin containing mainly different oligosaccharides and dextrins. Maltodextrins have slight sweetness and they usually undergo further conversion. In most starch conversion plants, starch liquefaction is carried out in a jet-cooking process. After adjusting the pH of the starch slurry, bacterial heat stable α-amylase is added to it, and the slurry is pumped through a jet cooker. By injecting the steam into the jet cooker the temperature inside is raised to 105°C, and the slurry is then passed through a series of holding tubes for 5-7 minutes, which is necessary to gelatinise the starch completely. The temperature of the partially liquefied starch is then reduced to 90-100°C by flashing, and the enzyme is allowed to further react with substrate at this temperature for 1-2 hours until the required DE (Dextrose Equivalent) is obtained. The DE (dextrose equivalent) value is used as an indication of the degree of hydrolysis of syrup. The DE value of starch is zero and that of dextrose is 100. Bacterial amylases generally remain active at considerably higher temperature (~110 ˚C) than do

286

Microbes: In Action

fungal amylases, and at elevated temperatures give rapid liquefaction of starch (Crueger and Crueger, 1990). Starch Saccharification Saccharification is the second step in the process. Depending on the desired end product, a glucoamylase or a fungal α-amylase is used for further break down of Maltodextrins (Kumar and Satyanarayana 2009). The glucoamylase can hydrolyze starch completely to glucose along with, a little maltose and isomaltose (Kumar and Satyanarayana 2009). Another enzyme pullulanase produced by many bacteria is used for starch-debranching and aid in saccharification process (Nair et al., 2006; Asha et al., 2013; http://www.sigmaaldrich.com). Fungal α-amylases can also be added in order to produce syrups with a higher maltose content, which means high fermentability and a relatively high degree of sweetness (de Souza, et al., 2010). Fungal amylases have relatively low stability at high temperatures but act rapidly at lower temperatures (~ 55 ˚C) and produce good saccharification (Crueger and Crueger, 1990). Another significant use for fungal amylases is in conversion of partially acid hydrolyzed starch to sweet syrups (Souza, et al., 2010). Acid hydrolysis is a random action whereas enzymatic hydrolysis is a patterned one. By proper control of the type and proportion of enzymes used (α-amylase, amyloglucosidase, maltase) syrups of almost any desired proportions of glucose, maltose, and dextrins may be produced (Dale and Langlois, 1940; Langlois, 1953). Isomerisation Further going one step ahead, a proportion of the glucose can be isomerised into fructose, which is about twice as sweet as glucose. An immobilized glucose isomerase is used. Glucose isomerase (D-glucose ketoisomerase) causes the isomerization of glucose to fructose (Converti and Borghi, 1998). Glucose has 70-75% the sweetening strength of beet sugar (sucrose), but fructose is twice as sweet as sucrose (http://www.rpi.edu/dept/chem-eng/BiotechEnviron/IMMOB/poppezz/hfcs.html). Thus, processes for the manufacture of fructose are of considerable value. Novo Industries has developed glucose isomerase from B. coagulans for commercial use (http://www.rpi.edu/dept/chem-eng/BiotechEnviron/IMMOB/poppezz/hfcs.html). In this immobilized enzyme process, the microorganism carries out a direct isomerization of the glucose. This glucose isomerase is primarily a xylose isomerase, so xylose, or a xylose-containing compound must be added for the induction of the enzyme (http://www.rpi.edu/dept/chem-eng/BiotechEnviron/IMMOB/poppezz/hfcs_proc.html). Enzymes in Baking and Milling Currently enzymes are playing a pivotal role in baking industries. In many improved baking formulations enzymes are acting as agents for product improvement and innovation. Enzymatic baking is becoming more and more

Application of Enzymes in Food Processing

287

important as consumers are demanding more natural products free of chemical additives. For example, enzymes may serve as better and safer substitute for potassium bromate (as a flour improver), a chemical additive that has been banned in a number of countries (http://www.biokemi.org/biozoom/issues/516/articles/2309). Amylases find extensive use in baking. The main component of wheat flour used to make dough is starch, which can be degraded by amylase to produce small dextrins, which by the further action of yeast can be converted into alcohol and carbon dioxide, making the dough to rise (http://www.lallemand.com/BakerYeastNA/eng/PDFs/LBU%20PDF%20FILES/1 _14ENZYPDF). There is also a special type of amylase that modifies starch during baking to give a significant anti-staling effect (Morgan et al., 2006) Use of fungal amylase for supplementing the diastatic activity of flour is a common practice. The fungal amylase has low inactivation temperature, permitting its uses in high amount in baking. This improves sugar production, gas formation and crust color, without danger of excessive dextrinization of the starch during baking (Peppler and Reed, 1987). Gluten is a protein composite present in wheat and related grains, including barley and rye. Gluten gives elasticity to dough, helping it to rise and keep its shape and often gives the final product a chewy texture (http://en.wikipedia.org/wiki/Gluten). Gluten forms a large network during dough formation. This network holds the gas inside the dough during its proofing and baking. The strength of this gluten network is therefore extremely important for the quality of all bread raised using yeast. Enzymes like hemicellulases, xylanases, lipases and oxidases can directly or indirectly improve the strength of the gluten network and so improve the quality of the finished bread (http://www.biokemi.org/biozoom/issues/516/articles/2309). Proteases find considerable application in baking bread and crackers (Godfrey and West, 1996; Gupta et al., 2002; Norus, 2006; Binod et al., 2008). The proper quantity of protease action reduces mixing time and increases extensibility of doughs, and improves grainy texture, and loaf volume. However, excess of protease must be avoided, and the time for enzyme action and quantity of enzyme used must be carefully controlled by the baker or sticky, unmanageable doughs would result. Bacterial maltogenic α-amylases find use in hydrolysis of starch at high temperature and it is responsible for the production of anti-staling bread. Bread produced has a far softer and more elastic crumb than produced by conventional method (Meghwanshi and Vashishtha, 2012). Hemicellulase, pentosanase or xylanase have also been used in baking. They hydrolyze pentoses of malt, barley and wheat and improve dough machinability yielding a more flexible, easier-tohandle dough (Butt et al., 2008). They also increase loaf volume and improved crumb (Butt et al., 2008). Lipases are other enzymes which play a considerable role in baking. They hydrolyze dough lipids, stabilize the dough, produce a larger loaf volume, and significantly improved crumb structure (the crumb texture is silkier and the crumb colour appears to be whiter), reduces the need for addition of emulsifiers like DATEM (diacetyl tartaric acid esters of

288

Microbes: In Action

monoglycerides) and SSL (sodium stearoyl lactylate) (http:// www. biokemi. org/ biozoom/ issues/ 516/ articles/ 2309). Yet another enzyme asparaginase plays an important role in baking. It reduces the formation of acrylamide in food products by 90 % by converting asparagine to aspartic acid (http://www.biokemi.org/biozoom/issues/516/articles/2309). Enzymes in Beer Industry Beer brewing, one of the oldest industries is also benefiting from new industrial processes based on enzymatic processing. Traditional brewing process comprised an important step namely malting in which enzymes needed for the breakdown of grain starch into fermentable sugars are produced in the germinating barley or other grains used, like wheat and sorghum. However, the malt enzymes do have certain limitations. They can have narrow temperatures and pH tolerance not suitable for optimal starch hydrolysis, and low activities to do the desired work in proper time. In contrast, commercial enzymes supplements have been prepared to work optimally at process temperature and pH, having more enzymatic power, or expressing the enzyme activities that are not present in malt (http://www.biokemi.org/biozoom/issues/522/articles/2368). Addition of enzyme supplements at various steps during the brewing process makes brewing simpler, rapid and more consistent (http://www.danisco.com/foodbeverages/beverages/how-brewing-enzymes-improve-the-beer-production/). It provides the brew-masters with a free hand in selecting the ingredients like maize, rice, wheat, sorghum or barley due to less dependence on malt enzymes, as well as gives prospects for new products, which otherwise are not possible to make using malt enzymes alone (http://www.megazyme.com/select-anindustry/malting-brewing-and-juice-manufacture). It is also possible to improve the beer quality by using commercial enzymes, as these can alleviate the offflavours (http://www.biokemi.org/biozoom/issues/522/articles/2368). Various steps of beer manufacture utilize different enzymes. Two enzymes are used in decoction vessel. First enzyme is α-amylase which carries out hydrolysis (liquefaction) of starch present in adjunct and reduces its viscosity. Bacterial amylases having high temperature stability are required in the brewing industry to supplement low diastatic malt, and especially for initial liquefaction of adjuncts such as rice and corn grits (Kennedy et al., 1988). On the other side, fungal amylase is used as a saccharifying agent for grain alcohol fermentation mashes (Hanson et al., 1955; Revedin et al., 2010). It has been established that use of fungal amylases results in better alcohol yields than with malt conversion (Roberts et al., 1944; Hanson et al., 1955; Revedin et al., 2010). β-glucanase is the second enzyme used in decoction vessel for catalyzing the hydrolysis of glucans and aid in filtration process. The mashing step is heavily dependent of the activity of different enzymes. It utilizes α-amylase for hydrolysis of starch to improve the quality of malt. Amyloglucosidase is also used in mashing as it helps in increasing the glucose content, the main fermentable sugar, thereby increasing the fermentable sugar in "light" beer. Debranching enzyme have important application in beer manufacture as it hydrolyzes α-1,6 branch points of starch ensuring maximum fermentability of the wort. Proteases increase soluble protein, and free amino- nitrogen (FAN), that results in improved yeast

Application of Enzymes in Food Processing

289

growth. β-glucanase hydrolyzes glucans and improves wort separation. Pentosanase/xylanase are also used in brewing for hydrolysis of pentosans of malt, barley, and wheat to improve extraction and filtration of beer. In fermentation step fungal α-amylase are used to increase maltose and glucose content, thereby augment the percentage of fermentable sugar in "light" beer. βglucanase is the other enzyme which assist in fermentation process by hydrolyzing glucans and consequently reduce the viscosity and aid filtration. Another important enzyme specific for fermentation process is α-acetolactatedecarboxylase (ALDC). It converts α-acetolactate to acetoin directly, and decrease fermentation time by avoiding formation of diacetyl. Protease are used in conditioning tank for modifying protein-polyphenolic compounds which helps reduce the chill haze formation in beer (http://www.biokemi.org/biozoom/issues/522/articles/2368). Enzymes in Cereal Processing Enzymes can be used for the processing of wholegrain- or bran-enriched wheat products as well as other cereals like rye, oats, and barley. Enzymatic processing of cereal foods can improve their sensory and nutritional quality as well as digestibility (www.nutritech.fi). For instance, Barley and other members of poaceae are characterized by the presence of (1,3; 1,4)-β- glucans and arabinoxylans as major component of their cell walls (Bacic et al., 1988; Hrmova et al., 2000), which decrease the digestibility of feed-stock prepared from these cereals for monogastric animals like poultry and pigs (Fincer and stone, 1986; Hrmova et al., 1999). However, enzymes like (1,3; 1,4)-β-glucan endohydrolases, β- glucosidases, β-glucan exohydrolases, (1,4)- βXylanohydrolases and xylanase have been described (Slade et al., 1989; Benjavongkulchai and Spencer, 1989) to hydrolyze these polysaccharides to simple sugars and thereby improve their digestibility (Hrmova et al., 1999). Use of exogenous lipase in dough for bread making has been reported to improve the rheological properties of dough, increases bread volume and delay the bread staling (Olesen, et al., 1994; Qi Si and Hansen, 1994; Poulsen and Soe, 1996; Castello et al., 1999). Jackson and Sahai (Jackson et al., 2002) have reported the application of a bacterial protease for the processing of "cereals" like, corn, wheat, rice, sorghum and millets; "non-cereal material" such as soybean, lentils, oilseeds, tubers, including potatoes, bananas, carrots, and other plant materials and their components for the preparation of food products like corn chips, tortilla, chips, potato chips, crispy snacks etc. They also claimed that their enzymatic process was superior to the conventional non enzymatic process of preparing these food products. Enzymes in Tea and Coffee Processing The role of enzymes in tea processing has been recognized for nearly four decades and its application to improve the quality of tea (Kumar et al., 2011). Enzyme treatments are given at three stages of black tea processing, that is, prior to fermentation of tea, prior to extraction of black tea, and to the extract; to improve soluble solids yield, cold water extractability/ solubility, and decrease in

290

Microbes: In Action

tea cream formation as well as to improve the clarity. The traditional process of black tea manufacture from fresh green tea leaves depends on the endogenous tea enzymes such as polyphenol oxidase, and peroxidase. During enzymatic processing the simple flavanoids in green tea leaf are oxidized by endogenous tea enzymes, polyphenol oxidase, and peroxidase to produce the more complex polyphenols that impart a bright red color and the astringent flavor to black tea. However, use of exogenous enzyme supplements such as pectinase and tannase have been reported to accelerates tea fermentation (enzymatic oxidation) and also destroys the foam forming property of instant tea powders by destroying pectins (Kashyap et al., 2001). Pectinase and Hemicellulase enzymes derived from a selected strain of fungal species have been used for breaking down of cell walls within the tea leaves during processing so that the leaves are better oxidized during fermentation and the release of the intracellular compounds which contributes to the flavor and hence the liquor is enhanced (http://www.enzyme-india.com/tea-enzymes.html). Commercial soluble coffee is produced by a step wise procedure which includes thermal processing, wetting, extraction and hydrolysis steps. These steps solubilize a high percentage of the roast and ground coffee solids. Very high temperatures required to perform thermal hydrolysis lead to off-flavours and make the process very costly. Various attempts have been reported using enzyme processing with carbohydrase enzymes to make soluble coffee in an attempt to improve product quality and process economics. Different enzymes mediated processes for coffee processing have been reported. For example, a method has been described, which employees steam treatment of roast and ground coffee at 220°C to 250°C for 1 to 10 minutes, followed by rapid depressurization, to activate the coffee before treating it with enzyme of the classes cellulases, proteases, ligninases, pectinases, cellobiase and lipases at 30°C to 60°C for 1 to 6 h (U.S. Pat. No. 4,983,408). Another method describes a process for making coffee extract, wherein a primary extract is obtained via extraction of coffee with hot water at 90°C to 100°C for 3 to 5 minutes at pH 4.7 to 5.0. The extract is separated and the solid fraction is hydrolysed by β-glucanase and pectinase enzymes added at 0.1 to 1% per 100 g dry matter at 43°C to 63°C for 0.5 to 1 h at pH 4.7 to 5.0 with continuous agitation. The secondary extract which is produced in this manner is then combined with the first (primary) extraction of the coffee. The process is said to give an increased soluble coffee quality and it is noted that the energy consumption is decreased (SU1,597,151). Still another method describes improvement in the efficiency of roasted coffee pulverization (a process used to reduce the particle size of a solid) to obtain roasted and ground coffee particles that can be easily dispersed and/or suspended in hot water to make a beverage with smooth mouth-feel. Roasted coffee is coarsely ground to a particle size of 500 to 1,000 μm. It is converted to an aqueous slurry to which an enzyme, typically mannanase is added which helps in reducing the viscosity of the roasted and ground coffee suspension in water. It helps to effect a more efficient pulverization or particle size reduction. The enzyme is then de-activated by heating the coffee suspension at up to 130°C, prior to the pulverization process.

Application of Enzymes in Food Processing

291

The latter finally reduces the particle size to 1 to 10 μm. The enzyme manufacturing giant Novo Nordisk of Denmark has disclosed that they are currently marketing three enzymes for the coffee industry--two for separation of the green bean from the cherry in washed coffee, and one for viscosity reduction of the liquid extract in the manufacture of soluble coffee (http://www.faqs.org/patents/app/20080311245#ixzz39 pMsJXDB). Enzymes in Confectionary The quality of many confectionery products depends on the softness and smoothness of their texture. But the moisture which is the crucial component of this texture is easily lost, because water evaporates and, when this happens, sugar crystallizes out leaving the product dry and hard (http://www.keylink.org/index.php). Production of a soft and durable confectionary product involves the manufacture of a center, usually through starch molding, which is then enrobed in chocolate. The center has to be firm enough to withstand the handling and processing, yet would soften to a desirable creamy consistency by the time it reaches the consumers. Invertase causes this transformation, by converting the crystalline sucrose present at the center, to the syrup phase (http://www.keylink.org/index.php; http://www.sternenzym.de/english/index.html). It would not be possible to get a creamy consistency directly from the starch molds, without the use of invertase. In addition to the softening that occurs, there are other benefits to this type of process. The fructose that is generated is hygroscopic, and helps to minimize the drying of the confection. This, in combination with the prevention of sugar crystallization, will increase the shelf life of the product by maintaining a desirable consistency for an extended period of time. Also, the process reduces the water activity, which helps to minimize microbial growth and contamination (http://www.keylink.org/index.php). Presently there are many companied which supply food grade invertase for confectionary applications such as Keylink Limited Green Lane, Ecclesfield Sheffield, S35 9WY UK; SternEnzym GmbH and Co. KG Kurt-Fischer-Straße 55 22926 Ahrensburg, Germany; Enzyme Development Corporation (212) 7361580 21 Penn Plaza, New York, NY 10001; AlindaVelco S.A.P.O. Box 114 Spata 19004 Athens Greece and many others. Enzymes in Dairy Dairy enzymes are enzymes used for the production of cheese and yoghurt as well as other milk products. The function of these enzymes varies widely from coagulants, which are used to make cheese, to bioprotective enzymes to enhance the shelf life and safety of dairy products. Dairy enzymes may be divided into 5 primary categories. Rennet (Coagulants) Coagulants may be segmented into four categories according to enzyme source and production method. The type of coagulant used has a direct influence on the cost, quality and yield of the final product.

292

Microbes: In Action

Milk contains proteins, specifically caseins, which stabilizes milk's liquid consistency by micelle formation and prevent its coagulation. Rennet and rennin are general terms for any enzyme which break down (hydrolyze) the milk protein casein, resulting in its coagulation. Technically rennet also refers to the lining of a calf's fourth stomach that is responsible for milk coagulation and assist in its digestion in calves. The most common enzyme isolated from rennet is chymosin. Chymosin can also be obtained from several other animal, microbial or vegetable sources; however indigenous microbial chymosin (from fungi or bacteria) is ineffective for making cheddar and other hard cheeses. Limited supplies of calf rennet have prompted the production of genetically engineered microbial chymosin by cloning calf prochymosin genes into bacteria. Recombinant chymosin may be involved in production of up to 70% of cheese products (http://biotech.about.com/od/casestudies/a/dairyenzymes.htm). Other Proteases In addition to the caseins, milk contains other proteins as well. Cow milk, besides casein also contains whey proteins such as lactalbumin and lactoglobulin. Denaturing these whey proteins with proteases results in a creamier yogurt product. Denaturation of whey proteins is also crucial for cheese production. During production of soft cheeses, whey is separated from the milk after curdling, and may be sold as a nutrient supplement for body building, weight loss, and lowering blood pressure. There are reports of dietary whey for cancer therapies (Bounous et al., 1991; Kennedy et al., 1995; Bounous, 2000; Parodi, 2007) and having a role in the induction of insulin production for those with Type-2 diabetes (Jakubowicz et al., 2014; http://www.battlediabetes.com/whey-protein-diabetes). Proteases are used to produce hydrolyzed whey protein, which is whey protein broken down into shorter polypeptides. Hydrolyzed whey is less likely to cause allergic reactions and is used to prepare supplements for infant formulas and medical uses (http://biotech.about.com/od/casestudies/a/dairyenzymes.htm). Lactase Lactase, a part of the β-galactosidase family of enzymes, is a glycoside hydrolase involved in the hydrolysis of the disaccharide lactose into constituent galactose and glucosemonomers. Lactase is present predominantly along the brush border membrane of the differentiated enterocytes lining the villi of the small intestine (Skovbjerg et al., 1981). In humans, lactase is encoded by the LCT gene (Mantei et al., 1988; Harvey et al., 1993). Lacking lactase or due to its insufficient production in the small intestine a person consuming dairy products may experience the symptoms of lactose intolerance. Lactose intolerance is a condition which refers to discomfort (cramps, gas and diarrhea) in the digestive tract upon ingestion of milk products (Järvelä et al., 2009). Lactase is used commercially to prepare lactose-free products, particularly milk, for such individuals. It is also used in preparation of ice cream, to make a creamier and sweeter-tasting product (http://www1.lsbu.ac.uk/water/enztech/lactase.html). Lactase is usually prepared from Kluyveromyces sp. of yeast and Aspergillus sp. of fungi (http://www1.lsbu.ac.uk/water/enztech/lactase.html).

Application of Enzymes in Food Processing

293

Catalase Catalase has found limited uses in dairy processing especially in cheese production. Hydrogen peroxide is a potent oxidizer and toxic to cells. It can be used as an alternative to pasteurization, when making certain cheeses such as Swiss, in order to preserve natural milk enzymes that are beneficial to the end product and flavor development of the cheese. These enzymes would be destroyed by the high heat of pasteurization. However, residues of hydrogen peroxide in the milk will inhibit the bacterial cultures that are required for the actual cheese production, so all traces of it must be removed. Catalse neutralize hydrogen peroxide by break it into harm less H2O and O2. Catalase enzymes are typically obtained from bovine livers or microbial sources, and are added to convert the hydrogen peroxide to water and molecular oxygen. Another application of catalase is flavor enhancement in cultured milk and sour cream. Hydrogen peroxide-catalase treatment of milk and, prior to inoculation with starter cultures containing diacetyl-producing aroma bacteria, has been found to increase synthesis and stabilization of diacetyl in the cultured milk, imparting characteristic flavour to the product. For this purpose hydrogen peroxide is first mixed into pasteurized milk, followed by addition of sufficient food-grade catalase to decompose the peroxide. The milk then is inoculated (0.5 to 1.0%) and incubated (21 C for 14 to 18 hours) as usually done with cultured buttermilk. The treatment results in at least a 100% increase in diacetyl production and the flavor produced is stable for at least one week (Pack et al., 1968). Lipases Lipases find considerable application in the dairy industry for the hydrolysis of milk fat. The dairy industry uses lipases to release fatty acids of specific chain lengths, to enhance the flavours of various cheeses. Current applications also include the acceleration of cheese ripening and the lipolysis of butter, fat and cream (Sharma et al., 2001; Ghosh et al., 1996). The traditional sources of lipases for enhancement of cheese flavours are animal tissues, especially pancreatic glands (bovine and porcine) and pre-gastric tissues of young ruminants (kid, lamb and calf). A range of microbial lipase preparations has been developed for the cheese manufacturing industry from Mucor miehei, Aspergillus niger, A. oryzae and several others. In some applications microbial lipases have successfully replaced pre-gastric lipases. Microbial lipases have been used individually or as mixtures of several preparations to produce a range of good quality cheeses. Enzyme modified cheese (EMC) is produced when cheese is incubated in the presence of enzymes at elevated temperature in order to produce a concentrated flavour by lipase catalysis for use as an ingredient in other products, such as dips, sauces, snacks and soups (Hasan et al., 2006). The concentration of fat is 10 times higher in EMC to that of normal cheese (www.au-kbc.org; Sharma et al., 2001; Ghosh et al., 1996; Makhzoum et al., 1996; Nagodawithana and Reed, 1993). The free fatty acids take part in simple chemical reactions resulting in development of new flavouring agents, such as acetoacetate, β-keto acids, methyl ketones, flavor esters and lactones (Ghosh et al., 1996).

294

Microbes: In Action

Gastric lipases have been used to accelerate ripening and flavour development of many cheese types, including cheddar, provolone and ras cheeses. Lipase addition enhances the rate of fatty acid liberation, which accelerates flavour development relative to control. These studies indicated that liberated fatty acid profiles of the accelerated process were identical to the control and the total quantities of short-chain liberated fatty acids (C4 to C6) were important for the development of typical cheddar cheese flavour during ripening. Intrinsic milk lipase in cheese, made from unpasturized milk, affects considerable lipolytic action. The cultures of Penicillium roqueforti and P. camembertii grow during ripening in Blue-vein and Camembert cheeses respectively, and produce lipases, which are responsible for lipolysis and development of characteristic flavours. In addition, lipases are usually added to Italian cheese, viz. paramesan, provolone, and romano, to intensify their flavor (Custry et al., 1987). Enzymes in Fruit and Vegetable Processing Enzymes are integral components of modern fruit and vegetable processing industries. They are used for the production of premium quality juices, purees and concentrates and are highly suitable for optimizing production processes. Their main purposes are: (i) increase extraction of juice from raw material (ii) increase processing efficiency (pressing, solid settling or removal) and (iii) generate a final product that is clear and visually attractive (http://www.abenzymes.com). Nearly all fruits and berries and many vegetables contain pectins and other polysaccharides such as starch and aribinoxylans. Pectins hold the fruit and vegetable cells together like a 'glue' and result in poor liberation of juice during pulping. The presence of soluble pectins in the subsequent juice also causes hazing or cloudiness. The cloudiness is difficult to remove except by enzymatic hydrolysis. This treatment also helps in reducing the juice viscosity, increasing its volume (e.g. the yield of juice from white grapes can be raised by 15%), slight improvement in the flavour and, in the case of wine-making, shorter fermentation times. Once the stabilizing effect of the pectins on the colloidal haze has been removed, insoluble plant material can be easily removed by filtration, or settling and decantation. Commercial pectolytic enzyme preparations are produced from Aspergillus niger; however, manyr non-commercial sources have been reported such as Aspergillus fumigatus Af293, Aspergillus aculeatus, Bacillus alcalophilus, Bacillus licheniformis, Clostridium acetobutylicum ATCC 824 etc (Chaplin and Bucke, 1990). The commercial preparation consists of a synergistic mixture of following enzymes: (i) polygalacturonase (EC 3.2.1.15), responsible for the random hydrolysis of 1,4-α-D-galactosiduronic linkages, (ii) pectinesterase (EC 3.2.1.11), which releases methanol from the pectyl methyl esters, a necessary stage before the polygalacturonase can act fully (the increase in the methanol content of such treated juice is generally less than the natural concentrations and poses no health risk), (iii) pectin lyase (EC 4.2.2.10), which cleaves the pectin, by an elimination reaction releasing oligosaccharides with non-reducing terminal 4-

Application of Enzymes in Food Processing

295

deoxymethyl-α-D-galact-4-enuronosyl residues, without the necessity of pectin methyl esterase action and (iv) hemicellulase (a mixture of hydrolytic enzymes including: xylan endo-1,3-β-xylosidase, EC 3.2.1.32; xylan 1,4-β-xylosidase, EC 3.2.1.37; and α-L-arabinofuranosidase, EC 3.2.1.55), strictly not a pectinase but its adventitious presence is encouraged in order to reduce hemicellulose levels (Chaplin and Bucke, 1990). The optimal activity of these enzymes is between pH 4 and 5 and generally below 50 °C. They are suitable for direct addition to the fruit pulps at levels around 20 U/l (net activity). Enzymes with improved characteristics of greater heat stability and lower pH optimum are currently being sought. Enzymes in Meat Processing Enzymatic meat processing has helped meat processing industries to maximize the quality and value of their meat products, and improve the economy of the total production process (http://www.danisco.com/product-range/foodenzymes/meat-and-culinary-processing-enzymes/). Enzyme based processes are environment friendly and provide sustainable solution that significantly reduces energy use, waste production, and processing costs (http://www.biotimes.com/en/articles/2010/March/Pages/Enzymes-add-valuefor China % E2 %80%99s-meat-processors.aspx). Meat processing industries produce huge quantity of by-products, which are not readily consumable and are therefore disposed off, resulting in wastage of valuable meat protein, despite their great commercial value (http://www.specialtyenzymes.com/products/term/meat-fish-proteins). Meat tenderness is a vital attribute considered by consumers in addition to its attractive colour (http://www.novozymes.com/en/solutions/food-and beverages/meat processing/ Pages/ Meat%20processing.aspx). Tenderness in meat is a combined effect resulting due to breakdown within muscle fibres, primarily because of the enzymatic activity, and loosening of connective tissue, in particular collagen (http://www.thebutcherweb.co.za/butchervol3no7enzymes.html). High cost of meat production has prompted the slaughterhouses and meat processing industries to use every part of animals to generate money making products. In this context, the enzymes restructures and improves the appearance and texture of low-valued by-products of meat (http://www.biotimes.com/en/articles/2010/March/Pages/Enzymes-add-valuefor China % E2%80%99s-meat-processors.aspx). Treatment by proteases from plant sources is a widely used method of meat tenderization, as plant proteases are active over a wide range of temperatures and pH (Calkins and Sullivan, 2007; http://www.thebutcherweb.co.za/butchervol3no7enzymes.html). The two meat tenderising enzymes most often used are both derived from plant sources: papain from the papaya fruit and bromelain from the pineapple plant (Bala et al., 2012). To a much lesser extent, ficin, derived from fig tree latex is also used. From microbial sources, Bacillus subtilis protease Aspergillus oryzae protease have been approved and can be used for meat tenderization (Calkins and Sullivan, 2007).

296

Microbes: In Action

Transglutaminase (TGase) is an enzyme with the ability to improve the functional characteristics of protein such as texture, flavour and shelf life. TGase initially attracted interest because of its capacity to reconstitute small pieces of meat into a steak. It can adhere to the bonding surfaces of food such as meat, fish, eggs, and vegetables as a thin layer, and it exhibits strong adhesion in small amounts. An important functional property of transglutaminase is the ability to induce gelation in meat foods. The TGase catalyses the interconnections of myofibrils, improves the gel elasticity of meat protein, and forms a protein network. Gel strength is further enhanced by heat treatment subsequent to the action of TGase. TGase has been widely applied in meat products such as chicken and beef frankfurters, fish, ham and sausages. Enzymatic processing adds value to slaughterhouse co-products, turning them into valuable food ingredients such as meat protein extract (MPE), which can be used in a number of food products such as meat cuts, sausages, processed foods and soups. The MPE application offers a number of benefits for meat processors such as maximising the value of trimmings and improving the quality of processed products, for example meat injected with MPE has better sliceability and a drier appearance than other processed meat products. An additional benefit of using MPE is that you get smoother processing because your injection needle does not get clogged (http://www.novozymes.com/en/solutions/food-andbeverages/meat-processing/salt-reduction/Pages/Salt%20reduction.aspx). Enzymes in Wine Processing The main enzymes used in wine production are pectinases. Pectinases are naturally present in all fruit (including grapes) and are in part responsible for the ripening process. However, grape pectinases are inactive under the pH and SO2 conditions associated with wine production. Fungal pectinases are resistant to these wine production conditions. The European Union regulatory body has established that only Aspergillus niger and Trichoderma can be used for enzyme production. The most widely used commercial enzymes are: pectinases, hemicellulases, glucanases and glycosidases (Mojsov et al., 2011). The pectic enzymes play important role in braking down grape pulp and skin cells and are able to split those chains and saccharide bonds between the chains (Whitaker, 1984). Enzymes cannot act on grapes if they are whole. Therefore, grapes should always be crushed before enzymes are added to enhance extraction. For all pectic enzymes, the wine should be at least 27°C for the enzyme to work. Pectic enzyme can be added at different times before and after fermentation to break down the pectin. Winemaking is a biotechnological process in which enzymes play a fundamental role. Numerous studies have reported on the use of commercial enzymes in white grape juice clarification, enzyme treatment effects on quality of white grape musts and wines (Ough and Crowell, 1979; Brown and Ough, 1981; Sreenath and Krishnaswamy, 1992; Lao et al., 1997). Treating crushed white grapes with pectic enzyme increases juice yield, sensory tests indicate that wine quality is either enhanced or unchanged (Ough and Crowell, 1979). White grape musts of eight different varieties were

Application of Enzymes in Food Processing

297

treated with pectic enzyme preparations. These treatments resulted in increases in total juice yields, clarity of the wine, filterability, methanol production, wine quality, browning capacity and amounts of solids that settled (Brown and Ough, 1981). A commercial pectinase from Aspergillus niger containing various polysaccharases clarified the white grape juice to an extent of 98-99% and also degraded the grape mash by 25-30%. Grapes of three white cultivars were treated with a commercial pectic enzyme preparation on an industrial scale. Pectic enzyme treatment increased the higher alcohols, free hydroxycinnamic acids and volatile phenols, whereas amounts of most esters, herbaceous alcohols and hydroxycinnamate derivative esters were reduced. When tasted by an expert panel, differences were found in sensory characteristics, with wines from untreated judged higher quality than those from treated grapes (Lao et al., 1997). Enzyme treatments on mushes speed up settling and ensure efficient sediment compaction (Cruess et al., 1951; Hohn et al., 2005; Trepo, 2008). The clear must is then racked from the lees without problems. REFERENCES Aehle W (2004). Enzymes in Industry. WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim. Asha R, Niyonzima FN and Sunil SM (2013). Purification and Properties of Pullulanase from Bacillus halodurans. Int. Res. J. Biological Sci. 2(3): 35-43 Bacic A, Harris PJ and Stone BA (1988). Structure and function of plant cell walls. In: J. Preiss, ed. The biochemistry of plants. New York: Academic Press, pp 297-371 Bala M, Ismail NA, Mel M, Jami MS, Salleh HM and Amid A (2012). Bromelain Production: Current Trends and Perspective. Archives Des Sciences. 65(11): 369-399 Benjavongkulchai E and Spencer MS (1986). Purification and characterization of barley aleurone xylanase. Planta. 169: 415-419 Berka RM and Cherry JR (2006). Enzyme biotechnology, in Basic Biotechnology, 3rd edition (C Ratledge and B Kristiansen),Cambridge University Press, Cambridge UK, pp. 477-498 Binod P, Singhania RR, Soccol CR and Pandey A (2008). Industrial enzymes, in Advances in Fermentation Technology, A Pandey, C Larroche, CR Soccol, and CG Dussap, Eds., Asiatech Publishers, New Delhi, India. pp. 291-320 Bounous G, Batist G and Gold P (1991). Whey proteins in cancer prevention. Cancer Lett. 57(2): 91-94 Bounous G (2000). Whey protein concentrate (WPC) and glutathione modulation in cancer treatment. Anticancer Res. 20(6C): 4785-4792 Brown M and Ough C (1981). A comparison of activity and effects of two commercial pectic enzyme preparations on white grape musts and wines, Am. J. Enol. Vitic. 32(4): 272-276 Buchholz K, Kasche V and Bornscheuer UT (2005). Biocatalysts and Enzyme Technology. Butt MS, Tahir-Nadeem M, Ahmad Z and Sultan MT (2008). Xylanases and their applications in aking industry. Food Technol. Biotechnol. 46(1): 22-31 Calkins CR and Sullivan G (2007). Adding Enzymes to Improve Beef Tenderness. BEEF FACTS: Product Enhancement, Copyright © 2007, Cattlemen's Beef Board. Carrez D and Soetaert W (2005). Looking ahead in Europe: white biotech by 2025, Industrial Biotechnology. 1: 95-101 Castello P, Baret JL, Potus J and Nicolas J (1999). Technological and biochemical effects of exogenous lipase in bread making. ESEPG-2. T Simoin and M Tenkanen, Eds. Organized by VTT Biotechnology TNO Nutriution and Food Research Institute at Helsinki, Finland, 8-10 December, 1999. Chandel AK, Rudravaram R, Rao LV, Ravindra P and Narasu ML (2007). Industrial enzymes in bioindustrial sector development: an Indian perspective, Journal of Commercial Biotechnology. 13(4): 283-291

298

Microbes: In Action

Chaplin M (2004). The use of enzymes in starch hydrolysis. London South Bank University (http://www1.lsbu.ac.uk/water/chaplin.html) Chaplin M and Bucke C (1990). Enzyme Technology. Cambridge University Press (http://www1.lsbu.ac.uk/water/enztech/index.html) Colton RL (1991). Steam treatment, pressurization, high temperature, atmospheric exposure without cooling, slurries, hydrolytic enzymes, US 4983408 A. Converti A and Borghi MD (1998). Kinetics of glucose isomerization to fructose by immobilized glucose isomerase in the presence of substrate protection. Bioprocess Eng. 18: 27-33 Copeland RA (2000). Enzymes: a practical introduction to structure, mechanism, and data analysis. Wiley-VCH Inc. pp- 1-2. Copyright. WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim. Crueger W and Crueger A (1990) Biotechnology: a Textbook of Industrial Microbiology. TD Brock (Edt.). Science Tech Publishers, USA. Cruess W, Neal R, Chong G and Dan U (1951). The effect of pectic enzymes in wine making, Am. J. Enol. Vitic. 2(1): 59-75. Custry F, Fernander N and Shahani KM (1987). Role of lipases and other enzymes in flavour development, paper presented at 24th Annu Miles-Marschall Italian Cheese Seminar, held on September 16-17, 1987 (Madison, WI) pp. 536-537. Dale JK and Langlois DP (1940). Starch conversion syrup. US Pat. 2201609. de Souza PM, de Oliveira e and Magalhaes P (2010). Application of microbial -amylase in industry – a review, Brazilian J. Microbiol. 41: 850-861 Demain AL and Fang A (2000). Advances in Biochemical Engineering/ Biotechnology, vol. 69, Th. Scheper, Edt., Springer –Verlag, Berlin Heidelberg. Demain AL (2010). History of Industrial Biotechnology. Industrial Biotechnology. Sustainable Growth and Economic Success. Edited by Wim Soetaert and Erick J Vandamme. WILEYVCH Verlag GmbH and Co. KGaA, Weinheim. Pp 17. Fernandes P (2010). Enzymes in sugar industries, in Enzymes in Food Processing: Fundamentals and Potential Applications, P Panesar, SS Marwaha, and HK Chopra, Eds., pp. 165–197, IK International Publishing House, New Delhi, India. Ghosh PK, Saxena RK, Gupta R, Yadav RP and Davidson S (1996). Microbial lipases: Production and applications, Sci Prog. 79: 119-157. Godfrey T and West S (1996). Introduction to industrial enzymology. In: Industrial enzymology, 2nd Edn. pp 1–8, Macmillan Press, London. Gupta R, Beg QK and Lorenz P (2002). Bacterial alkaline proteases: molecular approaches and industrial applications. Appl. Microbiol. Biotechnol. 59: 15-32 Hanson AM, Bailey TA, Malzahn RC and Corman J (1955) Submerged Culture Fermentation, Plant Scale Evaluation of Fungal Amylase Process for Grain Alcohol. J. Agric. Food Chem. 3(10): 866-872 Harvey CB, Fox MF, Jeggo PA, Mantei N, Povey S and Swallow DM (1993). Regional localization of the lactase-phlorizin hydrolase gene, LCT, to chromosome 2q21. Annals of Human Genetic. 57(3): 179-85 Hasan F, Shah AA and Hameed A (2006). Industrial applications of microbial lipases. Enz. Microbiol. Technol. 39: 235-251 Hohn A, Daqing S and Nolle F (2005). Enzymes in fruit juice and wine industry, Ch.5, In: Barrett, D et al., Processing fruits, science and technology, 2nd ed., CRC Press LLC, pp.98112. Hrmova M, Harvey AJ, Lee RC, Banik M, Varghese JN and Fincher GB (1999). Cell wall degrading enzymes in barley. 2nd European Symposium on Enzymes in Grain Processing ESEPG-2. T Simoin and M Tenkanen, Eds. Organized by VTT Biotechnology TNO Nutriution and Food Research Institute at Helsinki, Finland, 8-10 December, 1999. http:// www. biokemi. org/ biozoom/ issues/ 516/ articles/ 2309 http://biotech.about.com/od/casestudies/a/dairyenzymes.htm http://biotech.about.com/od/casestudies/a/dairyenzymes.htm http://en.wikipedia.org/wiki/Gluten

Application of Enzymes in Food Processing

299

http://www.abenzymes.com http://www.battlediabetes.com/whey-protein-diabetes http://www.bccresearch.com/market-research/biotechnology/enzymes-industrial-applicationsbio030f.html http://www.biokemi.org/biozoom/issues/516/articles/2309 http://www.biokemi.org/biozoom/issues/516/articles/2309 http://www.biokemi.org/biozoom/issues/522/articles/2368 http://www.biotimes.com/en/articles/2010/March/Pages/Enzymes-add-value-for China % E2 %80%99s-meat-processors.aspx http://www.biotimes.com/en/articles/2010/March/Pages/Enzymes-add-value-for China % E2%80%99s-meat-processors.aspx http://www.danisco.com/food-beverages/beverages/how-brewing-enzymes-improve-the-beerproduction/ http://www.danisco.com/product-range/food-enzymes/meat-and-culinary-processingenzymes/ http://www.enzyme-india.com/tea-enzymes.html http://www.faqs.org/patents/app/20080311245#ixzz39 pMsJXDB http://www.keylink.org/index.php http://www.keylink.org/index.php; http://www.lallemand.com/BakerYeastNA/eng/PDFs/LBU%20PDF%20FILES/1_14ENZY. http://www.mapsenzymes.com/Enzymes_Starch.asp. http://www.megazyme.com/select-an-industry/malting-brewing-and-juice-manufacture http://www.novozymes.com/en/solutions/food-and beverages/meat processing/ Pages/ Meat%20processing.aspx http://www.novozymes.com/en/solutions/food-and-beverages/meat-processing/salt-reduction / Pages/Salt%20reduction.aspx http://www.researchandmarkets.com/reportinfo.asp?catid=0 and reportid=1202421 and q=future%20of%20enzymes and p=1 http://www.rpi.edu/dept/chem-eng/Biotech-Environ/IMMOB/poppezz/hfcs.html http://www.rpi.edu/dept/chem-eng/Biotech-Environ/IMMOB/poppezz/hfcs_proc.html http://www.sigmaaldrich.com http://www.specialtyenzymes.com/products/term/meat-fish-proteins http://www.sternenzym.de/english/index.html http://www.thebutcherweb.co.za/butchervol3no7enzymes.html http://www.thebutcherweb.co.za/butchervol3no7enzymes.html http://www1.lsbu.ac.uk/water/enztech/lactase.html Jackson DS and Sahai D (2002). Enzymatic Process for Nixtamalization of Cereal Grains. Faculty Publications in Food Science and Technology. Paper 110. http://digitalcommons.unl.edu/foodsciefacpub/110. Jakubowicz D, Froy O, Ahren B, Boaz M, Landau Z, Bar-Dayan Y, Ganz T, Barnea M and Wainstein J (2014). Incretin, insulinotropic and glucose-lowering effects of whey protein pre-load in type 2 diabetes: a randomised clinical trial. Diabetologia, 57(9): 1807-1808 Jarvela I, Torniainen S and Kolho KL (2009). Molecular genetics of human lactase deficiencies. Annals of Medicin. 41(8): 568-575 Kashyap DR, Vohra PK, Chopra S and Tewari R (2001). Applications of pectinases in the commercial sector: a review, Bioresource Technol. 77: 215-227 Kennedy JF, Cabalda VM and White CA (1988). Enzymic starch utilization and genetic engineering. Trends Biotechnol. 6: 184-189 Kennedy RS, Konok GP, Bounous G, Baruchel S and Lee TD (1995). The use of a whey protein concentrate in the treatment of patients with metastatic carcinoma: a phase I-II clinical study. Anticancer Res. 15(6B): 2643-2649 Kirk O, Borchert TV and Fuglsang CC (2002). Industrial enzyme applications. Current Opinion Biotechnol. 13(4): 345-351

300

Microbes: In Action

Kumar CS, Subramanian R and Rao LJ (2011). Application of Enzymes in the Production of RTD Black Tea Beverages: A Review, Critical Reviews in Food Science and Nutrition. 53(2): 180-197 Kumar P and Satyanarayana T (2009). Microbial glucoamylases: characteristics and applications. Crit Rev Biotechnol. 29(3): 225-255 Langlois DP (1953) Application of enzyme to corn syrup production. Food Technol. 7: 303-307 Lao C, Lopez-Tamames E, Lamuela-Raventos R, Buxaderas S and Del Carmen de la TorreBoronat M (1997). Pectic enzyme treatment effects on quality of white grape musts and wines. Journal of Food Science. 62(6): 1142-149 Leisola M, Jokela J, Pastinen O, Turunen O and Schoemaker H (2002). Industrial use of enzymes, in Encyclopedia of Life Support Systems (EOLSS), OOPH¨anninen and M Atalay, Eds., pp. 1–25, EOLSS, Oxford, UK. Makhzoum A, Owusu-Apenten RK and Knapp JS (1996). Purification and properties of lipase from Pseudomonas fluorescens strain 2D, Int Dairy J. 6: 459-472 Mantei N, Villa M, Enzler T, Wacker H, Boll W, James P, Hunziker W and sem*nza G (1988). Complete primary structure of human and rabbit lactase-phlorizin hydrolase: implications for biosynthesis, membrane anchoring and evolution of the enzyme. EMBO J. 7(9): 2705-2713 Meghwanshi GK and Vashishtha A (2012). Microbial enzymes: production and applications. In: Recent trends in Microbiology (eds. BBS. Kapoor and Anil Arora). Madhu Publication, Bikaner. Pp. 83-100. Mojsovl K, Ziberoski J, Bozinovic Z and Petreska M (2011). Comparison of effects of three commercial pectolytic enzyme preparations in white winemaking. ATI - Applied Technologies and Innovations. 4(1): 34-38 Morgan KR, Hutt L, Gerrard J, Every D, Ross M and Gilpin M (2006). Staling in Starch Breads: The Effect of Antistaling α-Amylase. http://onlinelibrary.wiley.com/doi/10.1002/star.19970490204/abstract. Copyright © 1997 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim. Nagodawithana T and Reed G (1993). Enzymes in food processing, 3rd edn (Academic Press, San Diego) pp. 56-68. Nair SU, Singhal RS and Kamat MY (2006). Enhanced Production of Thermostable Pullulanase Type 1 Using Bacillus cereus FDTA 13 and Its Mutant. Food Technol. Biotechnol. 44(2): 275–282 Norus I (2006). Building sustainable competitive advantage from knowledge in the region: the industrial enzymes industry. European planning Studies. 14(5): 681-696 Ogawa J and Shimizu S (2002). Industrial microbial enzymes: their discovery by screening and use in large-scale production of useful chemicals in Japan. Current Opinion in Biotechnology. 13: 367-375 Olesen T, Si JQ and Doneyan V (1994). Use of lipase in baking. World Patent. WO 94/04035. Ough C and Crowell E (1979). Pectic-enzyme treatment of white grapes: Temperature, variety and skincontact time factors," Am. J. Enol. Vitic., 30(1): 22-27 Pack MY, Vedamuthu ER, Sandine WE and Elliker PR (1968). Hydrogen Peroxide-Catalase Milk Treatment for Enhancement and Stabilization of Diacetyl in Lactic Starter Cultures. Journal of Dairy Science. 51(4): 511-516 Parodi PW (2007). A role for milk proteins and their peptides in cancer prevention. Curr Pharm. 13(8): 813-28 Peppler HJ and Reed G (1987). Enzymes in food and feed processing. In Biotechnology, vol. 7a Enzyme technology, JF Kennedy (Ed.) pp. 547-603. Weinheim: VCH Verlagsgesellschaft Gmb H. Poulsen PB and Buchholz HK (2003) History of enzymology with emphasis on food production. In: Handbook of Food Enzymology, JR Whitaker, AGJ Voragen, and DWS Wong, Eds., pp. 11-20, Marcel Dekker, New York, USA Poulsen CH and Soe JB (1996). Effect and functionality of lipase in dough and bread. In Ist. Eur. Symp. Enzymes Grain Processing. Angelino, SAGF, Hamer, RJ Van Hartingsveldt W,

Application of Enzymes in Food Processing

301

Heidekamp, F and Van Der Lugt, JP Eds., Nutrition and Food Research Institute: Wageningen, Netherlands, pp. 204-214 Qi SJ and Hansen TT (1994). Effect of lipase on bread making in correlation with their effect on dough rheology and wheat lipids. In Proc. Int. Symp. AACC/ICC/CCOA. Am. Assoc. Cereal Chem. St. Paul-Minneapolis, USA. Research and markets (2010). Future of Enzymes in China to 2020, http://www.researchandmarkets.com/reportinfo.asp? cat id=0&report id = 1202421 &q = future%20of%20enzymes &p=1. Revedin A, Aranguren B, Becattini R, Longo L, Marconi E, Lippi MM, Skakun N, Sinitsyn A, Spiridonova E and Svoboda J (2010). Thirty thousand-year-old evidence of plant food processing. Proc Natl Acad Sci USA. 107: 18815-18819. Roberts M, Laufer S, Stewart ED and Saletan LT (1944). Saccharification of wheat by fungal amylases for alcohol production. Ind. Eng. Chem. 36(9): 811-812 Saxena RK, Agarwal L and Meghwanshi GK (2005). In: Diversity of fungal and yeast lipases: present in future scenario fir the 21st century. T Satyanaryana and BN Johri (Eds.). IK International pvt. Ltd, New Delhi, pp 796-814. Saxena RK, Ghosh PK, Gupta R, Davidson WS, Bradoo S and Gulati R (1999). Microbial lipases: potential biocatalyst for the future industry. Current Science. 77: 101-115 Sharma R, Chisti Y and Banerjee UC (2001). Production, purification, characterization and applications of lipases, Biotechnol Adv. 19: 627-662 Skovbjerg H, Sjostrom H and Noren O (1981). Purification and characterisation of amphiphilic lactase/phlorizin hydrolase from human small intestine. Eur. J. Biochem. 114(3): 653-61 Slade AM, Hoj PB, Morrice NA and Fincher GB (1989). The purification and characterization of three (1,4)-β-xylan endohydrolases from germinated barley. Eur J Biochem. 185: 533539 Soetaert W and Vandamme EJ (2010). Industrial Biotechnology: Sustainable Growth and Economic Success. Wiley Pp 17. Sreenath H and Krishnaswamy S (1992). The use of commercial enzymes in white grape juice clarification, Journal of Fermentation and Bioengineering. 73(3): 241-43. SU1597151-A Method for Making Coffee Extract (Moscow Technology Institute for Food Industry). Trepo G (2008). Enzymes for short maturation wines, Biotimes. 4: 11-12 Trincone A (2011). Marine Biocatalysts: Enzymatic Features and Applications. Mar. Drugs 9: 478-499 Vasic-Racki D (2006). History of Industrial Biotransformations-Dreams and Realities, in Industrial Biotransformations, A Liese, K Seelbach, and C Wandrey, Eds., pp. 1–35, WileyVCH, Weinheim, Germany, 2nd edition. Whitaker J (1984). Pectin supstances, pectin enzymes and haze formation in fruit juices. Enzyme Microb. Technol. 6: 341-49 www.au-kbc.org www.au-kbc.org www.nutritech.fi Zhang C and Kim SK (2010). Research and Application of Marine Microbial Enzymes: Status and Prospects. Mar Drugs. 8: 1920-1934

CHAPTER 19 Food Preservation: Methods and Practices Gautam Kumar Meghwanshi and Bharti Dhabai Department of Microbiology, Maharaja Ganga Singh University, Bikaner -334004 India Corresponding author: [emailprotected]

INTRODUCTION Food preservation refers to the processes by which food items are prevented from getting spoiled for a short or long period of time. The colour, taste and nutritive value of food stuffs are also preserved as far as possible. Food preservation ensures the availability of food articles viz. vegetables, fruits, meat, fish, dairy products and other perishable produce during off seasons and at regions different from their regions of production or origin. For instance fresh mangoes are perishable and we cannot relish these throughout the year in fresh form, but preserved mango products like pickle, chutney, juice, squash and jam can be enjoyed throughout the year. Therefore, preservation of food is very important to improve the nutritional content and have variety in diet. Thus vegetables and fruits are preserved when they are available in abundance. CAUSES OF FOOD SPOILAGE Food spoilage means that food is no longer fit for eating. When bread is kept outside the refrigerator for a few days, white, green or black puffy growth may be seen on it. This growth is called mould (Fungi) and it deteriorates the nutritive quality of bread or/and may even produce toxins, which are harmful for the consumers. Similarly, if cooked dal (pulses) or vegetable is left at room temperature for some time, it develops a foul smell and bubbles due to microbial fermentation. The dal (cooked pulses) and vegetables are thus spoilt and cannot be eaten. The indications of food spoilage are changes in colour, taste, bad smell, bubbles or there is growth of mould (spongy or powdery growth on the food stuff). Formation of soft spots or soft brown spots on fruits and vegetables is also an indication of food spoilage. The major factors responsible for food spoilage are microorganisms, enzymes (native to food), insects, worms and rats. Microbial spoilage of food items occur under those conditions which facilitate their growth and reproduction. Like all living beings they require moisture, right temperature and food to grow and multiply. However, unlike higher organisms microorganisms can grow and proliferate under aerobic or/and anaerobic conditions.

304

Microbes: In Action

PRINCIPLES OF FOOD PRESERVATION There are three major principles of food preservation: 1. killing the micro-organisms present in food. 2. preventing or delaying the action of microorganisms present in food. 3. stopping the action of native enzymes of food. (i) Killing Microorganisms The best way to prevent microbial spoilage is to kill the microorganisms. This can be done by two approaches. In the first approach microbes can be removed or destroyed completely by the method of sterilization. The second approach is based on killing only undesirable microorganisms and thereby decreasing the microbial load of food products. (ii) Preventing or Delaying the Action of Micro-Organisms Microbial spoilage can be delayed by food handling techniques. For example, fruits and vegetables with undamaged skins are more resistant to microbial spoilage than those with damaged or pilled off skins. Similarly, the shell of nuts and eggs, serve as a protective coating and delay the action of microorganisms. Food packed in polythene bags and aluminium foils are also protected against microorganisms. As commonly encountered microorganisms need air and water to grow, so if these are removed, microbial action can be prevented and thus food can be saved from being spoiled. Refrigerating a food or keeping them at low temperatures also helps in delaying the action of microorganisms and therefore in preserving the food. This is because microorganisms cannot act at low temperatures. Thus, when foods are kept in the refrigerator or freezer, microorganisms are prevented from growing. Microbial growth can also be prevented by certain chemicals like sodium benzoate and potassium metabisulphite. These chemicals are called preservatives. (iii) Stopping the Action of Enzymes Enzymes are also responsible for food spoilage. They are naturally present in foods such as fruits, vegetables, meat, fish and raw dairy products. For example if a raw mango is kept at room temperature for a few days it will turn ripe, become yellow and then start decaying. All this happens due to the presence of enzymes. So, if the action of enzymes is stopped, the foodstuff will be prevented from being spoiled. Enzyme action can be prevented by giving a mild heat treatment. Before canning or freezing, vegetables are dipped in hot water or are exposed to steam for a few minutes. This is known as blanching. When milk is boiled, it not only kills microorganisms but also stops the action of enzymes present in it, thus extending its shelf life. Methods of Food Preservation Food preservation is accomplished by the use of various physical, chemical, and biological techniques.

Food Preservation

305

Physical Methods of Preservation Asepsis Asepsis means absence of sepsis (absence of harmful microorganisms and their toxins). It is achieved by cleanliness in each step of manufacturing processing and handling of food since food items undergo several steps during its preparation and each step is a potential source of contamination e.g. the packed vegetables and fruits need aseptic condition at each step of its processing like plucking, harvesting, washing, pretreatments, packaging, quality control, transportation, selling, usage by consumer, each step requires proper aseptic condition for its preservation. High Temperature Treatment Heat treatment i.e. application of high temperatures denature proteins, inactivate enzymes, most or all vegetative cells, some or all spores are killed depending on the type of heat treatment. The deactivation of microorganisms to prevent food spoilage depends on their heat resistance. The factors affecting heat resistance are mentioned below: Factors affecting heat resistance: 

Vegetative cells and microbial spores exhibit varied resistance, most cells have medium resistance, whereas, spores are more resistant to killing by heat.  Initial concentration of cells, and their conditions like injured cells to healthy cells ratio.  Consistency of food material (liquid, semi liquid, solid).  Microbial growth phase i.e., lag / log / stationary.  Dried spores (desiccated spores) are harder to kill by heat  Food pH  Salt concentration  Presence of colloidal substances in the food. Thermal death time (TDT) can be described by 'D' decimal reduction time: time required to destroy 90% of cells in a population (reduction in 1 log cycle). For example, time required in reduction of cells from 104 to 103 is 10 min; 103 to 102 is 10 min. Heat treatments employed in processing of foods:   

Less than 100°C At 100°C More than 100°C

Pasteurization In pasteurization temperatures below 100°C is generally employed. Heating of food material may be achieved by steam/hot water/dry heat/electric current. The Purpose is to destroy all pathogens and most spoilage microbes. Milk is normally pasteurized at 72°C for 15 sec. The basis of temperature-time regime is heat resistant pathogenic bacteria like staphylococci, streptococci, Brucella

306

Microbes: In Action

abortus, Mycobacterium bovis, Mycobacterium tuberculosis etc., which may be present in raw milk (Waites et al., 2001). However bacterial spores and other thermodurics survive pasteurization. Pasteurization of milk is of two types: High temperature short time (HTST) such as 72°C (more precisely, 71.7 °C) for 15 sec and low temperature long time (LTLT) at 65°C for 30 min (Hayes and Boor, 2001). Fruit juices have been traditionally pasteurized by LTLT method from a long time (D'Amico et al., 2006). However, HTST method, has also been used for fruit juice pasteurization, e.g., orange juice is preserved by HTST at 90 to 95°C for 15 to 30 s (Braddock 1999) and apple juice is preserved by HTST at 77 to 88°C for 25 to 30 s (Moyer and Aitken, 1980). Heating at 100°C  



Boiling: Boiling is generally used for preservation of milk and other water based food products like vegetable curries, pulses etc. Blanching: Blanching refers to treating vegetables with boiling water. The time for blanching varies with hardness of fruits/vegetables. The food is treated until it becomes soft. Blanching also reduces enzyme activity of the food material. Canned foods can be preserved by immersing their container in boiling water

Heating to more than 100°C Canning Canning refers to packaging of foods in hermetically sealed containers (glass /aluminum /plastics). Canned foods are preserved by treating the sealed containers at high temperatures viz. 121°C or 115°C for various time periods (around 30 min). Ultra high temperature (UHT) regime is also employed for treatment of canned foods. UHT employs 150°C for 3 sec using steam by injection or infusion (Doyle and Beuchat, 2007). Heating is followed by immediate cooling, done by air currents or immersion in cold water or spray of cold water on the containers. Cooling is done as rapidly as possible since cooldown period leads to growth of microbes if any one left due to adaptive period. But cooling strategy depends on material of packaging; glass containers crack with sudden cooling. Canning ensures air tight packaging of foods thus prevents microorganisms from entering and proliferating inside during storage. It provides a shelf life normally of 1 - 5 years, however under specific circ*mstances it can last for as long as 30 years in an edible state (Blumenthal, 1990). Some common canned foods are: baked beans, canned asparagus, canned sardines, canned tuna, mushrooms, pears, pineapples, pink salmon, tomato juice, etc (Jay, 1996; Frazier and Westhoff, 1998; Doyle and Beuchat, 2007). Steam Under Pressure It is the most effective method of high temperature food preservation since it can kill the vegetative cells and spores of microorganisms. Food preservation by heat requires knowledge of heat resistance of

Food Preservation

307

microorganism, particularly spores, rate of penetration of heat in different consistencies of food, size of container during packing etc. Approximate heat resistance levels (Gupta, 2007) Food Borne pathogens

D (mins)

Temperature (°C)

Listeria monocytogenes Campylobacter jejuni Salmonella spp. Staphylococcus aureus Escherichia coli Yersinia enterocolitica Clostridium botulinum Spores Bacillus cereus Food spoilage organisms Bacillus stearothermophilus Bacillus coagulans Clostridium thermosaccharolyticum Yeasts and Molds

5.0-8.3 1.0 0.58-0.98 2.0-15.0 0.1 1.0-3.0 0.21 2.0-8.0

60 55 60 60 65 60 121 100

4.0-5.0 0.1-0.2 3.0-4.0 0.5-3.0

121 121 121 65

Low Temperature The temperature of 0°C or lower prevents the growth and metabolic activities of microbes. Thus it can be used in food preservation, e.g., refrigerators and freezers can be used for preservation of foods. In the process of freezing the food product is steam blanched in order to inactivate enzymes that can form products even at low temperatures. All the perishable food items can be refrigerated to prevent microbes from multiplying. Because of freezing the water becomes unavailable to microorganisms, thus chemical and physical reactions leading to spoilage of food are slowed by freezing. The disadvantage of using low temperature is that refrigeration can retard but does not stop the microbial growth. The psychrophiles can grow slowly at this temperature and can still cause the spoilage (Hayes and Boor, 2001. Thus the low temperature cannot be relied to kill all microorganisms. The number and types of spoilage microbes present in frozen food shows the degree of contamination of raw food and the aseptic conditions maintained during the processing and handling of the product. The microbial count of most of frozen food retards during storage. Many microbes including pathogens e.g. Salmonella species can survive the long term storage at even low temperature. Drying It is a process of preservation in which water is removed from the food which effectively inhibits the growth of microorganisms. It includes traditional method of sun drying in which the water from food materials is removed by exposing them to sun light, until the water activity of foods is brought down to a level which could not sustain the microbial growth. Drying using mechanical dryers is quicker, more reliable, although more expensive than sun drying. In this method, heated air with controlled relative humidity is allowed to pass over the

308

Microbes: In Action

food to be dried either in tunnels or the food is moved on conveyer belts through the heated air. Liquid foods, such as milk, juices, and soups, may be evaporated at low temperatures under vacuum or drum or spray dried. In freeze drying (lyophilization) water is removed from the food when it is in frozen state that is ice crystals are vaporized usually under a vacuum. It is a very efficient method of drying foods (Gupta, 2007). Drying involves both heat and mass transfer phenomena, for instance, in hot air drying the hot air stream used for drying has two functions: i) transfers heat to evaporate water from raw materials and ii) carries away vapor produced. In this method microbes are affected by both high temperature and low water activity (Nummer, 2002; www.partselect.com/JustForFun/Preserving.Food-byDrying.aspx). Osmotic Pressure In this method of preservation the microbes are killed due to osmotic imbalance. In this method the water is pulled out from microorganisms placed in solution containing large amount of dissolved substances such as sugar or salt. Thus the cell are plasmolysed when kept in it and their metabolism is arrested. High osmotic pressure inhibits the microbial growth but it does not kill all microbes (Hussain, 2009). Ultraviolet Light (UV-Light) This method of preservation utilizes radiation with the electro-magnetic spectrum in the range of 100 to 400 nanometers, between visible light and xrays. UV light spectrum can be divided into UV-A (320–400 nm), UV-B (280– 320 nm) and UV-C (200–280 nm). UV-C shows biocidal effects and kills microbes by degrading their cell walls and DNA (Ngadi et al., 2003). Thus, UV-C could be used for the inactivation of microorganisms such as bacteria, yeasts and moulds (Bintsis, 2000). The amount of cell damage depends on the type of medium, microorganisms and the applied UV dose (Ngadi et al., 2003). UV-C treatment has the advantages of no toxic or significant non-toxic by-products being formed during the treatment, very little energy being required when compared to thermal pasteurization processes, and maximum aroma and color of the treated fruits is maintained (Tran and Farid, 2004). UV-C treatment has been successfully used to reduce the microbial load in different fruit juices and nectars. Ultrasound (US) Power ultrasound (US) is a potential non-thermal technique for preservation of food products. Power US uses a lower frequency range of 20 to 100 kHz and a higher sound intensity of 10 to 1000 W/cm2 (Baumann et al., 2005). The principle of ultrasonic preservation is that first, the ultrasonic transducers convert electrical energy to sound energy. Then the ultrasonic waves propagate in liquid due to which small bubbles are formed which collapse thousands of times per second. This rapid collapse of the bubbles (cavitation) results in high localized temperatures and pressure, which causes breakdown of cell walls, disruption of cell membranes and damage of DNA of microbes

Food Preservation

309

(Manvell., 1997; Knorr et al., 2004; O'Donnell et al., 2010). The use of high power ultrasound in the food industry has been widely investigated. In order to meet the FDA requirement of a 5-log reduction of microorganisms, a combination of sonication with mild heat treatment and /or pressure is essential (Baumann et al., 2005; D'Amico et al., 2006; Ugarte-Romero et al., 2006; Salleh-Mack and Roberts., 2007; Tiwari et al., 2009). Pulsed Electric Field (PEF) Pulsed electric field (PEF) method uses short bursts of high voltage electricity for microbial inactivation and causes no or minimum effect on quality of food. In this method, the foods being treated are placed between two electrodes, usually at room temperature. The applied high voltage results in an electric field which leads to microbial inactivation. The voltage applied is in the order of 20-80 kV for microseconds (Knorr et al., 1994; Zhang et al., 1995; Barbosa-Cánovas et al., 1999). The principle of preservation by this method is explained by several theories including the trans-membrane potential theory, electromechanical compression theory and the osmotic imbalance theory. The most accepted theory is associated with the electroporation of cell membranes. It is believed that electric fields causes structural changes in the membranes of microbial cells due to generation of pores on the cell membrane, leading to microbial killing and inactivation (Tsong, 1991; Barbosa-Canovas et al., 1999). This method has many advantages. The nutritional characteristics of food is maintained due to the very short processing time and low processing temperatures, It is an energy saving and environment friendly process because it results in zero waste generation (Toepfl et al., 2006). Due to these advantages, PEF processing is widely used in food preservation. Chemical Methods of Preservation A variety of chemicals can be used in the preservation of foods, e.g., weak organic acids like benzoic acid, acetic acid, lactic acid, hydrogen peroxide, salt, sugar etc. Weak Organic Acids The weak acids works as preservative by inhibiting the growth of both bacterial and fungal cells. (Sofos and Busta, 1993; Blocher and Busta, 1985). Inhibition of growth by weak acid preservative is due to a variety of action e.g. Membrane disruption (Freese, 1973), Inhibition of essential metabolic reactions (Krebs, 1983), Stress on intracellular pH homeostasis (Salman,1984; Cole and Keenam, 1987; Bracey, 1998). Acetic acid is a major component of vinegar. Acetic acid is used in food preservation in two forms 5-10% vinegar and as 25-80% aq. solution of synthetic acetic acid. The mode of action of acetic acid is lowering the pH value of product to be preserved. Acetic acid shows the antimicrobial action by penetrating the cell wall and denaturing cellular proteins above concentration of 0.5% (Reynolds, 1975). Acetic acid is generally more effective against bacteria and yeast as compared

310

Microbes: In Action

to molds. (Ingram et al., 1956). Acetic acid is a weak preservative as compared to other chemicals. The addition of salt along with it improves the action of preservation by lowering the water activity. (Yamamoto et al., 1984). It is mostly combined with other method of preservation e.g. pasteurization, or with salt, sorbic acid and benzoic acid. Hydrogen Peroxide It can be used as a food preservative. It is bactericidal depending on concentration used and on environmental factors such as temperature (Cords and Dychdala, 1993; Juven and Pierson, 1996). Hydrogen peroxide is weekly sporicidal at room temperature but very potent at higher temperature. In the USA addition of hydrogen peroxide is allowed to food products for preservation, such as raw milk for preparation of cheese variants, whey preparation, corn starch and dried eggs for decontamination of packaging material (Toledo, 1971; Juven and Pierson, 1996; Gould, 2004). It is also used as preservative in fruit and vegetables (Falik, 1994) and for raisin decontamination (Simons, 1997). Common Salt (NaCl) It is one of the most important additives in food preservation from ancient time. Mostly it is used in combination with other preservatives or preservation methods. The mode of action of salt is that it lowers the water activity of cells and thus causes the conditions less favourable for the organisms. But a number of microorganisms can grow at a very low water activity, thus using salt alone for the food preservation is not enough for preservation (Kushner, 1971). For preserving a foods by using salt the food are immersed in solutions containing a considerably high amount of salt called brines or dry salt can be also added. Sugars Sugars such as glucose and sucrose are effective as preservative because they have the ability to make water unavailable to organism and causing osmotic effect, e.g., foods preserved by high sugar concentration are sweetened condensed milk, syrups, jellies and candies (Hussain, 2009). The mechanism of action of preservation by sugar is due to the osmotic effect and lowering of water activity of organism along with a decrease in pH, which prevents the growth of most microorganisms (Gupta, 2007). Ethylene Oxide It is a cyclic ether and in gaseous state at ambient temperature and pressure it boils at 10.7°C and freezes at -111°C. Mixture of ethylene oxide in air is highly flammable and explosive. To eliminate this hazard it is mixed with dichlorodifluromethane, carbon di-oxide, formic acid. It is active against most of spores, vegetative bacterial cells, yeast, molds and viruses (Conviser, 2009). BIOLOGICAL METHODS OF PRESERVATION The preservation of food by biological method is also known as biopreservation. In this method the food preservation is done by using natural antimicrobials

Food Preservation

311

and microorganisms (Ananou et al., 2007). In this process the beneficial products formed from the fermentation are used to reduce the rate of spoilage and to make food free from pathogenic microorganisms. Because of its ecofriendly approach this process is gaining increasing popularity. By definition biological preservation means use of antagonistic microbes or various metabolites of microorganisms to destroy or inhibit microbes in food for increasing the shelf life of food. Examples of some biopreservatives are lactic acid bacteria, natural antimicrobials such as bacteriocins, lactoperoxidase, herb leaves and oils, spices, chitosan etc. (Hoover, 2000; Gould, 2001; Corbo et al., 2009). Lactoperoxidase It is an enzyme widely found in colostrum, raw milk and other body fluids. By nature it is an oxidoreductase and catalyses the oxidation of thiocyanate with the consumption of hydrogen peroxide, to produce intermediate products with antibacterial properties (Corbo et al., 2009). These products are found to be bactericidal for some spoilage and pathogenic microorganisms and yeasts (Gould, 2001). Mostly it is used for the preservation of tomato juice and mongo fruits (Touch et al., 2004; Le Nguyen et al., 2005). Herbs, Spices and Flavor Oils Some herbs and spices contain essential oils, that are natural antimicrobials. The major elements of these antimicrobials are phenolic compounds, like caffeic, cinnamic, ferulic and gallic acids, oleuropein, thymol and eugenol (Gould, 2001). Examples of some herbs and spices showing antimicrobial properties for use in food are sage (Salvia officinalis), rosemary (Rosemarinus officinalis), clove (Eugenia aromatica), coriander (Coriandrum sativum), garlic (Allium sativum) and onion (Allium cepa) (Deans and Ritchie, 1987). The oils of bay leaves, cinnamon, clove and thyme are also found to be highly effective against food pathogenic microorganisms including Campylobacter jejuni, Salmonella enteritidis, Escherichia coli, Staphylococcus aureus and Listeria monocytogenes (Smith-Palmer et al., 1998). Gram-positive bacteria is believed to be more sensitive to inhibition by plant essential oils than the Gram-negative bacteria. Citrus fruits extracts are applied to fruits and vegetables as antimicrobials. (Fisher and Phillips, 2008). Chitosan It is a modified, natural carbohydrate polymer. Citosan is derived by deacetylation of chitin [poly-β-(1 → 4)-N-acetyl-D-glucosamine] (No and Meyers, 1995). It is produced from crab, shrimp and crawfish, with different deacetylation grades and molecular weights which leads to different functionalities (No et al., 2007). Chitosan shows antimicrobial activity against a wide range of microorganisms and thus it is used as a natural food preservative (Sagoo et al., 2002). The principle of the antimicrobial activity of chitosan could be explained

312

Microbes: In Action

by several hypotheses. According to one hypothesis the positively charged chitosan molecules interact with the negatively charged microbial cell membranes, which affects the cell permeability and lead to the leakage of intracellular compounds (Fang et al., 1994). Another hypothesis is that the interaction of diffused hydrolysis substances with microbial DNA leads to the inhibition of the mRNA and protein synthesis of the microorganisms (Sudarshan et al., 1992). Chitosan glutamate is found to be an effective preservative against spoilage yeasts in apple juice. Another study by Rhoades and Roller (2000) showed that 0.3 g/L of Chitosan eliminated all the yeasts in pasteurized apple-elderflower juice during a 13-day of storage at 7°C. Chitosan has been approved as a food preservative in Japan in 1983 and in Korea in 1995. But so far it is not a GRAS approved food additive by the FDA. Lactic Acid Bacteria (LAB) These bacteria were used as biopreservatives in early 1900. These bacteria release peptides called bacteriocin which acts as a preservative factor. These are gram positive, non spore forming, cocci or rods, non aerobic but aerotolerant fermentative with lactic acid as major end product. These are widely distributed in nature. LAB shows antimicrobial activity because these bacteria produce different antimicrobials compounds such as lactic acid, acetic acid, hydrogen peroxide, carbon dioxide, bacteriocins which inhibit pathogen and spoilage microbes and thus preserving food (Oliveira, 2008). Bacteriocins These are antimicrobial substances of LAB. These are used as biopreservative. It is a natural food preservative, heat stable and susceptible to proteolytic inactivation. These are synthesized in ribosomes as bioactive peptide or peptide complexes and shows bactericidal or bacteriostatic activity. Bacteriocins inhibit potential food borne pathogens e.g. Clostridium botulinum, Enterococcus faecalis, Listeria moncytogens, Staphylococcus aureus, Bacillus species. Bacteriocins are antimicrobial peptides that are readily degraded by proteolytic enzymes in the human body. Nisin is the most commonly used food preservative and the GRAS additives permitted by the Food Additive Status List (USFDA, 2006). It is used to preserve fruit and vegetable juices (Yuste and Fung, 2004; Settanni and Corsetti, 2008). Bacteriocins are safe since they are degraded by proteases in gastrointestinal tract (Cleveland et al., 2001). Bacteriocins are mostly bactericidal with few exceptions. The mode of action of nisin a bacteriocin is that it acts on cytoplasmic membranes of gram positive bacteria and forms due to which the sensitive cells and membranes vesicles shows efflux of amino acids and cations. Loss of these substances decreases the proton motive force and it finally interferes with cellular biosynthesis which results in collapse of membrane leading to cell death. Lactococcin, pediocin etc. causes disruption of membrane permeability to ions that leads to fall of proton motive force (Christensen et al., 1992).

Food Preservation

313

Use of Bacteriocins for Biological Preservation of Food Following strategies are considered for the application of bacteriocin in the preservation of food: Addition of bacteriocin producing LAB to food, Addition of purified or semipurified bacteriocin as a food preservative, Use of a fermented product with a bacteriocin producing strain as a ingredient. Bacteriocin producing LAB can be used in the preservation of foods of plant origin e.g. processed vegetables, mixed salads. A fall in number is observed in bacterial loads of ready to use mixed salads on adding bacteriocin producing LAB (Vescovo et al.,1995). Nisin is suitable for use in a wide range of foods. Lactoperoxidase It is an enzyme found in colostrum, raw milk and other body liquid. By nature It is an oxidoreductase and catalyses oxidation of thiocyanate with the consumption of Hydrogen peroxide, to produce intermediate products with antibacterial properties (Corbo et al., 2009). These products are found to be bactericidal for some spoilage and pathogenic microorganisms and yeasts (Gould, 2001). Preservation of Food by Hurdle Technology It is a method of preserving food from contaminating and spoilage bacteria, pathogens by a combination of one or more methods. In this method the microbes have to pass through these individual methods called hurdles for maintaining their activity in food. The proper combination of hurdles leads to destruction of microbes and prevents their future growth there by preserving food from spoilage (Alasalvar et al., 2010). The hurdles used in this technology includes properties like processing at high temperature storage at low temperature, lowering pH, water activity etc. along with the presence of biopreservatives in food products (Yang et al., 2012, Pal et al., 2005). The intensity of hurdle is dependent and controlled according to the type of spoilage microbes and regulated according to consumer safety and preference keeping in mind the quality and appearance of final product. Hurdle technology is derived from the hurdle effect given by Leistner (2000). It is basically used in food designed for making new products according to needs e.g. If we want to reduce or replace preservatives like nitrites in meat then the other hurdles, e.g., pH, water activity, refrigeration, competitive flora would be given much emphasis that would stabilize the products (Leistner et al., 1999). The food preservation by hurdle technology is basically based on physical and chemical measurement of hurdles in food and computer evaluation of results. This method gives faster and more reliable information on preservation of food.

314

Microbes: In Action

REFERENCES Ananou S, Maqueda M, Martinez-Bueno M and Valdivia E (2007). Biopreservation, an ecological approach to improve the safety and shelf-life of foods. In: Communicating Current Research and Educational Topics and Trends in Applied Microbiology, A Méndez-Vilas (Ed.) ©FORMATEX 2007: 475- 486 Barbosa-Canovas GV, Gongora-Nieto MM, Pothakamury UR and Swanson BG (1999). Preservation of foods with pulsed electric fields, Academic Press, San Diego, pp. 4-47 Barcey D, Holyoak CD and Coote PJ (1998). Comparison of the inhibitory effect of sorbic acid and amphotericin B on Saccharomyces cerevisiae: Is growth inhibition dependent on reduced intracellular pH? J. Appl. Microbiol. 85: 1056-1066 Baumann AR, Martin SE and Feng H (2005). Power ultrasound treatment of Listeria monocytogenes in apple cider. J Food Prot. 68: 2333-2340 Bintsis T, Litopoulou-Tzanetaki E and Robinson R (2000). Existing and potential applications of the ultraviolet light in the food industry- A critical review. J Sci. Food and Agric. 80: 637-645 Blocher JC and Busta FF (1985). Multiple modes of inhibition of spore germination and outgrowth by reduced pH and sorbate. J. Appl. Bacteriol. 59: 467-478 Blumenthal D (1990). The Canning Process; Old Preservation Technique Goes Modern. (http://www.highbeam.com/doc/1G1-9009146.html). FDA Consumer. Christensen DP and Hutkins RW (1992). Collapse of the proton motive force in Listeria monocytogenes caused by a bacteriocin produced by Pediococcus acidilactici. Appl. Environ. Microbiol. 58(10): 3312-3315 Cleveland J, Mantiville TJ, Ness IF and Chiknids ML (2001). Bacteriocins: safe antimicrobials for food preservation. Int. J. Food Microbiol. 71: 1-20 Cole MB and Keenan MHJ (1987). Effects of weak acids and external pH on the intracellular pH of Zygosaccharomyces bailii, and its implications in weak-acid resistance. Yeast. 3: 23-32 Conviser S (2009). The future of ethylene oxide. ICT Magazine. 1023. Corbo MR, Bevilacqua A, Campaniello D, D'Amato D, Speranza B and Sinigaglia M (2009). Prolonging microbial shelf life of foods through the use of natural compounds and nonthermal approaches - A review, Int. J. Food Sci. Technol. 44(2): 223-241 Cords BR and Dychdala GR (1993). Sanitizers: halogens, surface-active agents and peroxides. In: Antimicrobials in foods, second edition, PM Davidson and AL Branen, (Ed.) Marcel Dekker, Inc., New York, pp. 469-537 D'Amico DJ, Silk TM, Wu J and Guo M (2006). Inactivation of microorganisms in milk and apple cider treated with ultrasound. J. Food Prot. 69(3): 556-563 Deans SG and Ritchie G (1987). Antibacterial properties of plant essential oils, Int. J. Food Microbiol. 5: 165-180 Doyle MP and Beuchat LR (2007). Food Microbiology: Fundamentals and Frontiers (3rd Ed.), ASM Press. Falik E, Aharoni Y, Grinberg S, Copel A and Klein JD (1994). Postharvest hydrogen peroxide treatment inhibits decay in eggplant and sweet red pepper. Crop Protect. 13: 451-454 Fang SW, Li CF and Shih DYC (1994). Antifungal activity of chitosan and its preservative effect on low-sugar candied kumquat. J. Food Prot. 57: 136-140 Fisher K and Phillips C (2008). Potential antimicrobial uses of essential oils in food: is citrus the answer? Trends Food Sci. Technol. 19: 156-164 Frazier WC and Westhoff DC (1998). Food Microbiology (4th Ed.), Tata McGraw-Hill Publishing company Ltd. Freese E, Sheu CW and Galliers E (1973). Function of lipophilic acids as antimicrobial food additives. Nature. 241: 321-325 Gould GW (2001). Symposium on Nutritional effects of new processing technologies – New processing technologies: an overview, Proceedings of the Nutrition Society. 60: 463-474 Gould GW (2004). Heat sterilization, In: Principles and Practice of Disinfection, Preservation and Sterilization (fourth edition), AP Fraise, PA Lambert and JY Maillard, (Ed.), Russell, Hugo and Ayliffe´s. Blackwell Publishing, ISBN 1-4051-0199-7, Oxford, pp. 361-383

Food Preservation

315

Gupta RK (2007). Food and Industrial Microbiology: Food Preservation. http://nsdl.niscair.res.in/jspui/bitstream/123456789/305/2/FoodPreservation. Hayes MC and Boor K (2001). Raw Milk and Fluid Milk Products, In: Applied Dairy Microbiology, H Elmer Marth and James L Steele (Ed.). Marcel Dekker, Inc. New York, pp. 59-76 Hoover DG (2000). Microorganisms and their products in the preservation of foods. In: The Microbiological Safety and Quality of Food. BM Lund, AC Baird-Parker, and GW Gould (Ed.). Aspen, Gaithersburg, MD. pp. 251-276 Hussain M (2009). Microbiology Online: Osmotic Pressure. http://microbiologyonline.blogspot.in/2009/10/osmotic-pressure.html Ingram M Ottoway FJH and Coppock JBM (1956). The preservative action of acid substances in food. Chem Ind. London. 42: 1154 Jay JM (1996). Modern Food Microbiology (4th Ed.), CBS Publishers. Juven BJ and Pierson MD (1996). Antibacterial effects of hydrogen peroxide and methods for its detection and quantification. J. Food Protect. 59: 1233-1241 Knorr D, Geulen M, Grahl T and Sitzmann W (1994). Food application of high electric Field pulses. Trend. Food Sci. Technol. 5: 71-75 Knorr D, Zenker M, Heinz V and Lee D (2004). Applications and potential of ultrasonics in food processing. Trend. Food Sci. Technol. 15(5): 261-266 Krebs HA, Wiggins D, Stubbs M, Sols A and Bedoya F (1983). Studies on the mechanism of the antifungal action of benzoate. Biochem. J. 214: 657-663 Kushner DJ (1971). Influence of solutes and ions on microorganisms. In: Hugo, WB (Ed.). Inhibition and Destruction of the Microbial Cell. Academic Press, London. pp. 259-282 Le Nguyen DD, Ducamp MN, Dornier M, Montet D and Loiseau G (2005). Effect of the lactoperoxidase system against three major causal agents of disease in mangoes. J. Food Prot. 68: 1497-1500 Leistner L (1999). Use of combined preservative factors in foods of developing countries. In: The Microbiological Safety of Foods. Lund BM, Baird-Parker AC, Gould, GW (Ed.). Aspen Publishers, Gaithersburg, Maryland. Leistner L (2000). Basic aspects of food preservation by hurdle technology. Int. J. Food Microbiol. 55: 181-186 Manvell C (1997). Minimal processing of food. Food Sci. Technol. Today. 11: 107-111 Ngadi M, Smith JP and Cayouette B (2003). Kinetics of ultraviolet light Inactivation of Escherichia coli O157:H7 in liquid foods. J. Sci. Food Agric. 83:1551-1555 No HK, Meyers SP, Prinyawiwatkul W and Xu Z (2007). Application of chitosan for improvement of quality and shelf life of foods- a review. J. Food Sci. 72: 87-100 No HK and Meyers SP (1995). Preparation and characterization of chitin and chitosan – a review. J. Aqua. Food Prot. Technol. 4: 27-52 O'Donnell CP, Tiwari BK, Bourke P and Cullen PJ (2010). Effect of ultrasonic processing on food enzymes of industrial importance. Trend. Food Sci. Technol. 21(7): 358-367 Oliveira RBP, de L Oliveira A and Gloria MBA (2008). Screening of lactic acid bacteria from vacuum packaged beef for antimicrobial activity. Braz. J. Microbiol. 39: 368-374 Pal V, Jamuna M and Jeevarathnam K (2005). Isolation and characterization of bacteriocin producing lactic acid bacteria from a South Indian special dosa (Appam) batter. J. Culture Collection. 4: 53-60 Reynolds AE (1975). The mode of action of acetic acid on bacteria. Diss Abstr B. 35: 49354936 Rhoades J and Roller S (2000). Antimicrobial actions of degraded and native Chitosan against spoilage organisms in laboratory media and foods. Appl. Environ. Microbiol. 66(1): 80-86 Sagoo S, Board R and Roller S (2002). Chitosan inhibits growth of spoilage microorganisms in chilled pork products. Food Microbiol. 19: 175-182 Salleh-Mack SZ and Roberts JS (2007). Ultrasound pasteurization: the effects of temperature soluble solids organic acids and pH on the inactivation of Escherichia coli ATCC 25922. Ultrason. Sonochem. 14: 323-329

316

Microbes: In Action

Settanni L and Corsetti A (2008). Application of bacteriocins in vegetable food biopreservation. Int. J. Food Microbiol. 121: 123-138 Simons LK and Sanguansri P (1997). Advances in the washing of minimally processed vegetables. Food Australia. 49:75-80 Smith-Palmer A, Stewart J and Fyfe L (1998). Antimicrobial properties of plant essential oils and essences against five important food-borne pathogens. Lett. Applied Microbiol. 26(2): 118-122 Sofos JN and Busta FF (1993). Sorbic acid and sorbates. In antimicrobials in foods, 2nd edn (Davidson PM, Branen AL, eds). New York: Marcel Dekker, pp. 49-94 Sudarshan NR, Hoover DG and Knorr D (1992). Antibacterial action of chitosan. Food Biotechnol. 6: 257-272 Tiwari BK, Muthukumarappan K, O'Donnell CP and Cullen PJ (2009). Inactivation kinetics of pectin methylesterase and cloud retention in sonicated orange juice. Inno. Food Sci. Emerg. Technol. 10(2): 166-171 Toepfl S, Mathys A, Heinz V and Knorr D (2006). Review: Potential of high hydrostatic pressure and pulsed electric fields for energy efficient and environmentally friendly food processing. Food Rev. Internat. 22: 405-423 Toledo RT, Escher FE and Ayres JC (1973). Sporicidal properties of hydrogen peroxide against food spoilage organisms. Appl. Microbiol. 26(4): 592-597 Touch V, Hayakawa S, Yamada S and Kaneko S (2004). Effects of a lactoperoxidasethiocynate-hydrogen peroxide system on Salmonella entritidis in animal or vegetable foods. Int. J. Microbiol. 93: 175-183 Tran MTT and Farid M (2004). Ultraviolet treatment of orange juice. Inno. Food Sci. Emerg. Technol. 5: 495-502 Tsong TY (1991). Electroporation of cell membranes. Biophys J. 60: 297-306 Ugarte-Romero E, Feng H, Martin SE, Cadwallader KR and Robinson SJ (2006). Inactivation of Escherichia coli with power ultrasound in apple cider. J. Food Science. 71(2): 102-108 Vescovo M, Orsi C, Scolari G and Torriani S (1995). Inhibitory effect of selected lactic acid bacteria on microflora associated with ready-to-use vegetables. Lett. Appl. Microbiol. 21: 121-125 Waites MJ, Morgan NL, Rockey JS and Higton G (2001). Industrial Microbiology: An Introduction. Blackwell Science Ltd. Oxford, London. Yamamoto Y, Higashi K and Yoshii H (1984). Inhibitory activity of organic acids on food spoilage bacteria. (Studies on growth inhibition of food spoilage microorganisms for low salt foods. Part I). Nippon Shokuhin Kogyo Gakkaishi. 31: 525-530 Yang E, Fan L, Jiang Y, Doucette C and Fillmore S (2012). Antimicrobial activity of bacteriocin-producing lactic acid bacteria isolated from cheeses and yogurts. AMB Express. 2: 48 Yuste J and Fung DY (2004). Inactivation of Salmonella typhimurium and Escherichia coli O157:H7 in apple juice by a combination of nisin and cinnamon. J. Food Prot. 67: 371377 Zhang QH, Barbosa-Cánovas GV and Swanson BG (1995). Engineering aspects of pulsed electric field pasteurization. J. Food Eng. 25(2): 261-281

CHAPTER 20 Role of Fungi in Biosynthesis of Nanoparticles Praveen Gehlot1, Ramesh Raliya2 S K Singh3 Rakesh Pathak3 1

Department of Botany, Jai Narain Vyas University, Jodhpur-342001 India Washington University in St. Louis, MO 63130, USA 3 Central Arid zone Research Institute, Jodhpur, India-342 003 India Corresponding author: [emailprotected] 2

INTRODUCTION The term Nanotechnology, buzzword of present day science owes its origin from the Greek word 'nano' literally meaning dwarf. When it is expressed in terms of dimension one nanometer equals to one billionth of a meter (1nm =10-9 m). The subject nanotechnology deals with manufacturing, study and manipulation of matter at nano scale (or atomic scale) in the size range of 1-100 nm which may be called as nanoparticles (Rajan, 2004). NorioTaniguchi engineered materials at nanometer scale in 1974 and coined the term "nanotechnology". Material when attenuated at nanometer scale (less than 100 nm) exhibits new properties that are entirely different from its bulk counterpart due to small size and high surface to volume ratio. It is shown in terms of higher plasticity at high temperature, higher hardness, breaking strength and toughness at low temperature, higher chemical reactivity and surface energy, and high mobility in the body of an organism including cellular entry (Rajan, 2004). There is an enormous interest in the synthesis of nanomaterials due to their remarkable optical (Hu et al., 2006), chemical (Tay et al., 2014), photoelectrochemical (Ameena, 2012), and electronic (Tominaka et al., 2014) properties. Impressive advances have been observed in various aspects such as the synthesis of nanoscale matter and understanding/utilizing their exotic physicochemical and optoelectronic properties. Recent developments in the organization of nanoscale structures into predefined superstructures ensure that nanotechnology will play an increasingly crucial role in many key technologies of the new millennium. It is gaining importance in areas such as catalysis, optics, biomedical sciences, mechanics, magnetics, and energy science. The synthesis of nanomaterials over a range of chemical composition and high monodispersity is still challenging in material science. Several manufacturing techniques that usually employ atomistic, molecular, and particulate processing in a vacuum or in a liquid medium are in use (Daniel and Astruc, 2004). Most of the techniques are capital intensive, as well as inefficient in materials and energy use. Hence, there is an ever-growing need to develop clean, nontoxic, and environmentally benign synthesis procedures. Consequently, researchers in nanoparticle synthesis have

318

Microbes: In Action

turned to biological systems for inspiration. Nanotechnology is usually represented by two different approaches: 'topdown' and 'bottom-up'. 'Top-down' refers to making nanoscale structures by machining, templating and lithographic techniques, whereas 'bottom-up', or molecular nanotechnology, applies to building organic and inorganic materials into defined structures, atom-by-atom or molecule-by molecule, often by selfassembly or self-organization. Biologists/chemists are involved in the synthesis of inorganic, organic, hybrid and metal nanomaterials for the use in nanodevices, the development of novel nanoanalytical techniques and the manipulation of biological systems for the synthesis of nanomaterials. Although physical and chemical methods are more popular in the synthesis of nanoparticles, the use of toxic chemicals greatly limits their biomedical applications, in particular in clinical fields. Therefore, development of reliable, nontoxic and eco-friendly methods for synthesis of nanoparticles is of utmost importance to expand their biomedical applications. One of the options to achieve this goal is to use fungi to synthesize nanoparticles. In this chapter, potential of fungi for the synthesis of nanoparticles in order to develop an efficient and environmental benign approach, to be used in medicine, agriculture and industries for variety of uses. Fungi are relatively recent in their use in synthesis of nanoparticles. The mycosynthesis of metal nanoparticles, or Myconanotechnology is defined as the fabrication of nanoparticles by fungi and their subsequent application, at the interface between mycology and nanotechnology and includes an exciting new applied interdisciplinary science with considerable potential due to the wide range and diversity of fungi (Rai et al., 2009a). The development of new biological techniques provided new ways to use fungi as microbial cell factories for the production of industrial products. Fungi are eukaryotic, organisms that are usually filamentous, branched somatic structures with hyphae surrounded by cell walls. Fungi can accumulate metals by physicochemical and biological mechanisms including extracellular binding by metabolites and polymers, binding to specific polypeptides and metabolism-dependent accumulation. Certain fungal species can readily synthesise metal nanoparticles extracellularly using high-levels of secreted proteins and/or enzymes that not only stabilize the particles but allows for an improved yield over an intracellular one (Riddin et al., 2006). An extracellular synthesis has obvious advantages over an intracellular process, when it comes to downstream processing, since there would be very little handling of the fungal biomass (Gade et al., 2008). In contrast, with an intracellular synthesis, sophisticated instruments are required to isolate the nanoparticles from the biomass and into the cell-free filtrate. These fungal systems or myconanofactories have already been exploited for the synthesis of metal nanoparticles. There has been a shift from bacteria to fungi to be used as natural nanofactories owing to easy downstream processing, easy handling (Mandal et al., 2006) and their ability to secrete a large amount of enzymes. However, fungi being eukaryotes are less amenable to genetic manipulation compared to prokaryotes. Therefore, any alteration of fungi at genetic level for synthesis of more nanoparticles would not be so easy. A good number of fungi have been shown to synthesize metallic nanoparticles. It is important to know

Fungi in Biosynthesis of Nanoparticles

319

the mechanism of synthesis of nanoparticles in fungal systems to get better control over shape, size and other desired properties of the synthesized nanomaterials. Mechanisms of Nanoparticle Formation by Fungi Nanoparticles produced by a biogenic enzymatic process are far more superior, in several ways, to those particles produced by chemical methods. The chemicals methods are able to produce large quantities of nanoparticles with a defined size and shape in a relatively short time, they are complicated, outdated, costly and inefficient and produce hazardous toxic wastes that are harmful, not only to the environment but also to human health. With an enzymatic process, the use of expensive chemicals is eliminated and the more acceptable "green" route is not as energy intensive as the chemical method and is also environment friendly. The "biogenic" approach is further supported by the fact that the majority of the fungi inhabit ambient conditions of varying temperatures, pH and pressure. The particles generated by these processes have higher catalytic reactivity, greater specific surface area, and an improved contact between the enzyme and metal salt. Nanoparticles are biosynthesized when the microorganisms grab target ions from their environment and then turn the metal ions into the element metal through enzymes generated by the cell activities. It can be classified into intracellular and extracellular synthesis according to the location where nanoparticles are formed (Simkiss and Wilbur, 1989; Mann, 2001). The intracellular method consists of transporting ions into the fungal hyphal cell to form nanoparticles in the presence of enzymes. The extracellular synthesis of nanoparticles involves trapping the metal ions on the surface of the cells and reducing ions in the presence of enzymes (Zhang, et al., 2011). Different fungal species have different mechanisms of forming nanoparticles. However, nanoparticles are usually formed following this way: metal ions are first trapped on the surface or inside of the cells. The trapped metal ions are then reduced to nanoparticles in the presence of enzymes. In general, fungi impact the mineral formation in two distinct ways. They can modify the composition of the solution so that it becomes super saturated or more super saturated than it previously was with respect to a specific phase. A second means by which microorganisms can impact mineral formation is through the production of organic polymers, which can impact nucleation by favoring (or inhibiting) the stabilization of the very first mineral seeds (Benzerara et al., 2010). The exact mechanism of nanoparticles formation by fungi was not fully understood. Therefore, common mechanisms are described for understand possible mechanism for some typical nanoparticles formation by fungi and bacteria but the fact that nanoparticles were formed on the surface of the mycelia and not in the solution supports the following hypothesis. For examples, gold or silver ions were first trapped on the surface of the fungal cells via electrostatic interaction between the ions and negatively charged cell wall from the carboxylate groups in the enzymes. Next, the enzymes reduced the metal ions to form gold or silver nuclei, which subsequently grow through further reduction and accumulation. Kalishwaralal et al. (2008) speculated that

320

Microbes: In Action

the nitrate reductase enzyme is involved in the synthesis of silver nanoparticles in bacteria. This enzyme is induced by nitrate ions and reduces silver ions to metallic silver. The possible mechanism that may involve the reduction of silver ions is the electron shuttle enzymatic metal reduction process. NADH and NADH-dependent nitrate reductase enzymes are important factors in the biosynthesis of metal nanoparticles. Some bacteriaare known to secrete the cofactor NADH and NADH-dependent enzymes, especially nitrate reductase, which might be responsible for the bioreduction of Ag+ to AgO and the subsequent formation of silver nanoparticles. The formation of heavy metallic nanoparticles can be attributed to the metallophilic microorganism's developed genetic and proteomic responses to toxic environments (Reith et al., 2007). Heavy metal ions, for example, Hg2+, Cd2+, Ag+, Co2+, CrO42+, Cu2+, Ni2+, Pb2+, and Zn2+, cause toxic effects to the survival of microorganisms. To counter these effects, microorganisms have developed genetic and proteomic responses to strictly regulate metal homeostasis (Nies et al., 1999). Microorganisms harbor numerous metal resistance gene clusters enabling cell detoxification via a number of mechanisms such as complexation, efflux or reductive precipitation. Hence metallophilic bacteria thrive in environments containing high concentrations of mobile heavy metal ions, such as mine waste rock piles, efflux streams of metal processing plants and naturally mineralized zones (Mergeay et al., 2003). The molecular mechanism of bacterial magnetic particle (BacMP) biomineralization is hypothesized to be a multistep process (Arakaki et al., 2008). The first step involves the invagin*tion of the cytoplasmic membrane and the vesicle formed serves as the precursor of the BacMP membrane. The mechanism of envelope formation, however, still remains unclear. It is most probable that the mechanisms of vesicle formation for magnetotactic bacteria are similar to most eukaryotes and that is a specific GTPase mediates the priming of the invagin*tion. The formed vesicles were then assembled into a linear chain along with cytoskeletal filaments. The second step of BacMP biomineralization involves the accumulation of ferrous ions into the vesicles by the transmembrane iron transporters. External iron is internalized by transport proteins and siderophores. The internal iron is controlled strictly by an oxidation-reduction system. In the final step, tightly bound BacMP proteins trigger magnetite crystal nucleation and/or regulate morphology. Various proteins associated with the BacMP membrane could play functional roles involved in magnetite generation. These include the accumulation of supersaturating iron concentrations, maintenance of reductive conditions and the oxidation of iron to induce mineralization or the partial reduction and dehydration of ferrihydrite to magnetite. Another possible mechanism for the synthesis of magnetites using Shewanella oneidensis, which consists of both passive and active mechanisms, was recently suggested by Perez- Gonzalec et al. (2010). First, active production of Fe2+ occurs when bacteria utilize ferrihydrite as a terminal electron acceptor and the pH value surrounding the cells rises probably due to the bacterial metabolism of amino acids. Then, through a passive mechanism, the localized concentration of Fe2+ and Fe3+ at the net negatively charged cell wall, cell structures, and/or cell debris induces a local rise of super saturation of the system with respect to magnetite, causing the

Fungi in Biosynthesis of Nanoparticles

321

magnetite phase to precipitate. Sanghi and Verma (2009) proposed that the formation of CdS nanoparticles is through disulfide (cystine) bridges and may be attributed to cleavage of S–H bond and formation of a new bond, i.e., –S–Cd bond of Cd-thiolate (Cd–S– CH2COOH) complex on the nanoparticle surface. The –COOH groups from the cadmium-thiolate complexes do not react with the –NH2 groups of protein but interact with hydrogen bond. Therefore, the capped CdS nanoparticles are bonded to –NH2 groups by hydrogen bond (Tang et al., 2005). One of the oxygen atoms of the carboxylic group (–COOH) formed the coordinate bond between the oxygen atom and Cd2+ ions (Lover et al., 1997), thus competing with the thiol group to assemble onto the surfaces of the CdS nanoparticles. Nanoparticle formation was visually observed by the colour of the extracellular solution and the fungal biomass turning from yellow to dark-brown and their concentration was determined from the amount of residual hexachloroplatinic acid measured from a standard curve at 456 nm. The importance of pH, temperature and hexachloroplatinic acid (H2PtCl6) concentration in nanoparticle formation was examined through the use of a statistical response surface methodology (Riddin et al., 2006). Control of Size and Morphology of Nanoparticles It is well known that the electronic and optical properties of nanoparticles are heavily dependent on their size and shape. Thus, there has been tremendous interest in controlling the size, shape, and surrounding media of nanoparticles. Particular emphasis has recently been placed on the control of shape, because in many cases it allows properties to be fine-tuned with a great versatility that gives the particles a unique nature (Tran et al., 2013). The rate of particle formation and the particle size controlled by parameters such as pH, temperature, concentration, and exposure time. Under these optimum conditions, very less time require to use the culture supernatant. Various particle morphologies including spherical, triangular, hexagonal, and other shapes are formed. This is comparable to or faster than the synthesis rate of similar particles obtained using chemical methods. Characterization of Nanoparticles Dynamic Light Scattering (DLS) Analysis The particle size distribution of nanoparticles are monitored using Dynamic Light Scattering (DLS) measurements which determines particle size by measuring the rate of fluctuations in the laser light intensity scattered by particles as they diffuses through solvent. Particle size analyzer is used for size measurement and confirmation of nanoparticles size distribution. Transmission Electron Microscopy (TEM), High Resolution Transmission Electron Microscopy (HR-TEM) and selected area electron diffraction (SAED) Analysis Confirmation of size and shape of nanoparticles, transmission electron microscope (TEM) measurements are carried out using drop coating method in which a drop of solution containing nanoparticles are placed on the carbon coated copper grids and kept under vacuum desiccation for overnight before loading them onto a specimen holder. TEM and HR-TEM micrographs of the

322

Microbes: In Action

sample are taken. TEM instrument also having selected area electron diffraction (SAED) attachment. The instrument is operated at an accelerating voltage of 200 kV. Scanning Electron Microscopy (SEM) Analysis SEM was extremely useful for the determination of topology and observations of surfaces as they offer better resolution and depth of field than optical microscope. Micrographs of the biologically synthesized samples are taken using the SEM instrument. The instrument is operated at an accelerating voltage of 30 kV. Atomic Force Microscopy Analysis To study near-atomic-resolution with 3D surface topography, Scanning probe microscope in atomic force, tapping mode with closed loop 5 X5 μm scanner are used. X-Ray Diffraction (XRD) Analysis The crystal structure and size confirmation are examined by XRD analysis. XRD analyses of nanoparticle are carried out by thin film mode of XRD using PAN analytical system operated at 20 kV voltages and a current of 15 mA with Cu Kα radiations. Atomic Force Microscopy (AFM) Analysis To study near-atomic-resolution with 3D surface topography, scanning probe microscope in atomic force, tapping mode with closed loop 5×5 micron scanner are used. Electron Dispersive X-Ray Spectroscopy (EDS) X-Ray Spectroscopy Analysis EDS used particularly for elemental composition analysis, samples are prepared on a carbon coated copper grids and kept under vacuum desiccation for three hours before loading them onto a specimen holder. Elemental analyses on single particles are carried out using EDS attachment equipped with TEM. It is performed for determination of the elemental composition and purity of the sample by atom% of metal. Biosynthesis of Nanoparticles Mycologists become more and more interested in the interaction between inorganic molecules and fungal species. Microorganisms like fungi having naturally bestowed property of reducing and oxidizing metal ions nanoparticles (Nair and Pradeep, 2002; Shankar et al., 2003; Lengke et al., 2006; Gade, et al., 2010; Jain et al., 2013). Studies have found that many fungi can produce inorganic nanoparticles through either intracellular or extracellular routes. Therefore, production of various nanoparticles via biological methods following the categories of metallic nanoparticles including gold, silver, alloy and other metal nanoparticles, oxide nanoparticles consisting of magnetic and nonmagnetic oxide nanoparticles, sulfide nanoparticles, and other miscellaneous nanoparticles are reviewed.

Fungi in Biosynthesis of Nanoparticles

323

Metallic Nanoparticles Silver nanoparticles have broad applications in nonlinear optics, spectrally selective coatings for solar energy absorption, therapeutic and industrial areas as catalyst, cryogenic superconductor, biosensor, microelectronic, biolabeling, degrading pesticides, filters, antimicrobial agents, and killing human pathogenic bacteria owing to its high surface area to volume size ratio (Ahmad et al., 2003; Kuber and D'Souza, 2006; Marcato and Duran, 2008; Rai et al., 2009; Durán et al., 2010). Several protocols have been developed to obtain for synthesis of silver nanoparticles using fungi (Kowshik, et al., 2003; Duran, et al., 2009; Shaligram, et al., 2009; Varshney et al., 2009). But there is a need for a rapid, economically chief and environmentally safe protocol for biosynthesis of silver nanoparticles from a potential fungal nanofactory. Sastry et al. (2003) reported the intracellular synthesis of silver nanoparticles of 2–25 nm within Verticillium with the deposits of the metal clearly bound to the surface of the cytoplasmic membrane. Raliya and Tarafdar (2012) reported biosynthesis of metal nanoparticle by a fungus Aspergillus terreus. Extracellular secreting enzymes are produced by A. terreus which reduce the metal salt of macro or micro scale into nano scale diameter through catalytic effect. Extracellular secretion of enzymes offers the advantage to obtain pure, monodisperse nanoparticles, which are free from cellular components, associated with organisms and easy down-stream processing. An extracellular synthesis of 60–80 nm silver nanoparticles has been achieved with the fungus Phoma when the fungal cell filtrate was exposed to an aqueous silver nitrate solution at room temperature (Chen et al., 2003; Birla et al., 2009). Similarly the soil-borne Aspergillus produced silver nanoparticles, both extracellularly (Bhainsa and d'Souza 2006; Gade et al., 2008) and intracellularly (Vigeshwaran et al., 2007) after exposure to aqueous silver ions. Both Duran et al. (2005) and Ahmad et al. (2003) reported that aqueous silver ions, when exposed to the fungus Fusarium oxysporum, are reduced by a nitrate dependent reductase quinone process, leading to the formation of 10–30 nm silver nanoparticles stabilized by proteins secreted by the fungus. Mohammadian et al. (2007) have reported a rapid photobiological approach to generate silver nanoparticles of 10–60 nm from several strains of F. oxysporum in the presence of a conventional 90,000 lux halogen-tungsten lamp. This opened up new horizons in the combinatorial synthesis of nanoparticles as the method produced nanoparticles in less than 1 h, compared to 96 h without the halogen tungsten lamp. Response surface methodology (RSM) was used to investigate factors of pH, temperature, agitation rate, incubation time, silver salt concentration and weight of fungal biomass on the formation of silver nanoparticles (Karbasian et al., 2008). Basavaraja et al. (2008), Ingle et al. (2008, 2009), Balaji et al. (2009) and Mukherjee et al. (2008) used F. semitectum, F. acuminatum, F. solani, Cladosporium cladosporioides and Trichoderma asperellum respectively for the extracellular synthesis of 4–100 nm polydispersed spherical silver nanoparticles from an aqueous solution of a silver salt. These particles were often stabilized with the use of binding proteins as capping ligands. Silver nano Particles were synthesized in the form of a film or produced in solution or accumulated on the surface of its cell when fungi, Verticillium, F. oxysporum, or Aspergillus flavus, were

324

Microbes: In Action

employed (Jain et al., 2013; Vigneshwaran et al., 2007; Bhainsa and D'Souza, 2006). Biosynthesis of nanoparticles is a kind of bottom up approach where the main reaction occurring is reduction/oxidation. The fungal enzymes or reducing properties are usually responsible for reduction of metal compounds into their respective nanoparticles. The biosynthesis of gold nanoparticles that is reliable, environmentally friendly and lends itself to applications in biomedical, bioengineering, electronic and environmental systems. The extracellular synthesis of gold nanoparticles was carried out by exposure of a precursor salt aqueous HAuCl4 solution of 0.1 mM concentration to fungal cell-free filtrate obtained by incubating the fungus in an aqueous solution. Raliya and Tarafdar (2013a) reported bioynthesis of gold nanoparticles using Rhizoctonia bataticola. Mukherjee et al. (2002) reported extracellular synthesis of gold nanoparticles by fungus F. oxysporum. Mukherjee et al. (2001) also reported the intracellular synthesis of gold nanoparticles by fungus Verticilliumsp. Sastry et al.(2003) reported an extracellular synthesis of 7–12 nm monodisperse gold nanoparticles when the fungus Thermomonospora was exposed to aqueous gold ions. Ahmad et al. (2005) reported the ability of fungus Trichothecium for the synthesis of gold nanoparticles both intra and extracellularly while Colletotrichum produced 20–40 nm decahedral and icosahedral gold nanoparticles when exposed to chloroaurate ions (Shivshankar et al., 2003). Magnesium and Iron are essential either as structural components or as enzyme co-factors for plant metabolism. The development of nanoscale particles of Mg, Fe or their oxides may therefore help in triggering the metabolic pathways leading to better growth and higher yields of plants. The benefits of nanoparticles over conventional fertilizers may be two-fold first, due to small size they may have better permeability into a plant system and can be effective in extremely low doses and second, availability of high surface area may provide more reaction sites resulting in increased photosynthetic efficiency of plants, leading to higher productivity per unit of land and energy. Besides, their application may also help in minimizing the deleterious effects of conventional fertilizers on biotic and abiotic environment over a period of time. The concept of nanonutrients is relatively new in plant sciences. Harnessing their potential for achieving higher nutrient use efficiency in plants is likely to be one of the research areas in the coming years. So far, very few attempts have been made to produce nanoparticles of these elements or their oxides through biological means. Response of five fungi to different salts of magnesium and iron for production of nanoparticles was studied by Kaul et al. (2012). Pochonia chlamydosporium induces development of extracellular nanoparticles in MgCl2 solution while Aspegillus fumigatus produces intracellular nanoparticles in MgSO4 solution. C. globosum was found as the most effective in producing nanoparticles when exposed to Fe2O3 solution. The FTIR analysis of the nanoparticles obtained from Fe2O3 solution showed the peaks similar to iron. Alloy Nanoparticles Alloy nanoparticles are of great interest due to their applications in catalysis,

Fungi in Biosynthesis of Nanoparticles

325

electronics, as optical materials, and coatings (Senapati et al., 2005; Zheng et al., 2010). Senapati et al. (2005) reported the synthesis of bimetallic Au-Ag alloy by F. oxysporum and argued that the secreted cofactor NADH plays an important role in determining the composition of Au-Ag alloy nanoparticles. Zheng et al.(2010) studied Au-Ag alloy nanoparticles biosynthesized by yeast cells. Fluorescence microscopic and transmission electron microscopic characterizations indicated that the Au-Ag alloy nanoparticles were mainly synthesized via an extracellular approach and generally existed in the form of irregular polygonal nanoparticles. Electrochemical investigations revealed that the vanillin sensor based on Au-Ag alloy nanoparticles modified glassy carbon electrode was able to enhance the electrochemical response of vanillin for at least five times. Sawle et al. (2008) demonstrated the synthesis of core-shell AuAg alloy nanoparticles from fungal strains Fusarium semitectum showed that the nanoparticle suspensions are quite stable for many weeks. Non Metallic Nanoparticles The development of novel material, opens new exiting possibilities in the scientific breakthrough. Nanoscale materials, particles and composite consist of other than metal such as carbon, oxides, dendrimers, lipid based, metabolites are considered as non-metal nanoparticles (Maynard et al., 2006, Tarafdar et al., 2013a). Owing to their relatively low toxicity profile than metal nanoparticles, having great attention for wide biological applications (Wu et al., 2010). Since many years, DNA, lipid and chitosan based nanomaterials (Fig. 1) are being used for oral gene delivery in order to molecular immune remedy (Roy et al., 1999; Patil et al., 2005; Mansouri et al., 2006). In the continuum of nonmetal nanoparticles, the unique and tunable properties of carbon-based nanomaterials enable new technologies for identifying and addressing energy and environmental challenges. Carbon is arguably the most fascinating element in the periodic table. It is the base for DNA and all life on Earth. Carbon can exist in several different forms. The most common form of carbon is graphite, which consists of stacked sheets of carbon with a hexagonal structure known as graphene. In particular, graphene, an advance nanomaterial used broadly as sorbents, high-flux membranes, depth filters, antimicrobial agents, environmental sensors, renewable energy technologies, and pollution prevention strategies. The major problem to scale up the process of graphene is restacking and conversion back to graphite. Therefore, Scientist came with a possible solution to solve the restacking issue of graphene oxide nanosheets during large-scale production is to turn the two-dimensional (2D) nanosheets into three-dimensional (3D) crumpled balls that have excellent compressive properties but still maintain high free volumes (Fig. 2).

326

Microbes: In Action

FIG. 1: Biological entities used as potential nonmetal nanotechnology tool in nanomedicine (Conde, et al., 2014)

FIG. 2: Morphology evolution of GO particles as a function of furnace temperature. (a–d) FESEM images and (e–h) corresponding TEM images. (a,e) 200 °C, (b,f) 400 °C, (c,g) 800 °C, and (d,h) 1000 °C. The spherical inset at each condition is the corresponding igital photo of GO collected on a filter. Individual crumpled GO particles are highlighted in panels b (gold) and c (aqua).(Wang, et al., 2012)

In linking technological advance back to the physical, chemical, and electronic properties of carbonaceous nanomaterials (Wang, 2005; Mauter and Elimelech, 2008; Bartelmess et al., 2015, Titirici et al., 2015). In recent, nonmetal, mineral nanoparticles such as calcium carbonate and phosphorous are used for medicinal and agricultural purposes (Fujiwara et al., 2008; Chaudhury et al., 2014). In conclusion, nonmetal nanoparticles are used extensively mainly for three reasons (1) easy to scale up (2) tunable properties (3) more biocompatibility with biological interface. Phosphorus is a major component of many cell constituents and plays a vital role in several key processes, including photosynthesis, respiration, energy

Fungi in Biosynthesis of Nanoparticles

327

storage and transfer, cell division, membrane synthesis and stability, enzyme activation and inactivation, redox reactions, cellular transporters, cellular signal cascade pathway, nitrogen fixation and cell enlargement (Vance, 2011). As a mineral, P is found mostly in oxidized state as inorganic rock phosphate which is partially made of apatite. More than 90 per cent of the globally mined rock phosphate is used as fertilizer in the agricultural sector and required essentially for higher food production. However, rock phosphorus is a limited resource and according to studies on remaining phosphates reserves, phosphorus will reach at the climax stage in a very near time scale (Cordell et al., 2011; Neset and Cordell, 2012). The continuous production of phosphorus is based only on nonrenewable resources, results in significantly increased cost and availability for future. So there is an urgent need to develop a technology for efficient P utilization and its sustainability. Hence explore a rapid, cost effective, ecofriendly and readily reproducible approach for the purpose of scale-up and subsequent easy downstream processing for the production of efficient phosphorous nanoparticle using tri calcium phosphate (Ca3P2O8). An effort to understand the nano-transformation mechanism has also been made. Synthesis of phosphorous nanoparticle using cell free extra cellular secrets in tri calcium phosphate salts. Extracellular secretion of enzymes offers the advantage to obtain pure, monodispese nanoparticles, which are free from cellular components, associated with downstream processing. In the microbial synthesis of phosphorous nanoparticles involves an enzyme mediated process which is present in extracellular secrets and another protein mentioned as capping protein play role in the further encapsulation of phosphorous nanoparticles and increase stability. Tarafdar et al. (2012) synthesized phosphorous nanoparticle from tri-calcium phosphate using Aspergillus tubingensis TFR-5. Nanoparticles of varying size (10–100 nm) and shape (hexagons, pentagons, circles, squares, rectangles) were produced at both intra- and extracellular levels by the F. oxysporum. Bansal et al. (2007) reported that fungal enzymes secreted from F. oxysporum selectively bioleached silicates, present in zircon sand, into silicic acid and, subsequently into silica nanoparticles. Exposure of F. oxysporum to an aqueous solution of K2ZrF6, at room temperature, resulted in its proteinmediated extracellular hydrolysis, to form crystalline zirconia nanoparticles. They also reported synthesis of 5–15 nm silica by F. oxysporum, when the cell filtrate was challenged with the salts K2SiF6. Further, they confirmed the presence of proteins as capping agents for stabilization of these nanoparticles. Oxide Nanoparticles Oxide nanoparticle is an important type of compound nanoparticle synthesized by fungi. In this section, we reviewed the biosynthesized oxide nanoparticles from the two aspects: magnetic oxide nanoparticles and nonmagnetic oxide nanoparticles. Magnetic nanoparticles are recently developed new materials, due to their unique micro configuration and properties like super paramagnetic and high coercive force, and their prospect for broad applications in biological separation and biomedicine fields. Magnetic nanoparticles like Fe3O4 (magnetite) and Fe2O3 (maghemite) are known to be biocompatible. They have been actively investigated for targeted cancer treatment (magnetic

328

Microbes: In Action

hyperthermia), stem cell sorting and manipulation, guided drug delivery, gene therapy, DNA analysis, and magnetic resonance imaging (Fan et al., 2009) Titanium is a strong, lustrous, corrosion resistant metal. Its common compound, titanium di-oxide, is a photo-catalyst, and is used in manufacture of pigments. In plants, titanium stimulates production of more carbohydrate, encourage growth and photosynthesis rate (Owolade et al., 2008). Photo catalytic degradation of pesticides with TiO2 and other catalyst has shown promise as potential water remediation method (Lee et al., 2003). Hence there was an increased demand to develop a high yielding, low cost, non toxic and mono-disperse nanoparticles leads to exploit biological systems (Raliya and Tarafdar, 2012). Biological methods for nanoparticle synthesis may circumvent many of the detrimental features by enabling synthesis at mild pH, pressure, temperature and at a substantially lower cost (Raut et al., 2009). An attempt was made to eco-friendly, rapid, low cost synthesis of titanium dioxide, its characterization and role on photosynthesis. Tarafdar et al. (2013b) synthesized TiO2 nanoparticle from precursor salt soluction of TiO2 by employing Aspergillus tubingensis. Jha et al. (2009) have reported on the synthesis of TiO2 nanoparticles from S. cerevisiae. In biological systems, zinc plays significant roles in a wide variety of metabolic processes such as carbohydrate, lipid, nucleic acid, and protein synthesis as well as their degradation. In addition, zinc is an integral component of many enzyme structures and is the only metal to be represented in all six enzyme classes viz. oxidoreductases, transferases, hydrolases, lyases, isomerases, and ligases (Auld, 2001). Zinc is one of the essential nutrients required for plant growth. Its important role can be adjudged as it controls the synthesis of indole acetic acid (IAA), a phytohormone which dramatically regulates the plant growth. It is also necessary for the chlorophyll synthesis and carbohydrate formation (Vitosh et al., 1994). It enables the plants to withstand lower air temperatures and helps in the biosynthesis of cytochrome, a pigment that maintains the plasma membrane integrity and the synthesis of leaf cuticle. The improvement of Zn nutritional status also reduces the uptake of harmful heavy metals, i.e., hinders their toxicity in plants, such as Cd (Adiloglu, 2002). As Zn is the structural component of P mobilizing phosphatase and phytase enzymes, it can be hypothesized that application of nanoZnO may help in more secretion of P-mobilizing enzymes, which is involved in native P mobilization for plant nutrition from unavailable organic sources (Tarafdar and Classen, 2003). Raliya and Tarafdar (2013b) synthesized ZnO nanoparticles from ZnNO3 using extracellular secretions of Aspergillus fumigatus TFR-8. Beside magnetic oxide nanoparticles, other oxide nano particles have also been studied including Sb2O3, SiO2, BaTiO3, and ZrO2 nanoparticles (Bansal et al., 2004; Bansal et al., 2005; Bansal et al., 2006; Jha et al., 2009; Jha and Prasad, 2010; Narayanan et al.,2010). Jha et al. (2009) found a green low-cost and reproducible Saccharomyces cerevisiae mediated biosynthesis of Sb2O3 nanoparticles. The synthesis was performed akin to room temperature. Analysis indicated that Sb2O3 nanoparticles unit was a spherical aggregate having a size of 2–10nm. Bansal et al.(2005) used F. oxysporum to produce SiO2 and TiO2 nanoparticles from aqueous anionic complexes SiF62−and TiF6 2−, respectively.

Fungi in Biosynthesis of Nanoparticles

329

Bansal et al. (2004) and Bansal et al. (2006) also prepared tetragonal BaTiO3 and quasispherical ZrO2 nanoparticles from F. oxysporum with a size range of 4-5nm and 3–11 nm, respectively. In addition to oxide nanoparticles, sulfide nanoparticles have also attracted great attention in both fundamental research and technical applications as quantum-dot fluorescent biomarkers and cell labeling agents because of their interesting and novel electronic and optical properties (Yang et al., 2005). Dameron et al. (1989) have used S. pombe and C. glabrata (yeasts) to produce intracellular CdS nanoparticles with cadmium salt solution. CdS nanocrystal is one typical type of sulfide nanoparticle. Some stable metal sulfide nanoparticles, such as CdS, ZnS, PbS and MoS2 can be produced extracellularly by the fungus F. oxysporum when exposed to aqueous solution of metal sulfate. The quantum dots were formed by the reaction of Cd2+ ions with sulfide ions which were produced by the enzymatic reduction of sulfate ions to sulfide ions. Other Nanoparticles Besides various nanoparticles, fungi produce different metal sulphides and metal oxides nanoparticles. In addition to nanoparticles mentioned above PbCO3, CdCO3, SrCO3, PHB, Zn3(PO4)2, and CdSe nanoparticles were reported. SrCO3 crystals were obtained when challenging fungi were incubated with aqueous Sr2+ ions (Rautaray et al., 2004). Kumar et al. (2007) showed that highly luminescent CdSe quantum dots can be synthesized by F. oxysporum at room temperature. Haverkamp et al. (2007) reportedCandida glabrata on exposure to Cd2+ Ions afforded an intracellular formation of CdS nanoparticles. Similarly, Schizosaccharomyces pombe produced 2–2.5 nm CdS nanoparticles and Torulopsis produced 2–5 nm PbS nanoparticles intracellularly. Bansal et al. (2007) reported synthesis of 5–15 nm titania nanoparticles by F. oxysporum, when the cell filtrate was challenged with the salts K2TiF6. Even more exciting is the finding that the exposure of F. oxysporum to the aqueous CdSO4 solution yields CdS quantum dots extracellularly (Ahmad et al., 2002). FUTURE PERSPECTIVE The fungi are now well established as suitable system for the synthesis of different kinds on nanomaterials with great potential and promise with their applications over the last decade. However, much work is needed to improve the synthesis efficiency and the control of particle size and morphology. Therefore, effective control of the particle size and monodispersity must be extensively investigated. Several studies have shown that the nanoparticles formed by fungi may be decomposed after a certain period of time. Thus, the stability of nanoparticles produced by biological methods require further study. By varying parameters like growth stage (phase), growth medium, synthesis conditions, pH, substrate concentrations, source compound of target nanoparticle, temperature, reaction time, and addition of nontarget ions, it might be possible to obtain sufficient control of particle size and monodispersity. In the last few years, there has been a less investment in research and development in the field of myconanotechnology. This is a serious problem to introducing new biology in commercial sector while the global nanotechnology

330

Microbes: In Action

market had been touched, approximately US$ 29 billion by 2010 (Subramanian and Tarafdar, 2011). The exponential growth of global investments in nanotechnology research can be directly corresponding with the number of patents filing related to technology and products developed from nanotechnology and nanoscience. Global market forecasts indicating US$ 1880 billion investments in nanotechnology industries by 2015. In India, myconanotechnology has already made some impressive innovative research but still in its infancy. CONCLUSION/ SUMMARY Innovative approach for the biosynthesis of nanoparticles by fungi is thought to be clean, nontoxic, and environmentally acceptable "green chemistry" procedures. They are easy to cultivate, reliable, eco-friendly and extremely costeffective and less time consuming. The use of fungi can be classified into intracellular and extracellular synthesis according to the location where nanoparticles are formed. The rate of nano particle formation and size of the nanoparticles can be controlled parameters such as pH, temperature, substrate concentration, and exposure time to substrate. The characterization techniques (DLS, TEM, HR-TEM, AFM etc) should validate biotransformation of nanoparticles for confirmation of size, shape, surface structure and crystalline nature of nanoscale particles. Implementation of these novel approaches at commercial scale shall open up new opportunities in the fields of medicine, agriculture, industries and environment. REFERENCE Adiloglu A (2002). The effect of zinc (Zn) application on uptake of cadmium (Cd) in some cereal species. Arch Agron Soil Sci. 48:553-556 Ahmad A, Mukherjee P and Mandal D (2002). Enzyme mediated extracellular synthesis of CdS nanoparticles by the fungus Fusarium oxysporum. J Am Chem Soc. 41: 12108-12109 Ahmad A, Mukherjee P, Mandal D, Senapati S, Khan MI, Kumar R and Sastry M (2002). Enzyme mediated extracellular synthesis of CdS nanoparticles by the fungus Fusarium oxysporum. J Am Chem Soc. 124:12108-12109 Ahmad A, Mukherjee P and Senapati S (2003). Extracellular biosynthesis of silver nanoparticles using the fungus Fusarium oxysporum. Coll Surf B Biointerfaces. 28: 313-318 Ahmad A, Senapati S, Khan MI, Kumar R and Sastry M (2005). Extra-/intracellular biosynthesis of gold nanoparticles by an alkalotolerant fungus Trichothecium sp. J Biomed Nanotechnol. 1:47-53 Ahmad P, Mukherjee S, Senapati D, Mandal M, Khan I, Kumar R and Sastry M (2003). Extracellular biosynthesis of silver nanoparticles using the fungus Fusarium oxysporum . Colloids Surf B 28: 313-315 Ajayan PM, Schadler LS and Braun PV (2003). Nanocomposite. Science and Technology. Wiley. pp. 239 Ameena S, Akhtarb MS, Seoc KK, Kima YS and Shina HS (2012). Influence of Sn doping on ZnO nano structures from nanoparticles to spindle shape and their hotoelectrochemical properties for dye sensitized solar cells. Chemical Engineering Journal.187: 351-356 Arakaki A, Nakazawa H, Nemoto M, Mori T and Matsunaga T (2008). Formation of magnetite by bacteria and its application. Journal of the Royal Society Interface. 26: 977-999 Auld DS (2001). Zinc coordination sphere in biochemical zinc sites. Biometals 14:271-313

Fungi in Biosynthesis of Nanoparticles

331

Balaji DS, Basavaraja S, Deshpande R, Mahesh DB, Prabhakar BK and Venkataraman A (2009). Extracellular biosynthesis of functionalized silver nanoparticles by strains of Cladosporium cladosporioides fungus. Coll Surf B Biointerfaces. 68:88-92 Bansal V, Rautaray D, Ahmad A and Sastry M (2004). Biosynthesis of zirconia nanoparticles using the fungus Fusarium oxysporum. Journal of Materials Chemistry. 22:3303-3305 Bansal V, Rautaray D and Bharde A (2005). Fungus-mediated biosynthesis of silica and titania particles. Journal of Materials Chemistry. 26:2583-2589 Bansal V, Syed A, Bhargava SK, Ahmad A and Sastry M (2007). Zirconia enrichment in zircon sand by selective fungus mediated bioleaching of silica. Langmuir. 23:4993-4998 Bansal VP, Oddar P, Ahmad A and Sastry M (2006). Room temperature biosynthesis of ferroelectric barium titanate nanoparticles. Journal of the American Chemical Society. 36: 11958-11963 Bartelmess J, Quinn S and Giordani S (2015). Carbon nanomaterials: Multi-functional agents for biomedical fluorescence and raman imaging. Chemical Society Rev. DOI: 10.1039/C4CS00306C Basavaraja S, Balaji SD, Legashetty A, Rasab AH and Venkatraman A (2008). Extracellular biosynthesis of silver nanoparticles using the fungus Fusarium semitectum. Mater Res Bull. 43:1164-1170 Benzerara K, Miot J, Morin G, Ona-Nguema G, Skouri-Panet F and F'erard C (2010). Significance, mechanisms and environmental implications of microbial biomineralization. Comptes Rendus Geoscience. 343: 160-167 Bhainsa KC and D'Souza SF (2006). Extracellular biosynthesis of silver nanoparticles using the fungus Aspergillus fumigatus. Colloids and Surfaces B. 47:160-164. Birla SS, Tiwari VV, Gade AK, Ingle AP, Yadav AP and Rai MK (2009). Fabrication of silver nanoparticles by Phoma glomerata and its combined effect against Escherichia coli, Pseudomonas aeruginosa and Staphylococcus aureus. Letts App. Microbiol. 48: 173-179 Chaudhury K, Kumar V, Kandasamy J and Roychoudhury S (2014). Regenerative nanomedicine: Current perspectives and future directions, International journal of nanomedicine. 9: 4153-4154 Chen JC, Lin ZH and Ma XX (2003). Evidence of the production of silver nanoparticles via pretreatment of Phoma sp. 3.2883 with silver nitrate. Lett Appl Microbiol. 37:105-108 Conde J, Dias JT, Grazu V, Moros M, Baptista PV and De La Fuente JM (2014). Revisiting 30 years of biofunctionalization and surface chemistry of inorganic nanoparticles for nanomedicine. Front Chem. 2: 48 doi: 10.3389/fchem.2014.00048 Cordell D, Rosemarin A, Schroder JJ and Smit AL (2011). Chemosphere Special Issue on Phosphorus. Chem Rev. 84: 747-750 Dameron CT, Reese RN and Mehra RK (1989). Biosynthesis of cadmium sulphide quantum semiconductor crystallites. Nature. 6216:596-597 Daniel MC and Astruc D (2004). Gold nanoparticles: assembly, supramolecular chemistry, quantum-size-related properties, and applications toward biology, catalysis and nanotechnology. Chem Rev. 104: 293-346 Duran N, Marcato PD, Conti RD, Alves OL, Costa FTM and Brocchi MJ (2010). Potential use of silver nanoparticles on pathogenic bacteria, their toxicity and possible mechanisms of action. Braz Chem Soc. 21: 949-951 Duran N, Marcato PD, De Souza GIH, Alves OL and Esposito E (2009). Mechanistic aspects of biosynthesis of silver nanoparticles by several Fusarium oxysporum strains. J Biomed Nanotechnol. 5: 247 -249 Duran N, Marcato PD, Alves OL, D'Souza G, Esposito E (2005). Mechanistic aspects of biosynthesis of silver nanoparticles by several Fusarium oxysporum strains. J Nanobiotechnol. 3:8-14 Fan TX, Chow SK and Zhang D (2009). Biomorphic mineralization: from biology to materials. Progress in Materials Science. 54: 542-659 Fujiwara M, Shiokawa K, Morigaki K, Zhu Y and Nakahara Y (2008). Calcium carbonate microcapsules encapsulating biomacromolecules. Chemical Engineering Journal. 137: 1422

332

Microbes: In Action

Gade A, Ingle A, Whiteley CG and Rai M (2010). Mycogenic metal nanoparticles: progress and applications. Biotechnol Lett. 32: 593 Gade AK, Bonde P, Ingle AP, Marcato PD, Duran N and Rai MK (2008) Exploitation of Aspergillus niger for synthesis of silver nanoparticles. J Biobased Mater Bioener. 2:243-247 Haverkamp RG, Agterveld DV and Marshall AT (2007). Pick your carats: nanoparticles of gold-silver copper alloy produced in vivo. J Nanopart Res. 9:697-700 Hu MS, Chen HL, Shen CH, Hong LS, Huang BR, Chen KH and Chen LC (2006). Photosensitive gold-nanoparticle-embedded dielectric nanowires. Nature Materials. 5: 102 -106 Ingle A, Gade A, Bawaskar M and Rai M (2009). Fusarium solani: a novel biological agent for the extracellular synthesis of silver nanoparticles. J Nanopart Res. 11:2079-2085 Ingle A, Gade A, Pierrat S, Sonnichsen C and Rai M (2008). Mycosynthesis of silver nanoparticles using the fungus Fusarium acuminatum and its activity against some human pathogenic bacteria. Curr Nano. 4:141-144 Jain N, Bhargava A, Tarafdar JC, Singh SK and Panwar J (2013). Abiominetic approach towards synthesis of zinc oxide nanoparticles. Applied Microbiology and Biotechnology. 97: 859-869 Jha AK and Prasad K (2010). Ferroelectric BaTiO3 nanoparticles: biosynthesis and characterization. Colloids and Surfaces B. 75: 330-334 Jha AK, Prasad K and Prasad K (2009) A green low-cost biosynthesis of Sb2O3 nanoparticles. Biochemical Engineering Journal. 43: 303-306 Jha AK, Prasad K and Kulkarni AR (2009). Synthesis of TiO2 nanoparticles using microorganisms. Coll Surf B Biointerfaces. 71:226-229 Kalishwaralal K, Deepak V, Ramkumarpandian S, Nellaiah H and Sangiliyandi G (2008). Extracellular biosynthesis of silver nanoparticles by the culture supernatant of Bacillus licheniformis. Materials Letters. 29:4411- 4413 Karbasian M, Atyabi SM, Siadat SD, Momem SB and Norouzian D (2008). Optimizing nanosilver formation by Fusarium oxysporum (PTCC 5115) employing response surface methodology. Am J Agric Bio Sci. 3:433-437 Kaul RK, Kumar P, Burman U, Joshi P, Agrawal A, Raliya R and Tarafdar JC (2012). Magnesium and iron nanoparticles production using microorganisms and various salts. Materials Science. 30: 254-258 Kowshik M, Ashtaputre S, Kharraz S, Vogel W, Urban J, Kulkarni SK and Paknikar KM (2003). Extracellular synthesis of silver nanoparticles by a silver-tolerant Yeast strain MKY3. Nanotechnology. 14: 95-100 Kuber CB and D'Souza SF (2006). Extracellular biosynthesis of silver nanoparticles using the fungus Aspergillus fumigatus. Coll Surf B Biointerfaces. 47:160-164 Kumar SA, Ansary A, Abroad A and Khan MI (2007). Extracellular biosynthesis of CdSe quantum dots by the fungus Fusarium oxysporum. Journal of Biomedical Nanotechnology. 2:190-194 Lee DJ, Senseman SA, Sciumbato AS, Jung S and Krutz LJ (2003). The Effect of Titanium dioxide Alumina beands on the Photocatalytic Degradation of Picloram in Water. J Agri Food Chem. 51: 2659-2664 Lengke M, Fleet ME and Southam G (2006). Synthesis of platinum nanoparticles by reaction of filamentous cyanobacteria with platinum (IV)-chloride complex. Langmuir..22: 73187328 Lover T, Henderson W, Bowmaker GA, Seakins JM and Cooney RP (1997). Functionalization and capping of a cds nanocluster: a study of ligand exchange by electrospray mass spectrometry. Chemistry of Materials. 8:1878-1886 Mandal D, Bolander ME, Mukherjee P, Mukhopadhyay D and Sarkar G (2006). The use of microorganisms for the formation of metal nanoparticles and their application. Appl Microbiol Biotechnol. 69:485-492 Mann S (2001). Biomineralization: Principles and Concepts in Bioinorganic Materials Chemistry. Oxford University Press, Oxford, UK.

Fungi in Biosynthesis of Nanoparticles

333

Mansouri S, Cuie Y, Winnik F, Shi Q, Lavigne P, Benderdour M, Beaumont E and Fernandes JC (2006). Characterization of folate-chitosan-DNA nanoparticles for gene therapy. Biomaterials. 27: 2060-2065 Marcato PD and Duran NJ (2008). New aspects of nanopharmaceutical delivery system. Nanosci Nanotechnol. 8: 2216-2229 Mauter MS and Elimelech M (2008). Environmental applications of carbon-based nanomaterials. Environmental Science and Technology. 42: 5843-5859 Maynard A, Aitken RJ, Butz T, Colvin V, Donaldson K, Oberdorster G, Philbert MA, Ryan J, Seaton A and Stone V (2006). Safe handling of nanotechnology. Nature. 444: 267 Mergeay M, Monchy S and Vallaeys T (2003). Ralstonia metallidurans, a bacterium specifically adapted to toxic metals: towards a catalogue of metal-responsive genes. FEMS Microbiology Reviews. 27: 385-410 Mohammadian A, Shojaosadati SA and Habibi-Rezaee M (2007). Fusarium oxysporum mediates photogeneration of silver nanoparticles. Scientia Iranica 14:323-326 Mukherjee P, Ahmad A and Mandal D (2001). Bioreduction of AuCl4 ions by the fungus, Verticillium sp. and surface trapping of the gold nanoparticles formed. Angewandte Chemie. 40: 3585-3588 Mukherjee P, Roy M, Mandal BP, Dey GK, Mukherjee PK, Ghatak J, Tyagi AK and Kale SP (2008). Green synthesis of highly stabilized nanocrystalline silver particles by a nonpathogenic and agriculturally important fungus T. asperellum. Nanotechnology. 19:103110 Mukherjee P, Senapati S and Mandal D (2002). Extracellular synthesis of gold nanoparticles by the fungus Fusarium oxysporum. Chem Bio Chem. 5:461-463 Nair B and Pradeep T (2002). Coalescence of nanoclusters and the formation of sub-micron crystallites assisted by Lactobacillus strains. Cryst Growth De. 4: 293-298 Narayanan KB and Sakthivel N (2010). Biological synthesis of metal nanoparticles by microbes. Advances in Colloid and Interface Science. 156:1-13 Neset TS and Cordell D (2012) Global phosphorus scarcity: identifying synergies for a sustainable future . J Sci Food and Agri. 92: 2-6 Nies DH (1999). Microbial heavy-metal resistance. Applied Microbiology and Biotechnology. 51:730-750 Owolade OF, Ogunleti DO and Adenekan MO (2008). Titanium Dioxide affects disease development and yield of edible cowpea. EJEAF Chem. 50: 2942-2947 Patil SD, Rhodes DG and Burgess DJ (2005). DNA-based therapeutics and DNA delivery systems: A comprehensive review. The AAPS journal. 7: E61-E77 Perez-Gonzalez T, Jimenez-Lopez C and Neal AL (2010). Magnetite biomineralization induced by Shewanella oneidensis. Geochimica Et Cosmochimica Acta.74: 967-979 Rai M, Yadav A and Gade A (2009) Silver nanoparticles as a new generation of antimicrobials. Biotechnol Adv. 27: 76-83 Rai M, Yadav P, Bridge P and Gade A (2009). Myconanotechnology: a new and emerging science. In: Rai, Bridge (eds) Applied mycology. CABI publication, UK. pp. 258-267 Rajan MS (2004) Nano; The next Revoluction. National Book Trust, India. Raliya R and Tarafdar JC (2012). Novel Approach for Silver Nanoparticle Synthesis Using Aspergillus terreus CZR-1: Mechanism Perspective. J of Bionanosci. 6: 1-5 Raliya R and Tarafdar JC (2013a). Biosynthesis of gold nanoparticles using Rhizoctonia bataticola tfr-6 Advanced Science, Engineering and Medicine 5: 1-4 Raliya R and Tarafdar JC (2013b). ZnO Nanoparticle biosynthesis and Its Effect on phosphorous-mobilizing enzyme secretion and gum contents in Clusterbean (Cyamopsis tetragonoloba L.). Agric Res. 2:48-57 Raut RW, Lakkakula JR, Kolekar NS, Mendhulkar VD, Kashid SB (2009). Phytosynthesis of Silver Nanoparticle using Gliricidia sepium (Jacq.). Curr Nanosci. 5: 117-122 Rautaray D, Sanyal A, Adyanthaya SD, Ahmad A and Sastry M (2004). Biological synthesis of strontium carbonate crystals using the fungus Fusarium oxysporum. Langmuir. 20:68276833

334

Microbes: In Action

Reith F, Lengke MF, Falconer D, Craw D and Southam G (2007). The geomicrobiology of gold. The ISME Journal. 7: 567-584 Riddin TL, Gericke M and Whiteley CG (2006). Analysis of the inter and extracellular formation of platinum nanoparticles by Fusarium oxysporum f. sp. lycopersici using response surface methodology. Nanotechnology. 17: 3482-3489 Roy K, Mao HQ, Huang SK and Leong KW (1999). Oral gene delivery with chitosan–DNA nanoparticles generates immunologic protection in a murine model of peanut allergy. Nature medicine. 5: 387-391 Sanghi R and Verma P (2009). A facile green extracellular biosynthesis of CdS nanoparticles by immobilized fungus. Chemical Engineering Journal. 155: 886-891 Sastry M, Ahmad A, Khan MI and Kumar R (2003). Biosynthesis of metal nanoparticles using fungi and actinomycetes. Curr. Sci. 85:162-170 Sawle BD, Salimath B, Deshpande R, Bedre MD, Prabhakar BK and Venkataraman A (2008). Biosynthesis and stabilization of Au and Au-Ag alloy nanoparticles by fungus Fusarium semitectum. Science and Technology of Advanced Materials. 9:1-6 Senapati S, Ahmad A, Khan MI, Sastry M and Kumar R (2005). Extracellular biosynthesis of bimetallic Au-Ag alloy nanoparticles. Small. 5: 517-520 Shaligram NS, Bule M, Bhambure R, Singhal RS, Singh SK, Szakacs G and Pandey A (2009). Biosynthesis of silver nanoparticles using aqueous extract from the compactin producing fungal strain. Process Biochem. 44: 939-943 Shankar SS, Ahmad A and Sastry M (2003). Geranium leaf assisted biosynthesis of silver nanoparticles. Biotechnol Prog. 9: 1627-31 Shivshankar S, Ahmad A, Pasricha R and Sastry M (2003). Bioreduction of chloroaurate ions by Geranium leaves and its endophytic fungus yields gold nanoparticles of different shapes. J Mater Chem. 13:1822-1826 Simkiss K and Wilbur KM (1989). Biomineralization. Academic, New York, NY, USA. Subramanian KS and Tarafdar JC (2011). Prospects of nanotechnology in Indian farming. Indian J Agric Sci. 81:887-893 Tang H, Yan M, Zhang H, Xia M and Yang D (2005). Preparation and characterization of water-soluble CdS nanocrystals by surface modification of ethylene diamine. Materials Letters. 59:1024-1027 Tarafdar A, Raliya R, Wei-Ning Wang, Biswas P and Tarafdar JC (2013a). Green Synthesis of TiO2 Nanoparticle Using Aspergillus tubingensis Advanced Science, Engineering and Medicine 5:1-7 Tarafdar J, Sharma S and Raliya R (2013b). Nanotechnology: Interdisciplinary science of applications. African Journal of Biotechnology. 12: 219-226 Tarafdar JC and Claassen N (2003). Organic phosphorus utilization by wheat plants under sterilized condition. Biol Fert Soils. 39:25-29 Tarafdar JC and Yadav RS (2011). Hydrolysis of P fractions by phosphate and phytase producing fungi. Agrochimica. 55:1-13 Tarafdar JC, Raliya R and Rathore I (2012). Microbial Synthesis of Phosphorous Nanoparticle from Tri-Calcium Phosphate Using Aspergillus tubingensis TFR-5. Journal of Bionanoscience. 6: 1-6 Tay CY, Setyawati MI, Xie J, Parak WJ and Leong DT (2014). Back to Basics: Exploiting the Innate Physico-chemical Characteristics of Nanomaterials for Biomedical Applications. Advanced Functional Materials. 24(38): 5936-5955 Titirici MM, White RJ, Brun N, Budarin VL, Su DS, del Monte F, Clark JH and MacLachlan MJ (2015). Sustainable carbon materials, Chemical Society Reviews. 44: 250-290 Tominaka S, Yoshikawa H, Matsush*tad Y and Cheetham AK (2014). Topotactic reduction of oxide nanomaterials: unique structure and electronic properties of reduced TiO2 nanoparticles. Materials Horizons. 1: 106-110 Tran QH, Nguyen VQ and Le AT (2013). Silver nanoparticles: synthesis, properties, toxicology, applications and perspectives. Advances in Natural Sciences: Nanoscience and Nanotechnology. 4(3): 1-20

Fungi in Biosynthesis of Nanoparticles

335

Vance CP (2011). Phosphorous as a critical macronutrient. In: J. Malcolm, Hawkesford and P. Barraclough (eds.). The molecular and physiological basis of nutrient use efficiency inn crops. Wiley-Blackwell, UK. (2011) pp. 229-264. Varshney R, Mishra AN, Bhadauria S and Gaur MS (2009). A novel microbial route to synthesize silver nanoparticles using fungus Hormoconis resinae. Digest J. Nanomater Biostruct. 4: 349 Vigeshwaran N, Ashtaputre M, Nachane RP, Paralikar KM and Balasubramanya H (2007). Biological synthesis of silver nanoparticles using the fungus Aspergillus flavus. Mater Lett. 61:1413-1418 Vitosh ML, Warncke DD and Lucas RE (1994). Secondary and micronutrients for vegetable and field crops. Ichigan State Univ Ext Bull.E-486 Wang J (2005). Carbon-nanotube based electrochemical biosensors: A review. Electroanalysis. 17: 7-14 Wang WN, Jiang Y and Biswas P (2012). Evaporation-induced crumpling of graphene oxide nanosheets in aerosolized droplets: Confinement force relationship. The Journal of Physical Chemistry Letters. 3: 3228-3233 Wu HC, Chang X, Liu L, Zhao F, and Zhao Y (2010). Chemistry of carbon nanotubes in biomedical applications. Journal of Materials Chemistry. 20: 1036-1052 Yang H, Santra S and Holloway PH (2005). Syntheses and applications of Mn-doped II-VI semiconductor nanocrystals. Journal of Nanoscience and Nanotechnology .9:1364-1375 Zhang X, Yan S, Tyagi RD and Surampalli RY (2011). Synthesis of nanoparticles by microorganisms and their application in enhancing microbiological reaction rates. Chemosphere. 82: 489-494 Zheng D, Hu C, Gan T, Dang X and Hu S (2010). Preparation and application of a novel vanillin sensor based on biosynthesis of Au-Ag alloy nanoparticles. Sensors and Actuators B: Chemical. 148:247-252

CHAPTER 21 Secondary Structure Modelling of ITS1, 5.8S and ITS2 Ribosomal Sequences for Intra-Specific Differentiation among Aspergillus Species Praveen Gehlot1, S K Singh2, Jyoti Lakhani3 and Dharmesh Harwani3 1

Department of Botany, Jai Narain Vyas University, Jodhpur-342001 India Central Arid Zone Research Institute, Jodhpur-342003, India 3 Department of Microbiology, Maharaja Ganga Singh University, Bikaner – 334004 India Corresponding author: [emailprotected] 2

INTRODUCTION Previously, the taxonomy and identification of fungi have been based mainly on morphological characteristics. However, recent molecular techniques have been introduced to provide more objective criteria. The morphological traits are subject to environmental influences and can vary substantially from culture to culture (Seady, 1996). Thus, taxonomic considerations, based solely on phenotype, may be subject to ambiguities induced by environmental conditions. The nucleotide sequences of the conservative rRNA coding regions have been widely used for phylogenetic analysis among families or distantly related genera (Berbee and Taylor, 1993; Carmean et al., 1992; Samson, 1974; White et al., 1990). Eukaryotic rDNA is composed of tandemly repeated clusters of 18S, 5.8S and 28S rRNA genes, which are transcribed as a precursor molecule by RNA polymerase I (Raue and Planta, 1995). The external and internal spacer molecules are then removed in nucleolus before escaping for cytoplasm. The variable ITS regions have an advantage of the phylogenetic analysis and identification of the closely related fungal species (Singh et al., 2005, Gehlot et al., 2012). The 5.8S rRNA gene regions are located between the 18S and 28S rRNA genes and offer distinct advantages over other molecular targets including increased sensitivity due to the existence of approximately 100 copies per genome. The rRNA gene for 5.8S RNA separates the two ITS regions (Fig. 1). The sequence variation of ITS regions has led to their use in phylogenetic studies of many different organisms (Guarro and Stchigel, 1999; White et al., 1990). The ITS spacers are versatile genetic markers and have been used for evaluation of the evolution process, determination of taxonomic identities as well as construction of secondary structure of ribosome. The ITS regions have been regarded as nonfunctional sequences. However, analysis of the ITS regions in yeast revealed that these regions have some functions in processing of precursor molecules of rRNA: ITS1 in processing the 3' end of 18S and the 5' end

338

Microbes: In Action

of 5.8S, and ITS2 in processing the 3' end of 5.8S and the 5' end of 28S (Musters et al., 1990; Van derSande et al., 1992; Raue and Planta, 1995). Therefore, the secondary structure and the nucleotide sequences of the ITS regions, which will influence the variation of nucleotide sequences, is crucial for consideration of phylogenetic relationships. Conservation of certain domains and nucleotide motifs are apparent across the eukaryotic kingdom (Coleman, 2007). By analyzing the predicted secondary structure of an rRNA gene sequence and detecting conserved domains and motifs, it is possible to estimate whether the sequence is likely to code for functional rRNA and also, validate the authenticity of rDNA copies (Harpke and Peterson, 2008).

FIG. 1: A map of Internal Transcribed Spacer (ITS) regions separated by 5.8S gene

The identification of Aspergillus species based on morphological characteristics requires adequate growth for evaluation of colony characteristics and microscopic features. A culture time of five days or more is generally required for identification of anamorphic forms of Aspergillus. Various molecular approaches have been used for the detection of Aspergillus from environment (Bretagne et al., 1995, Einsele et al., 1997, Yamakami et al., 1996). Targets for the genus level detection of Aspergillus have included the 18S rRNA gene, mitochondrial DNA, the intergenic spacer region and the internal transcribed spacer (ITS) regions. Secondary structure prediction is advantageous for species identification because it allows for the detection of sequencing errors, pseudogenes and genetic footprints indicative of past hybridization events (Coleman, 2009). Accordingly, structural information can offer supplementary information for species identification (Coleman, 2003; 2007). Therefore in the present study has been carried out made to systematically investigate the potential use of ITS1, 5.8S and ITS2 consensus secondary structure prediction for identification of species within genus Aspergillus. The main objectives of this study were to assess the nature of polymorphisms that may accumulate in the ITS1 and ITS2 rDNA

Secondary Structure Modelling of ITS1, 5.8S and ITS2

339

sequences and to examine the predicted consensus secondary structures for separate ITS1 and ITS2 markers and identify their structural features, including conserved motifs and variable regions and to determine whether predicted ITS secondary structures can be used to identify species and to discuss the usefulness of secondary structure analyses to validate ITS sequence data for use in phylogenetic reconstruction. Therefore, to infer applicability for the systematics of eight Aspergillus species, ITS1-5.8-ITS2 sequences were subjected to sequence analyses prior to generation of predicted, consensus secondary structures including the GC content. Analysis pertaining to structure stability and the presence of conserved and variable motifs in secondary structures for ITS1, 5.8S and ITS2 markers presented. DNA EXTRACTION, AMPLIFICATION OF 5.8S, ITS SEQUENCES AND DNA SEQUENCING DNA extraction, amplification of 5.8S, ITS sequences and DNA sequencing have been presented Gehlot et al. (2011). ITS I and ITS II sequences of eight Aspergillus species have been deposited in GenBank were assigned GenBank accession numbers. The accession number of A. hiratsukae, A. flavus, A. fumigatus, A. terreus, A. niger, A. sydowii, A. clavatus, and A. flavipes are EU515147, EU515148, EU515149, EU515150, EU515151, EU515152, EU515153 and EU515154 respectively. Multiple Sequence Alignment Multiple sequence alignment was performed using CLUSTALW version 1.83 software (Thompson et al., 1994). The obtained sequences were initially aligned and was then refined visually with a word processing program with bold coded nucleotides. Ultimately, three sets of sequence alignments were generated: ITS1, 5.8S and ITS2 as separate data sets. Secondary Structure Modelling The RNA secondary structures for ITS were predicted using RNADRAW (Matzura and Wennborg, 1996). Secondary structure predictions of rRNA sequences are sensitive to single base changes which in turn, can affect hydrogen base-pairing especially along the stem aspect of a stem loop secondary structure (Matthews et al., 2005). RNADRAW predicts RNA structures by identifying suboptimal structures using the free energy optimization methodology at a default temperature of 37oC. In the current study, ITS region was used for RNA structure prediction. The minimum energy structure prediction algorithm in RNADRAW was ported from the RNAFOLD program included in the Vienna RNA package (Hofacker et al., 1994). The dynamic programming algorithm employed in RNADRAW was based on the effort of Zuker and Stiegler (1981) and uses energy parameters taken from Turner et al. (1988). ITS Sequence Analysis and Alignment Errors can occur during PCR amplification when two different DNA templates may be present. The resulting amplicon may be chimeric, that is, a mosaic of these original sequences (Jumpponen, 2011). Such chimeric sequences may be misinterpreted as novel which can artificially inflate estimates of diversity and

340

Microbes: In Action

interfere with phylogenetic inference and species discrimination if undetected (Hugenholtz and Huber, 2003). ITS sequences were checked for possible chimeras using the UNITE PlutoF Chimera checker (Nilsson et al., 2010; Edgar et al., 2011) and MAFFT analysis (http://mafft.cbrc.jp/alignment/server/ (Katoh, 2005; 2008). Comparison of GC Content and Nucleotide Diversity of the ITS Sequences The sequence length of the ITS1 and ITS2 region for a given species can be variable, however, the two markers should have similar GC content if they are authentic sequences under functional and selective constraints and not pseudogenes (Harpke and Peterson, 2008; Mullineaux and Hausner, 2009). The GC content of the ITS1, 5.8S and ITS2 sequences was determined using BioEdit version 7.2.0 software. Sequence Alignments Electrophoresis and direct sequencing of each PCR product confirmed that a single product was amplified and the size of each product corresponded to the expected rDNA. Amplification of the ITS1-5.8S-ITS2 regions from the eight Aspergillus species generated PCR products ranging in size from 479 to 520bp (Table 1). The aligned data of the DNA sequences of ITS1 and ITS2, and 5.8S rDNA using CLUSTALW has been shown in Fig. 2. There is considerable sequence variation in the ITS sequences and little in the regions of the 5.8S rDNA. The sequence variations are usually higher in ITS2 than ITS1 in the literature. However, the sequences of ITS1 were more variable in our study than those of ITS2. The sequence difference in Aspergillus species and base substitution is supposed as the variation of cultural, geographical and environmental conditions. TABLE 1: GC content and nucleotide length of the ITS1, ITS2, and 5.8S rDNA sequences of eight Aspergillus species with Gene Accession numbers ITS1 Aspergillus strains A. hiratsukae (Neosartorya hiratsukae) EU515147 A. flavus EU515148 A. fumigatus EU515149 A. terreus EU515150 A. niger EU515151 A. sydowii EU515152 A. clavatus EU515153

5.8S rDNA

ITS2

Total Length (nt)

GC content (%) 61.50

Length GC content (nt) (%) 187 49.04

Length GC content (nt) (%) 157 67.83

Length GC content (nt) (%) 171 59.80

515

61.32 63.04

181 184

49.68 49.04

157 157

66.27 67.86

169 168

59.37 60.31

507 509

62.90 64.32 59.74 49.60

186 185 154 187 127 182

48.41 48.41 49.68 49.04

157 157 157 157

68.93 65.68 69.05 67.86

177 169 168 168

60.58 59.88 59.71 56.19

520 511 479 512

48.41

157

68.12

160

60.32

499

A. flavipes EU515154 63.74

Secondary Structure Modelling of ITS1, 5.8S and ITS2

341

Phylogenetic Analysis of ITS1, ITS2 and the 5.8S rRNA Sequences A comparative study of common core secondary structure in the ribosomal internal transcriber spacers (ITS1 and ITS2) of eight Aspergillus species were carried out. Multiple sequence alignment and secondary structural analysis of ITS1 and ITS2 were performed to elucidate the phylogenetic relationship (Gehlot et al., 2011). Sequencing was first performed using direct sequencing of PCR products. As stated above, alignment of contiguous fungal sequences demonstrated that both single-nucleotide differences and short lengths of sequence diversity due to putative insertions or deletions existed in the ITS15.8S-ITS2 regions among the Aspergillus species. The ITS1 region displayed more intra species variation than the ITS 2 region. Several common features of secondary structure are shared among eight species with some of them supported by compensatory changes, suggesting the significant role played by ITS1 and ITS2 as an RNA domain during ribosome biogenesis. G+C Contents and Nucleotide Length of rDNA ITS Regions The G+C contents and nucleotide length of ITS1, ITS2, 5.8S rRNA gene, and their total (ITS1-5.8S-ITS2) are shown in Table 1. The total G+C contents of ITS1-5.8S-ITS2 ranged from 56.19% in A. clavatus to 60.58% in A. terreus. The relatively low G+C content of A. clavatus might reflect the low optimum temperature of the fungus. The shortest size of ITS1-5.8S-ITS2 was 479 nucleotides of A. sydowii and the longest was 520 nucleotides of A. terreus (Table 1). This size variation was derived from the variation of the ITS regions, because the size of the 5.8S rRNA gene was identical (157 nucleotides) among the tested Aspergillus species. The predicted stem regions are extremely G+C rich, indicating the presence of stable stem structures in the domains (Fig. 2). These results may support the reliability of the predicted secondary structures. The G+C contents of the 5.8S rRNA gene were stable (48.41 to 49.68%) among all eight aspergilli investigated. Most of the tested strains could be divided into two groups, based on the ITS1-5.8-ITS2 length. One group with short (below 500bp) ITS sequence includes A. sydowii (EU515152) with 479bp and A. flavipes (EU515154) with 499bp. The other group with long ITS (above 500bp) includes A. flavus (EU515148) with 507bp, A. fumigatus (EU515149) with 509bp, A. niger (EU515151) with 511bp, A. clavatus (EU515153) with 512bp, A. hiratsukae (EU515147) with 515bp and A. terreus (EU515150) with 520bp. Secondary Structure Modeling of ITS1 and ITS2 The nucleotide sequence data set obtained above from the eight Aspergillus species in Table 1 gave a 509-nucleotide aligned sequence, including many ambiguously aligned sites due to the variable nucleotide sequence of the ITS regions. However, since some conserved sites were found in the ITS regions, these conserved sites of the ITS regions and the 5.8S rRNA gene were used for the current analysis. MAFFT analysis (http://mafft.cbrc.jp/alignment/server/ (Katoh, 2008) revealed no evidence of chimeric sequences present in the ITS data set and indicated good quality ITS sequences with no stochastic or art factual nucleotide data. RNA sequences of the ITS1 and ITS2 markers were aligned using the align and fold approach. The consensus minimum free energy (MFE) structures for the

342

Microbes: In Action

ITS1-5.8-ITS2 marker according to species are illustrated in Fig. 2 and Fig. 3. The delta G required for formation of the secondary structures was found to be in the range from -174.00 kcal/mol to -230.00 kcal/mol. The species specific sequence variation is contemplated in the predicted RNA secondary structures of eight Aspergillus species. The optimal secondary structure with a minimum free energy of A. hiratsukae (-224.70 kcal/mol), A. flavus (-221.10 kcal/mol), A. fumigates (223.90 kcal/mol), A. terreus (-244.70 kcal/mol), A. niger (-231.00 kcal/mol), A. sydowii (-210.34 kcal/mol), A. clavatus (-235.50 kcal/mol) and A. flavipes (205.50 kcal/mol) As described previously, the nucleotide sequences of the ITS regions were variable among Aspergillus species, while relatively conserved regions were also present. Many different folding structures with a similar energy were obtained from the nucleotide sequences of the ITS1 from eight Aspergillus species. The sequence for conserved domain for all species was found to be 5' GGUUGGAGGGU 3'. In compare to ITS1 structures of eight Aspergillus species, less variable secondary structures with a similar energy were obtained in the ITS2. However, the structures were not relatively consistent compared with those obtained in ITS1, and a certain structure was commonly found in all investigated species. Four domains having distinctive hairpin structures were found in the ITS2 region. A highly conserved sequence, 5' CGCCGCCGUGGCGCAGGCCAGGAG CUCGCAUACCCCGAAACAG 3' was found in all species of this group. Although the stem structures of ITS-2 were also conserved in ITS2, an insertion of several nucleotides was observed at the apical part of the hairpin structures compared with the short-ITS group (Fig. 2 and Fig. 3). No length mutation was detected in the hairpin structures of ITS2 groups, and the hairpin structures seemed to be stable among Aspergillus species. A conserved sequence motif, 5' CCCCUGCCCGGG 3' was found at the stem base of ITS2. Nucleotide sequences in the apical loop were diverged more as compared with those in the stem regions (Fig. 2 & 3). On the other hand, it is known that the loops of the coding region of rRNA are more conserved than the stem region. This inconsistency between spacer regions and coding regions may be derived from functional difference between the regions.

Secondary Structure Modelling of ITS1, 5.8S and ITS2

343

FIG. 2: Nucleotide sequence alignment of A. sydowii (EU515152). A. flavus (EU515148), A. flavipes (EU515154), A. terreus (EU515150), A, niger (EU515151), A. calvatus (EU515153), A. hiratsukae (EU515147) and A. fumigatus (EU515149) using CLUSTALW. The alignment consists of the complete IT IS region, the highly conserved 5.8S rDNA gene sequence (Bold capital letters) and the complete ITS2 region, representing putative insertion-deletion sites, indicated by dashes and character ‘*’ , indicate position that are 100% identical.

344

Microbes: In Action

EU515147 -214.40 kcal/mol

EU515150 -230.00 kcal/mol

EU515153 -192.40 kcal/mol

EU515148 -207.40 kcal/mol

EU515151 -218.70 kcal/mol

EU515149 -214.20 kcal/mol

EU515152 -199.30 kcal/mol

EU515154 -174.00 kcal/mol

FIG. 3: The consensus minimum free energy (MFE) structures calculated for the ITS1-5.8S-ITS2 sequences of the eight Aspergillus species calculated by RNA fold program included in the Vienna RNA package. The delta G required for formation of mater the secondary structures have been given with every Aspergillus species.

Secondary Structure Modelling of ITS1, 5.8S and ITS2

Aspergillus species Aspergillus hiratsukae

Aspergillus flavus

Aspergillus fumigatus

Aspergillus terreus

Aspergillus niger

Aspergillus sydowii

345

RNA Secondary Structures ITS-1

5.8S

ITS-2

346

Aspergillus species

Microbes: In Action

RNA Secondary Structures ITS-1

5.8S

ITS-2

Aspergillus clavatus

Aspergillus flavipes

Fig. 3. Consensus minimum free energy (MFE) structures and proposed ribotypes for ITS1, 5.8S and ITS2 markers for eight Aspergillus species calculated by RNA fold program including in the Vienna RNA package.

UPGMA

Neighbor Joining

Secondary Structure Modelling of ITS1, 5.8S and ITS2

347

Maximum Parismony

Maximum Likelihood

Phylip

The nucleotide sequences of the internal transcribed spacer (ITS) regions of the ribosomal DNA encompassing the 5.8S rRNA gene have been determined for eight species of Aspergillus in order to predict their secondary structure to infer phylogenetic relationship. The nuclear internal transcribed spacer (ITS) regions have been used as molecular markers because of their relative variability and ease of PCR amplification (Nilsson et al., 2012). The ITS array consists of the entire ITS1, 5.8S gene and ITS2 regions of the nuclear rDNA cistron. It is a

348

Microbes: In Action

multigene family with the potential for variation among tandem repeats. Polymorphisms are not uniformly distributed across the ITS array. As identified in the present study, the 5.8S gene sequence is highly conserved but the ITS1 and ITS2 sequences are more variable and are highly polymorphic depending on the fungal species (Hillis and Dixon 1991; Coleman 2007). Interestingly, positive correlations in G+C contents and nucleotide length have been found between ITS1 and ITS2 (Table 1), i.e., ITS2 of species having GC rich ITS1 is also GC rich, and species having a long ITS1 sequence also has a long ITS2 sequence, and vice versa. Torres et al. (1990) found similar phenomenon in the G+C contents of ITS regions in a wide range of organisms including filamentous fungi and called it "GC balance". Evidence suggests that significant variation among ITS sequences is found only within organisms that are diploid or polyploid hybrids, and of disparate parents (Buckler 1997). Earlier, Turenne et al. (1999) have proposed the use of ITS amplicons of different lengths for identification of Aspergillus species by capillary electrophoresis. The goal of their study was to compare the ITS1 and ITS2 nucleotide sequences of clinically important Aspergillus species and determine whether sufficient variability existed for identification to the species level. Analysis of ITS spacers of eight species of Aspergillus in the present study revealed low level of similarity among species. Immediately post-transcription, the initial ITS transcript folds and forms helices that provide recognition and docking signals that enable processing of the transcript into mature rRNAs (Joseph et al., 1999). Schlotterer et al. (1994) found that the more variable portions of ITS2 appear to be slow evolving, at a rate close to neutral which suggests no selection. The relatively conserved regions of the ITS2 sequence are stabilized by selective forces which ensure correct rRNA processing (Coleman 2009). The present study confirms that the ITS2 regions are more conserved then ITS1 region in all aspergilli analyzed (Fig. 3). In addition to being widely used for phylogenetic inference and in systematics, the ITS region is the formal fungal barcode and is the primary choice for molecular identification of fungi from a number of sources (Schoch et al., 2012). The difficulty in using ITS sequences for phylogenetic inference, however, is appropriate ITS sequence alignment which must be carried out in the absence of a translated protein product (Coleman 2009). Further, many intergenic spacers may exist as a mosaic of functional elements and inactivated pseudogenes at different stages of decay (Degnan et al., 2011). A ribosomal secondary structure showed us the distribution of interior loop, bulge loop, multiple branched loop, hairpin loop and exterior loop in the all the species. The greatest intra species variation was seen among isolates of A. clavatus and isolates of A. flavipes for ITS1 sequence and for A. terreus for ITS-2 sequence. Although all observed A. species exhibited higher sequence similarity but the difference between A. clavatus and isolates of A. flavipes for ITS-1 sequence and for A. terreus for ITS-2 sequence allowed these species to be readily distinguished. It is believed that concerted evolution allows hom*ogenization of the many copies of this array and it is proposed that the ITS can be analyzed as a single gene (Coleman 2003). ITS sequences are typically found to be more similar within species and more divergent between species (Alvarez and Wendel 2003). The convergence at secondary structure level among species is may be due to

Secondary Structure Modelling of ITS1, 5.8S and ITS2

349

evolutionary pressure on ITS 2 to maintain the RNA secondary structure involved post transcription processing of rRNA. Secondary structure prediction for the ITS2 region indicated that these domain base pair from a core region central to several stem features implying that conservedness is more important for the proper rRNA folding pattern. Gaskell et al. (1997) investigated sequence variation in ITS regions to distinguish Aspergillus from other allergenic molds. They found little variation between Aspergillus and Penicillium within the ITS2 region but concluded that the ITS1 region may be sufficient for identification. Similarly we also focused in the present study on internal transcribed spacer sequences to predict secondary structures of rRNA of selected eight Aspergillus species. The comparison of ITS1-5.8S-ITS2 region sequences among eight Aspergillus species revealed several areas of sequence variation. The inclusion of the 5.8SrRNA gene sequence had minimal impact on the overall ITS1-ITS2 sequence and secondary structure comparison since there is little intra species variation in this region. Thus in the present study, the insignificant intra species variation of 5.8SrRNA gene among eight Aspergillus strains was not considered in secondary structure determination. This is consistent with the phylogenetic study by Sugita et al. (1999) of the Trichosporon species, where very few nucleotide bases were different among various strains of the same species. Although automated sequencing and analysis provided accurate discrimination of Aspergillus from other fungi, a probe-based DNA hybridization approach for other organisms has been described and may be more cost effective in the future (Einsele et al., 1997, Shin et al., 1999). In structure modelling, however, sequence read errors can give rise to artificial structures involving several-to-many base-pairs, whereas they only give rise to single-base-pair alignment mismatches in similarity searches. In this study, the observed variability of the ITS1 marker was higher than that of ITS2 which is in agreement with the findings of Freire et al. (2012) and Nilsson et al. (2008). Although several conserved nucleotide sequence motifs have been identified in 5.8S and ITS2 sequences, it is the retention of functionally conserved secondary structures that enable the ITS array to play a critical role in the production of mature rRNA molecules (Michot et al., 1999; Venema and Tollervey 1999). Although the variable ITS sequences were ambiguously aligned, conserved sites were also discerned for analyzed Aspergillus species (Fig. 2 and Fig. 3). We therefore suggest that both the ITS1 and ITS2 regions are necessary for species level identification. It is apparent from the level of variation in the nucleotide sequence and predicted secondary structures of the ITS1 and ITS2 markers that different selective pressures may be acting at each markers. Within the ITS array, some regions are under evolutionary constraints at the level of the nucleotide sequence (Liu and Schardl 1994; Mai and Coleman 1997), while others are under positive selection at the level of the secondary structure with the emergence of concomitant compensatory base changes to preserve this structure (Joseph et al., 1999). The present studies have shown us that the low number of base changes in the ITS2 sequences is capable of resolving Aspergillus species. In some cases, the variation in the ITS2 sequence is insufficient to distinguish among certain members of this species. The predicted secondary structures were

350

Microbes: In Action

supported by the conserved sequences and their high G+C content in the predicted stem regions (Fig. 2 & 3). It is known that the secondary structure of ITS2 is necessary for processing of the precursor molecule in Saccharomyces (Van der Sande et al., 1992). Our results suggest presented in this study also suggests that the ITS of the Aspergillus species have a similar function, that the secondary structure is more important than the nucleotide sequences in this region. The variable spacer regions of rDNA have been considered to be useful for phylogenetic analysis of closely related genera, inter species or intra species (Bruns et al., 1991). This is also true of the Aspergillus species since some conserved sequences were found in the spacer regions, which allowed us to infer phylogeny of eight Aspergillus species using these conserved sequences of spacers as well as coding regions. Nevertheless, analysis of more conserved regions will be required to show the precise branching order among the groups. The structure models developed in this study can be used for further phylogenetic analysis. In addition to that the species specific secondary structures predicted for Aspergillus species may provide supplementary data to improve its systematics. The present data may help us in getting more precise knowledge on the evolutional process of the Aspergillus species. REFERENCES Alvarez I and Wendel JF (2003). Ribosomal ITS sequences and plant phylogenetic inference. Mol Phylogenet Evol. 29:417-434 Atanas I, Lavev, Ross and Nazar N (1999). Structural equivalence in the transcribed spacrs of pre rRNA transcripts in Schizosaccharomyces pombe. Nucl acid Res. 27: 3071-3078 Berbee ML and Taylor JW (1993). Dating the evolutionary radiations of the true fungi. Can. J. Bot. 71: 1114-1127 Bretagne S, JM Costa, Marmorat-Khuong A, Poron F, Cordonnier C, Vidaud M and FleuryFeith J (1995). Detection of Aspergillus species DNA in bronchoalveolar lavage samples by competitive PCR. J. Clin. Microbiol. 33:1164-1168 Bruns TD, White TJ and Taylor JW (1991). Fungal molecular systematics. Annu. Rev. Ecol. Syst. 22: 525-564 Buckler ES, Ippolito A and Holtsford TP (1997). The evolution of ribosomal DNA: divergent paralogues and phylogenetic implications. Genetics. 145:821-832 Carmean D, Kimsey LS and Berbee ML (1992). 18S rDNA sequences and the holometabolous insects. Mol. Phylogenet. Evol. 1: 270-278 Coleman AW (2003). ITS2 is a double-edged tool for eukaryote evolutionary comparisons. Trends Genet. 19:370-375 Coleman AW (2007). Pan-eukaryote ITS2 hom*ologies revealed by RNA secondary Structure. Nucl. Acids Res. 10:3322-3329 Coleman AW (2009). Is there a molecular key to the level of biological species in eukaryotes? A DNA guide. Mol. Phylogenet. Evol. 50:197-203 Degnan PH, Ochman H and Moran NA (2011). Sequence conservation and functional constraint on intergenic spacers in reduced genomes of the obligate symbiont Buchnera. PLoS Genet. 7: 252 Edgar RC, Haas BJ, Clemente JC, Quince C and Knight R (2011). UCHIME improves sensitivity and speed of chimera detection. Bioinformatics. 27:2194-2200. Einsele H, Hebart H, Roller G, Loffler J, Rothenhofer I, Muller CA, Bowden RA, van Burik J, Engelhard D, Kanz L and Schumacher U (1997). Detection and identification of fungal pathogens in blood by using molecular probes. J. Clin. Microbiol. 35:1353-1360

Secondary Structure Modelling of ITS1, 5.8S and ITS2

351

Einsele H, Hebart H, Roller G, Loffler J, Rothenhofer I, Muller CA, Bowden RA, van Burik J, Engelhard D, Kanz L and Schumacher U (1997). Detection and identification of fungal pathogens in blood by using molecular probes. J. Clin. Microbiol. 35:1353-1360 Freire MCM, Romeria da Silva M, Zhang X, Almeida AMR, Stacey G and de Oliveira LO (2012). Nucleotide polymorphism in the 58S nrDNA gene and internal transcribed spacers in Phakopsora pachyrhizi viewed from structural models. Fungal Genet. Biol. 49:95100 Gaskell GJ, Carter DA, Britton WJ, Tovey ER, Benyon FH and Lovborg U (1997). Analysis of the internal transcribed spacer regions of ribosomal DNA in common airborne allergenic fungi. Electrophoresis. 18:1567-1569 Gehlot P, Purohit DK and Singh SK (2011). Molecular diagnostics of human pathogenic Aspergillus species. Ind. J. Biotechnol. 10: 207-2011 Gehlot P, Singh SK and Pathak R (2012). Morphometric and molecular characterization of Pestalotiopsis a fungal species using nuclear ribosomal DNA analysis. Journal of Environmental Biology. 33: 897-901 Guarro J, Gene J, and Stchigel AM (1999). Developments in fungal taxonomy. Clin. Microbiol. Rev. 12:454-500 Harpke D and Peterson A (2008). 5.8S motifs for the identification of pseudogenic ITS regions. Botany. 86:300-305 Hausner G Wang X (2005). Unusual compact rDNA gene arrangements within some members of the Ascomycota: evidence for molecular co-evolution between ITS1 and ITS2. Genome. 48:648-660 Hillis DM and Dixon MJ (1991). Ribosomal DNA: molecular evolution and phylogenetic inference. Q. Rev. Biol. 66:411-453 Hofacker IL, Fontana W, Stadler PF, Bonhoeffer LS, Tacker M and Schuster P (1994). Fast folding and comparison of RNA secondary structures. Chemi. Mont. 125:167-188 Hugenholtz P and Huber T (2003). Chimeric 16S rDNA sequences of diverse origin are accumulating in the public databases. Int. J. Syst. Evol. Microbiol. 53:289-293 Joseph N, Krauskopf E, Vera MI and Michot B (1999). Ribosomal internal transcribed spacer 2 (ITS2) exhibits a common core of secondary structure in vertebrates and yeast. Nucl. Acids Res. 27:4533-4540 Jumpponen A (2011). Analysis of ribosomal RNA indicates seasonal fungal community dynamics in Andropogon gerardii roots. Mycorrhiza. 21:453-464 Katoh K and Toh H (2008). Recent developments in the MAFFT multiple sequence alignment program. Brief. Bioinform. 9:286-298 Katoh K, Kuma KI, Toh H and Miyata T (2005). MAFFT version 5: improvement in accuracy of multiple sequence alignment. Nucl. Acids Res.33:511-518 Liu JS and Schardl CL (1994). A conserved sequence in internal transcribed spacer 1 of plant nuclear rRNA genes. Plant Mol. Biol. 26:775-778 Mai JC and Coleman AW (1997). The internal transcribed spacer 2 exhibits a common secondary structure in green algae and flowering plants. J. Mol. Evol. 44:258-271 Mathews DH, Schroeder SJ, Turner DH and Zuker M (2005). Predicting RNA secondary structure. In: Gesteland RF, Cech TR, Atkins JF (eds) The RNA world, 3rd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, pp 631-657 Matzura O and Wennborg A (1996). RNAdraw: an integrated program for RNA secondary structure calculation and analysis under 32-bit Microsoft Windows Computer Application in the Bioscience. 12:247-249 Michot B, Hassouna N and bachellerie JP (1984). Secondary structure of 28S rRNA and general model for the folding of the large rRNA in eukaryotes. Nucl. Acid Res. 2:42594279 Michot B, Joseph N, Mazan S and Bachellerie JP (1999). Evolutionarily conserved structural features in the ITS2 of mammalian pre-rRNAs and potential interactions with the snoRNA U8 detected by comparative analysis of new mouse sequences. Nucl. Acids Res. 27:2271- 2282

352

Microbes: In Action

Mullineux T and Hausner G (2009). Evolution of rDNA ITS1 and ITS2 sequences and RNA secondary structures within members of the fungal genera Grosmannia and Leptographium. Fungal. Genet. Biol. 46:855-867 Musters W, Boon K, Vander sande CA and van heerikuizen HRJ (1999). Functional analysis of transcribed spacers of yeast ribosome. EMBO J. 9:3989-3996 Musters W, Boon KC, Van der Sande AFM, Van Heerikhuizen H and Planta RJ (1990). Functional analysis of transcribed spacers of yeast ribosomal DNA. EMBO J. 9:3989-3996 Nilsson RH, Abarenkov K, Veldre V, Nylinder S, De Wit P, Brosche S, Alfredsson JF, Nilsson RH, Kritiansson E, Ryberg M, Hallenberg N and Larsson KH (2008). Intra-specific ITS variability in the kingdom Fungi as expressed in the international sequences database and its implications for molecular species identification. Evol. Bioinform. 4:193-201 Nilsson RH, Tedersoo L, Abarenkov K, Ryberg M, Kristiansson E, Hartmann M, Schoch CL, Nylander JAA, Bergsten J, Porter TM, Vaishampayan AJP, Ovaskainen O, Hallenberg N, Bengtsson-Palme J, Eriksson KM, Larsson HK, Larsson E and Koljalg U (2012). Five simple guidelines for establishing basic authenticity and reliability of newly generated fungal ITS sequences. Myco. Keys. 4:37-63 Perrone G, Susca A, Cozzi G, Ehrlich K, Varga J, Frisvad JC, Meijer M, Noonim P, Mahakarnachanakul W and Samson RA (2007). Biodiversity of Aspergillus species in some important agriculture products. Stud. Mycol. 59: 53-66 Raue HA and Planta RJ (1995). The pathway to maturity: Processing of ribosomal RNA in Saccharomyces cerevisiae. Gene Exp. 5:71-77 Ryberg M and Kristiansson E (2010). An open source chimera checker for the fungal ITS region. Mol. Ecol. Resour. 10:1076-1081 Samson RA (1974). Paecilomyces and some allied hyphomycetes. Stud. Mycol. 6: 1-119 Schlotterer C, Hauser MT, von Haeseler A and Tautz D (1994). Comparative evolutionary analysis of rDNA ITS regions in Drosophila. Mol. Biol. Evol. 11:513-522 Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, Levesque CA and Chen W (2012). Fungal Barcoding Consortium; Fungal Barcoding Consortium Author List, Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for fungi. Proc. Nat. Acad. Sci. 109:6241-6246 Seady DA (1996). Differentiation of Tricho*rma taxa associated with mushroom production. Pla. Pathol. 45: 905-912 Shin JH, Nolte FS, Holloway BP and Morrison CJ (1999). Rapid identification of up to three Candida species in a single reaction tube by a 59 exonuclease assay using fluorescent DNA probes. J. Clin. Microbiol. 37:165-170 Singh SK, Tiwari M, Kamal S and Yadav MC (2005). Morel Phylogeny and diagnostics based on restriction fragment length polymorphism analysis of ITS region of 5.8S ribosomal DNA. Journal of Plant Biochemistry and Biotechnology. 14: 179-183 Sugita T, Nishikawa A, Ikeda R and Shinoda T (1999). Identification of medically relevant Trichosporon species based on sequences of internal transcribed spacer regions and construction of a database for Trichosporon identification. J. Clin. Microbiol. 37:1985-1993 Torres RA, Ganal M and Hemleben V (1990). GC balance in the internal transcribed spacers ITS 1 and ITS 2 of nuclear ribosomal RNA genes. J. Mol. Evol. 30: 170-181 Turenne CYSE, Sanche DJ, Hoban JA, Karlowsky and Kabani AM (1999). Rapid identification of fungi by using the ITS2 genetic region and an automated fluorescent capillary electrophoresis system. J. Clin. Microbiol. 37:1846-1851 Turner DH, Sugimoto N and Freier S (1988) RNA Structure Prediction. Annual Review of Biophy. Biophysi. Chem. 17: 167-192 Van Burik J, Myerson D, Schreckhise R and Bowden R (1998). Panfungal PCR assay for detection of fungal infection in human blood specimens. J. Clin. Microbiol. 36:1169-1175 Van der Sande CAFM, Kwa M, Van Nues RW, Van Heerikhuizen H, Raue HA and Planta RJ (1992). Functional analysis of internal transcribed spacer 2 of Saccharomyces cerevisiae ribosomal DNA. J. Mol. Biol. 223: 899-910 Varga J, Juhasz A, kevei F and Kozakiewich Z (2004). Molecular diversity of agriculturally important Aspergillus species. Euro. J. Plant Pathol. 110:627-640

Secondary Structure Modelling of ITS1, 5.8S and ITS2

353

Venema J and Tollervey D (1999). Ribosome synthesis in Saccharomyces cerevisiae. Annu. Rev. Genet. 33:261-311 White T, Burns J, Lee S and Taylor J (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Pp. 482. In Innis, MADH Gelfand, JJ Sinsky, and TJ White. (eds.), PCR protocols: a guide to methods and applications. Academic Press, San Diego, California. White T, Burns T, Lee S and Taylor J (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics, p. 315–322. In MA Innis, DH Gelfand, JJ Sninsky, and TJ White (ed.), PCR protocols. A guide to methods and applications. Academic Press, Inc., San Diego, Calif. Yamakami Y, Hashimoto A, Tokimatsu I and Nasu M (1996). PCR detection of DNA specific for Aspergillus species in serum of patients with invasive aspergillosis. J. Clin. Microbiol. 34:2464-2468 Zuker M and Stiegler P (1981). Optimal computer folding of large RNA sequences using thermodyanamics and auxiliary information. Nucl. acid Res. 9:133-148

CHAPTER 22 Halophiles of Sambhar Salt Lake Archana Gaur Department of Zoology, Jai Narain Vyas University, Jodhpur-342001 India Corresponding author: [emailprotected]

INTRODUCTION A salt lake or saline lake is a landlocked body of water which has a concentration of salts and other dissolved minerals significantly higher than most lakes (At least 3gm of salt per litre). The ocean is naturally saline at approximately 3.5% salt. Some inland salt lake are even saltier, such lakes are termed as hypersaline lakes. The Dead Sea, for example, has a surface water salt content of around 30% (Goetz, 1986). Salt lakes may contain water permanently, intermittently or episodically; water levels may be constant or fluctuate widely on a seasonal or secular basis. Globally there are several large, deep salt lakes, but generally saline lakes are shallow therefore their physic-chemical features fluctuate widely with diel, season and hydrological budget. Significant and rapid changes in volume, depth and area are marked with seasonal and episodic climate changes (Williams, 1996). Saline lakes with salt composition and proportion like sea waters or marine in origin are termed as "Thalassohaline" where as Inland saline lakes differing from sea salt composition are distinguished as "Athalassohaline" (Bond,1935). The major ions in salt lakes are the same as those in fresh waters, namely Na_, K_, Ca2_, Mg2+, Cl_, SO4 2- and CO32-/HCO3_, but the ionic proportions are different (Hammer 1986). In fresh waters, the divalent cations and HCO3_/CO3 2_ are important; in salt lakes, Na_ and Cl_ are usually the dominant ions, though a dominance of Mg2+, Ca2+ and SO4 2- is also found in some lakes (Eugster and Hardie1978). Saline lakes are most common in the arid and semiarid regions of the biosphere, because two preconditions for the formation of salt lakes occur there most frequently: evaporation exceeding precipitation and the presence of endorheic drainage basins. Saline lakes contain 104 x 103 cu Km or 0.008% water of total global water volume. Salt lakes include the largest lake on earth, the Caspian Sea, with an area of 622 000 km2, many other large lakes, lakes at the highest altitudes for any lake (>3000 m above sea-level on the Altiplano of South America and in Tibet), as well as the lowest lake on earth, the Dead Sea, at about 400 m below sea level. Study on Geographical distribution of salt lakes revealed that Asia contains 24.4% of total salt lakes, out of which 10.5% are located in arid and 13.9 % in semi-arid regions (Williams,1996a).

356

Microbes: In Action

India holds Asia's biggest salt water lake in its eastern coast, The Lake Chilika. In India majority of saline habitat studies are also focused on coastal salt waters (Rahaman et al.,1993). Rajasthan, the largest state of India (3,42,269 sq. km) is largely an arid state. Area estimates of various wetland categories for Rajasthan carried out using Satellite remote sensing, Geographic Information System (GIS) revealed total wetland area of 782314 ha that is around 2.29 per cent of the geographic area. Major wetland types observed in the state are Reservoirs/Barrages, Tanks/Ponds, River/Stream, Lakes/Ponds, Man-made Waterlogged area and Salt pans (NWA, 2010). Main saline lakes of Rajasthan are, Lunkaransar in Bikaner district, Pachpadra in Barmer district, Kuchaman lake, Deedwana lake in Nagour district, Phulera and Sambhar lake in Jaipur district etc. (Kulshreshtha et al., 2013). Such lakes have salt concentrations much greater than that of seawater, often close to or exceeding salt saturation (Hypersaline).

FIG. 1: Shaded areas indicate the distribution of salt lakes around the world.

Sambhar lake (27o 58 N, 75o 55 E) is the largest inland halo-alkaline lake of India. The lake is located along National Highway 8 in Rajasthan, 96 km south west of the city of Jaipur (Northwest India) and 64 km north east of Ajmer. It encircles historical Sambhar Lake Town. The name stems from Shakambhari Devi, the tutelary goddess of Chauhan Rajputs and the consort of Lord Shiva. The lake shore has a temple dedicated to Shakambhari Devi. The lake receives water from an endorheic basin with 5700 square km catchment area. The lake is actually an extensive saline wetland, with water depths fluctuating from as few as 60 cm (24 in) during the dry season to about 3 meters (10 ft) after the monsoon season. It occupies an area of 190 to 230 square kilometers, based on the season. It is an elliptically shaped lake 35.5 km long with a breadth varying between 3 km and 11 km. It is located in Nagaur and Jaipur districts and it also borders the Ajmer district. The circumference of the lake is 96 km, surrounded on all sides by the Aravali hills.

Halophiles of Sambhar Salt Lake

357

FIG. 2: Major salt lakes of Rajasthan

The Sambhar lake basin is divided by a 5.1 km long dam made of sand stone. After salt water reaches a certain concentration, it is released from the west side to the eastern side by lifting dam gates. To the east of the dam are salt evaporation ponds where salt has been farmed for a thousand years. It produces 196,000 tons of salt every year, which equals 8.7% of India's salt production (Jain, 2005). This eastern area is 80 km². and comprises salt reservoirs, canals and salt pans separated by narrow widges. To the east of the dam is a railroad, built by the British (before India's independence) to provide access from Sambhar Lake City to the salt works. Salinity of Sambhar lake fluctuates from hypo to hypersaline condition with season and hydrological input. The Sambhar, a recognized saline lake and Ramsar site, boasts peculiar physical and chemical characteristic. It is considered athalassohaline as its salt composition derives from the dissolution of minerals of geological origin (Rodriguez-Valera, 1993). Similarly to other hypersaline ecosystems, the lake is subjected to drastic physico-chemical conditions including high salinity, high radiation (UV) and strong changes in temperatures and dryness which make it a relevant study target for microbiologists. Salt-loving extremophiles, called halophiles, are highly specialized for living in such environments. Extremophiles, including halophiles, provide a glimpse into what life on other planets might be like. These extreme environments are similar to the environments that exist (or used to exist) on other planets in our solar system, especially Mars. Extremophiles, therefore, provide us with an opportunity to study the kinds of organisms that might have lived or still live on Mars. The longevity of different types of halophiles within salt crystals has become a popular topic, relevant to disciplines including geology, biogeography, evolution, and even space exploration (McGenity, et al., 2000).

358

Microbes: In Action

Satellite image of Sambhar Salt Lake

Hypersaline environments including saltern pond brines and natural salt lakes are relatively simple ecosystems with low diversity and high community densities. These ecosystems present ecologists a ideal system for studying fundamental questions of biodiversity, selection, biogeography, and evolution in the microbial world, much more conveniently than in the far more complex freshwater and marine systems. Challenges in Hypersaline Environment The microorganisms that live in hypersaline lakes are considered to be extremophiles. An extremophile is a living creature, usually microbial, that thrives under conditions that humans cannot tolerate. Halophiles are salt-loving organisms that inhabit hypersaline environments and are well equipped to balance the osmotic pressure of the environment and resist the denaturing effects of salts. Hypersaline environments have low biological diversity because the environment is so challenging and the inhabitants are exposed to multiple forms of stress. Halophiles are exposed to desiccation by osmotic loss of water as they thrive at NaCl levels of 3.5 mol/L. To prevent the loss of cellular water to the environment, halophiles accumulate solutes within the cytoplasm (Galinski, 1993). Halophilic archaea, by use of a Na+ pump, push Na+ ions out of the cell, while concentrating K+ ions within the cell in order to balance osmotic pressure. This balance consists of an internal concentration of K+ at around 5M and an outside concentration of Na+ at around 4M. Halotolerant Bacteria and algae balance osmotic pressure by producing, or taking from the environment, organic molecules such as glycerol to act as compatible solutes (Litchfield, 1998). Microbes that inhabit hypersaline lakes experience intense ultraviolet (UV). To counteract and survive this type of environment, halophiles have efficient DNA repair, but they also have mechanisms to prevent damage. For example, halophilic Archaea have a low number of UV "targets," thymines, in their genomes. The colorful carotenoids may also be a strategy for photoprotection as mutant colorless halophiles are UV sensitive (e.g., Dundas and Larsen, 1963). These are a class of very important antioxidants that may provide protection from UV damage. Exposure to UV light is necessary for the activation of Bacteriorhodopsin, a purple chromoprotein located within the cell membrane, which acts as a proton pump and drives ATP synthesis. Halobacterium species

Halophiles of Sambhar Salt Lake

359

produce gas vesicles which enable them to float to the surface of the water column where light and oxygen are readily available (DasSarma and Arora, 2001) In many athalassohaline environments, life at the extremes of high salt is combined with the need to thrive at alkaline pH and elevated temperatures. Long term of survival of halophiles is also challenging as well as interesting. Elevated temperature and saturation of brine lead to crystallization of salt. At the time of crystallization small fluid inclusions remain entrapped within the crystals. Microorganisms inhabiting the brine get entrapped in these inclusions (Baati et al.,2010). Studies have showed that such microorganisms may retain their viability for long periods. The population of viable halophiles is hypothesized to decrease as resources are depleted over time (Norton and Grant, 1988). Halophilic Microbes Halophiles are found distributed all over the world in hypersaline environments, many in natural hypersaline brines in arid, coastal, and even deep sea locations, as well as in artificial salterns used to mine salts from the sea. Specific microbial and crustacean species thrive in high salinity environment (Hammer, 1986), that are otherwise inhospitable to most life forms. Some of these species attain dormancy when they are desiccated, and organisms of certain species have been shown to survive for over 250 million years (Horikoshi and Grant, 1998). Halophiles can be grouped as slightly, moderately or extremely halophilic, depending on their requirement for NaCl. Moderately halophilic bacteria are microorganisms able to grow optimally in media containing 3 to 15% (wt/vol) salts (Kushner, 1993). This group is very heterogeneous taxonomically and includes a great variety of species belonging to Archaea (Mathrani et al., 1988) and Bacteria (Ventosa, 1994). Halophilic microbes adapted to life at high salt concentrations are found in all three domains of life: Archaea, Bacteria, and Eucarya, however, eukaryotes are in small numbers (Baxter et al., 2005). It is noteworthy that low taxonomic biodiversity is observed in all the saline environments (Oren 1994; Kamekura, 1998), yet the metabolic diversity of halophiles is great. The diversity of metabolic types encountered decreases with salinity (Oran, 2002). Sambhar Salt lake is a unique ecosystem and heaven for halophiles that can be categorized as a extremophiles group. Studies on the lake resulted in retrieval of microbes belonging to all the three domains, Archaea, Bacteria, and Eucarya. Upasani and Desai (1990) isolated six strains of red, extremely haloalkaliphilic bacteria and designated them as SSL 1 to SSL 6. All the isolates showed obligate requirements for sodium chloride (>15%, w/v) and high pH (>9.0). Magnesium ions were required in traces for maintaining morphological structure and pigmentation. These strains were assigned to newly proposed genus Natronobacterium.

360

Microbes: In Action

Sambhar lake brine showing Pink hue imparted by Halophilic Archaea

The most remarkable and obvious feature of salt lakes is their red/orange/pink-purple colouration. This colour is imparted by the extreme halophilic archaea bacterial pigments called carotenoids and bacterioruberins. These pigments are similar to that found in tomatoes, red peppers, pink flamingos, and in many colorful flowers and autumn leaves. These pigments protect their delicate cells from the intense desert sunlight (Shun Ichi, 1996). TABLE 1: Halophilic Microbes isolated from Sambhar Salt lake Isolated Halophile

Genus

Reported by

Natrobacterium Ectothiorhodospira Halobacterium

Upasani and Desai (1990) Upasani (2008) Sundaresan et al.,(2006)

Geomicrobium Geomicrobium Staphylococcus Bulleidia

Kumar et al., 2012

Bacillus Bacillus Bacillus Bacillus Bacillus Bacillus Bacillus Micrococcus Staphylococcus Sediminibacillus Bacillus

Nigam et al.,2013 Annapurna et al.,2012 Rahman et al. (1993)

Extremely haloalkaliphilic Archaebacteria SSL 1 to SSL 6 Ectothiorhodospira sp. Halobacterium salinarium Extremely Halophilic Eubacteria Haloalkaliphilic bacterium EMB1 Haloalkaliphilic bacterium EMB2 Haloalkaliphilic bacterium EMB3 Haloalkaliphilic bacterium EMB4 Moderate Halophiles NPBT002 Bacillus subtilis Bacillus subtilis B. amyloliquefaciens B. sphaericus B. licheniformis B. sphaericus Micrococcus Sp. Staphylococcus capitis Sediminibacillus halophiles Bacillus selenatarsenatis

Sundaresan et al., 2006

Sahay et al., 2012

Halophiles of Sambhar Salt Lake

361

Isolated Halophile

Genus

Oceanobacillus sp. Bacillus flexus Bacillus aquimaris Bacillus baekryungensis Virgibacillus Sp. Thalassobacillus devorans Amphibacillus sp. Halobaillus trueperi Halomonas sp. Halomonas salifodinae Halomonas variabilis Halomonas campisalis Halomonas salina Halomonas caseinilytica Halomonas aquamarina Halomonas muralis Halomonas meridian Salicola marasensis Marinobacter hydrocarbonoclasticus Nitrinicola lacisaponensis Alkalibacterium sp. Exiguobacterium sp. Alcaligenes sp. Anacystis nidulans Chromohalobacter salexigens Marinobacter aquaeolei SL-1 to Sl-8

Oceanobacillus Bacillus Bacillus Bacillus Virgibacillus Halobacillus Amphibacillus Halobaillus Halomonas Halomonas Halomonas Halomonas Halomonas Halomonas Halomonas Halomonas Halomonas Salicola Marinobacter Nitrinicola Alkalibacterium Exiguobacterium Alcaligenes Anacystis

Reported by

Dautania and Singh (2012)

Bacillus

Gaur and Mohan,2014

Streptomyces viridiviolaceus Streptomyces radiopugnans JAJ 71 JAJ 73, JAJ 83 JAJ 77, JAJ 82 R29 R3 R18 R40 R13 Eukaryote

Streptomyces

Sahay et al., 2012

Actinoalloteichus Streptomyces Pseudonocardia Actinopolyspora Streptomyces Actinoplanes Saccharopolyspora Microbispora

Jose et al.,2013

Dunaliella salina

Dunaliella (Eukaryote)

Kulshreshtha and Singh, 2013

Sahay et al., 2012

Actinomycetes

Yadav et al., 2013

Halophiles are also widely spread within the domain Bacteria. Temperature is a major factor determining the competition between red Archaea and colorless

362

Microbes: In Action

bacteria in the intermediate salinity range, The Archaea being favored at high temperatures (Rodrigues-Valera et al.,1980a). Halophilic bacteria and archaea overlap in the salinity range of 250-320 g/l (Rodrigues-Valera et al.,1981). Unlike archaea, most halophilic bacteria can live only at moderate salinity (up to 2.5 M salt). Moderately halophilic bacteria are widely distributed in hypersaline habitats. A number of moderately halophilic Bacillus species have been isolated from hypersaline environments (Garabito et al., 1997, Arahal et al., 1999, Caton et al., 2004). Rahman et al. (1993) reported that Sambhar brine mainly contains Bacillus and Halobacterium, and reported Bacillus subtilis, B. amyloliquefaciens, B. sphaericus, B. licheniformis from the lake. The occurrence of Bacillus licheniformis in the lake was reported to 78% by Rahman (2005). Bacterial halophiles vary widely in physiological properties, including aerobic and anaerobic chemo-heterotrophs, photo-autotrophs, photo-heterotrophs, and chemo-lithotrophs. Halophilic anoxygenic sulfur oxidizing bacteria was also isolated from Sambhar lake brine by Upasani (2008). The application of modern genomic approaches to research on halophilic Archaea and Bacteria in recent years has yielded fascinating insights into the diversity, adaptations and evolution of these unique organisms. Microbes of strain Halofarux volcani, Natrialba, Ectothiospira, Geomicrobium halophilum, Staphylococcus xylosus, Bulleidia extructa has been isolated and identified identified from sambhar lake on the basis of 16S r-DNA (Upasani, 2008; Kumar et al.,2012). Sahay et al. (2012) isolated 93 haloalkaline bacteria from the lake and categorized into 32 groups, with each group representing a different taxa belonging to 3 phyla (Firmicutes, Proteobacteria and Actinobacteria) by employing molecular tools. The life in sambhar salt lakes is completely dominated by prokaryotes, i.e. bacteria and archaea, particularly at "extreme" conditions (higher alkalinity and salinity, or lower oxygen content). However, a rich diversity of eukaryotic algae, protists and fungi have also been encountered. Dunaliella salina is a unicellular green microalga that is considered as one of the best commercial sources of carotenoids has been isolated from the lake (Kulshreshtha and Singh, 2013). Multicellular crustaceans brine shrimp Artemia saline has also been reported from the lake, though it is now devoid of it. According to Valera et. al, 1981, in saline lakes very small salt loving microorganisms form the base of lake's ecological food pyramid. These ecosystems would not exist if there were not halophilic bacteria that have established an ideal habitat in the saline lakes and their extremely salty environment. Halophilic Fungus Extreme environments have long been considered to be populated almost exclusively by prokaryotic organisms and therefore remained monopolized by bacteriologists (Gunde-Cimerman et al., 2009). Extremophiles from the Eukarya domain can also be found living in extreme conditions, as long as there are enough energy sources available to sustain their metabolism. Most eukaryotic extremophiles belong to the algal and fungal categories (Schleper et al., 1995). Hypersaline environments with extreme salt concentration are also home to

Halophiles of Sambhar Salt Lake

363

several unique eukaryotes yet most diversity studies in salterns have focused on halophilic Archaea bacteria of the order Halobacteriales, which comprise the main microbial component in these environments (Oren, 2002). Earlier it was a well accepted notion that other organisms such as algae, protozoa, eubacteria and even fungi are not found in the salterns as they cannot survive under high salt conditions (Gunde-Cimerman et al., 2004). In 2000 fungi were first reported to be active inhabitants of solar salterns (Gunde-Cimerman et al., 2009). Last decade has seen a surge in the studies focusing on halophilic and halo tolerant fungi. Most of the studies of fungi in extreme salt conditions have been performed in the northern latitudes, in the region of Russia and the Dead Sea (Gunde-Cimerman et al., 2004, Kis-Papo et al., 2001, 2003, Buchalo et al., 1998, Butinar et al. (2005a,b). Buchalo et al. (2000) have reported 26 fungal species from the Dead Sea. Sambhar Salt lake is the most studied saline habitat in Rajasthan. Though the lake has been explored for many of its aspects yet the status of halophilic and halo-tolerant fungi still remains under-explored. There are no major reporting of Halophilic or halo-tolerant fungal strains from Sambhar salt lake. Though Annapurna et al.,(2012) worked on protease producing fungi and bacteria from of sambhar lake and Mumbai Sea Shore, yet no breakthrough was reported. Biotechnological Potential of Halophilic Microbes Halophilic microbes have been considered as a group with great biotechnological potentials similar to that of other extremophilic microorganisms. The halo-bacteria have advantage over other extremophile micro-organisms as they are easy to grow and maintain in laboratory conditions and the necessity for aseptic condition is decreased to minimum. These halophilic microorganisms leading life in saline environments offer a multitude of potential applications in various fields. In comparison to other groups of extremophilic microorganisms such as the thermophiles and the alkaliphiles, the halophiles of all three domains have been relatively little exploited in biotechnological processes, with notable exceptions of β-carotene from Dunaliella, bacteriorhodopsin from Halobacterium, and ectoine from Halomonas (Oren, 2010). These organisms are known to produce stable hydrolytic enzymes such as DNAases, lipases, amylases, gelatinases and proteases capable of functioning under high salt conditions at which other proteins usually precipitate or denature. Halophilic proteins compete effectively with salts for hydration, a property that may result in resistance to other lowwater-activity environments, such as in the presence of organic solvents. Kumar et al. (2012) reported 20 strains of moderate halophiles from Sambhar salt lake with the amylase, lipase and protease activity. Bacillus subtilis growing optimally at 10% NaCl, showing protease activity has also been reported from Sambhar lake (Annapurna et al.,2012). Also, they are the source of novel halophilic biomolecules having specialized applications e.g. bacteriorhodopsin for biocomputing, pigments for food colouring and compatible solutes as stress protectants (Oren,2002). Possible areas of exploitation of halophiles may stretch from production of valuable compounds and remediation of contaminated

364

Microbes: In Action

waters and soils to future solutions of the world's liquid fuel crisis (Yanhe Ma, 2010). The microbial EPS are used in several biotechnological applications viz., cosmetics, textiles, pharmaceuticals, agricultural, paints and petroleum industries. Halophilic and Halotolerant microbes are also known to produce EPS (Nanjani and Soni, 2012). Sulfated EPS also provide interesting applications for pharmaceutical industry as antitumoral [23], antiviral (Oran, 2010; Harley and Klein, 2008; Zheng et al., 2006) and anticoagulant properties (Nishini et al.,1989). Certain Halophilic Archaea contains Baceriorhodopsin (BR) and halorhodopsin that are membrane bound retinal pigments. This protein enables the organism to use light energy (Oran, 1994). The excellent thermodynamics and photochemical stability of BR has led to technical applications based on its protonmotive, photoelectric and photochemical properties. The application comprises holography, Neural network, optical computing and volumetric and associative optical memories, spatial light modulators and artificial retina (Margesin and Schinner, 2001), Other possible uses of halophilic microorganisms such as treatment of saline and hypersaline wastewaters, and the production of noval exopolysaccharides, poly-beta-hydroxyalkanoate bioplastics and biofuel are being investigated (Oran, 2010). Kargi and Dincer (2000) reported that saline waste water with more than 2% salt can be treated effectively by Halobacter-supplemented activated sludge cultures. Novel developments in the cultivation and production of halophiles, but also developments related to the cloning and expression of their genes in heterologous hosts, will increase the number of enzyme-driven transformations in chemical, food, pharmaceutical and other industrial applications. CONCLUSION Halophiles are an unique and interesting group of extremophilic organisms that have developed potential to withstand harsh, hypersaline conditions. They are able to compete successfully for water and resist the denaturing effects of salts. They include mostly microorganisms, e.g., cyanobacteria, photosynthetic green algae and green and purple bacteria, sulfur-oxiding bacteria, and sulfate reducing bacteria, anaerobic and fermentative bacteria etc. The exploration of halophiles with new and useful applications will in turn deepen our understanding of the functioning of hypersaline ecosystems also. Hypersaline environments and Salt lakes are geographically widespread, numerous and a significant part of the world's inland aquatic ecosystems. They are important natural assets with considerable aesthetic, cultural, economic, recreational, scientific, conservation and ecological values yet saline lakes and wetlands have remained secondarily important for society as compared to their freshwater counterpart. Salt lakes are sensitive even to small changes in any component of their hydrological budgets and climate variables, especially evaporation and precipitation quickly affect them. Global climate warming therefore will affect salt lakes more than freshwater lakes and other inland waters. The effect will be compounded by the fact that salt lakes occur mainly in semi arid regions where most climatic models

Halophiles of Sambhar Salt Lake

365

predict the greatest increase in temperature will occur (Hammer 1990; IPCC 1996). Sambhar salt lake of Rajasthan is also threatened by environmental changes and human activities that reduce its values as natural assets. Already, many salt lakes have been impacted and degraded, almost all irreparably. Degradation continues and is accelerating because of increasing human population densities in surrounding regions and the concomitant expansion of activities to support them, notably drainage, irrigation and land-use. Therefore it is utmost priority to study and conserve these unique ecosystems before they are completely lost from the landscape. ACKNOWLEDGEMENTS The Author is thankful to Science and Engineering Research board (SERB) for financially supporting the research work. REFERENCES Annapurna SA, Amarnath S, Shashank G, Anupam K and Harsh K (2012). Screening, Isolation and Characterization of Protease producing moderately halophilic microorganisms. Asian Journal of Microbiology, Biotechnology and Environmental Sciences. 14(4): 603-612 Arahal DR, Marquez MC, Volcani BE, Schleifer KH and Ventosa A (1999). Bacillus marismortui sp. nov., a new moderately halophilic species from the Dead Sea. International Journal of Systematic Bacteriology. 49: 521-530 Baati H, Guermazi S, Gharsallah N, Sghir A and Ammar E (2010). Microbial community of salt crystals processed from Mediterranean seawater based on 16S rRNA analysis. Can. J. Microbiol. 56: 44-51 Baxter BK, Litchfield CD, Sowers K, Griffith JD, DasSarma PA and DasSarma S (2005). Great Salt Lake Microbial Diversity. In Gunde-Cimerron N, Oren A, Plemenita, A (eds.) Adaptation to Life in High Salt Concentrations in Archaea Bacteria, and Eukarya, Springer, Netherlands. Bertus van den B (2003). Extremophiles as a source for novel enzymes. Current Opinion in Microbiology. 6: 213-218 Buchalo AS, Nevo E, Wasser SP, Oren A and Molitoris HP (1998). Fungal life in the extremely hypersaline water of the Dead Sea: first records. Proceedings Royal Society London Biological Science. 265: 1461-1465 Buchalo AS, Nevo E, Wasser SP and Volz PA (2000). Newly discovered halophilic fungi in the Dead Sea (Israel). Journey to Diverse Microbial Worlds. 2: 241-252 Butinar L, Santos S, Spencer-Martins I, Oren A and Gunde-Cimerman N (2005a). Yeast diversity in hypersaline habitats. FEMS Microbiology Letters 244: 229-234 Butinar L, Sonjak S, Zalar P, Plemenitas A and Gunde-Cimerman N (2005b). Melanized halophilic fungi are eukaryotic members of microbial communities in hypersaline waters of solar salterns. Botanica Marina. 48: 73-79 Caton TM, Witte LR, Ngyuen HD, Buchheim JA, Buchheim MA and Schneegurt MA (2004). Halotolerant aerobic heterotrophic bacteria from the Great Salt Plains of Oklahoma. Microbial Ecology. 48:449-462 DasSarma S and Arora P (2001). Halophiles. Encyclopedia of Life Sciences, Macmillan Press. Dundas ID and Larsen H (1963). A Study on the Killing by Light of Photosensitized Cells of Halobacterium salinarium. Arch. Mikrobiol. 46:19-28 Eugster HP and Hardie LA (1978) Saline lakes. In: Lakes:Chemistry, Geology, Physics, ed. A Lerman.Springer-Verlag, New York, USA Galinski EA (1993). Compatible solutes of halophilic eubacteria: molecular principles, watersolute interactions, stress protection. Experientia. 49: 487-496

366

Microbes: In Action

Garabito MJ, Arahal DR, Mellado E, Marquez MC and Ventosa A (1997). Bacillus salexigens sp. nov., a new moderately halophilic Bacillus species. International Journal of Systematic Bacteriology. 47:735-741 Goetz PW (1986). The New Encyclopaedia Britannica (15th edn), Vol. 3, p.937, Encyclopaedia Britannica Inc., Chicago. Gunde-Cimerman N, Jose Ramos, Ana Plemenitas (2009). Halotolerant and halophilic fungi. Mycological Research. 113:1231-1241 Gunde-Cimerman N, Zalar P, de Hoog S and Plemenitas A (2000). Hypersaline waters in salterns-natural ecological niches for halophilic black yeasts. FEMS Microbiol. Ecol. 32: 235-240 Hammer UT (1990). The effects of climate change on the salinity, water levels and biota of Canadian prairie saline lakes. Verhandlungen Internationale Vereinigung für Limnologie. 24: 321-326 Hammer UT (1986). Saline lake ecosystems of the world. Dordrecht, the Netherlands: Kluwer. Springer. Harley and Klein's Microbiology (2008).7th Edition (Willey, Linda Sherwood, CJ Woolverton and LM Prescott). Publisher-McGraw-Hill Higher Education. Horikoshi K and Grant WD (1998). Microbial life in hypersaline environments. Extremophiles: microbial life in extreme environments. Wiley-Liss, Inc. pp. 93-132. IPCC (1996). Climate Change 1995. Cambridge, UK: Cambridge University Press. Jain AK (2005). Conservation Planning of Sambhar Lake, Rajasthan using Satellite Remote Sensing and GIS, Andhra University thesis. Visakhapatnam: Indian Institute of Remote Sensing. Kamekura M (1998). Diversity of extremely halophilic bacteria Extremophiles. 2(3):289-295 Kargi F and Dincer AR (2000). Use of Halophilic bacteria in treatment of saline waste water by Fed-Batch operation. Water Environ Res. 72:170-173 Kis-Papo T, Kirzhner V, Wasser SP and Nevo E (2003). Evolution of genomic diversity and sex at extreme environments: Fungal life under hypersaline Dead Sea stress, Proc Natl Acad Sci USA. 100: 14970-14975 Kulshreshtha J and Singh GP (2013) Evatution of various inorganic media or growth and biopigments of Dunaliella salina. Int J Pharm Bio Sci. 4(2): 1083 - 1089 Kulshreshtha S, Sharma BK and Sharma S (2013). The Ramsar sites of Rajasthan: Ecology and Conservation of Sambhar salt lake, Jaipur and Keoladeo National Park, Bharatpur. In: Faunal heritage of Rajasthan, India: Conservation and Management of Vertebrates. Springer. Kumar S, Ram Karan, Kapoor S, Singh SP and Khare SK (2012). Screening and isolation of halophilic bacteria producing industrially important enzymes. Braz J Microbiol. 43(4): 1595-1603 Kushner DJ and Kamekura M (1988). Physiology of halophilic eubacteria. In: Halophilic bacteria,(Ed.) F Rodriguez-Valera, CRC Press, Boca Raton, Fla. pp. 109-140 Kushner DJ (1993). Growth and nutrition of halophilic bacteria. Pp. 87-104 in The biology of halophilic bacteria. (RH Vreeland and LI Hochstein, editors). CRC Press. Boca Raton, Florida. Litchfield CD (1998). Surrvival Strategies for Microorganisms:Hypersaline Environments and Their Relevance to Life on Early Mars. Meteoritics and Planetary Sci. 33:813-819 Margesin R and Schinner F (2001) Potential of halotolerant and halophilic microorganisms for biotechnology. Extremophiles.5:73-83 Mathrani IM, Boone DR, Mah RA, Fox GE and Lau PP (1988). Methanohalophilus zhilinae sp. nov., an alkaliphilic, halophilic, methylotrophic methanogen. Int. J. Syst. Bacteriol. 38:139-142 McGenity TJ, Gemmell RT, Grant WD and Stan-Lotter H (2000). Origins of halophilic microorganisms in ancient salt deposits. Environ. Microbiol. 2:243-250 Nanjani SG and Soni HP (2012). Diversity and EPS Production Potential of Halotolerant Bacteria from Veraval and Dwarka. Journal of Pharmacy and Biological Sciences. 2: 20-25. Nishino T, Yokoyama G, Dobashi K, Fujihara M and Nagumo T (1989) Isolation, purification and characterization of fucose containing sulfated polysaccharides from the brown

Halophiles of Sambhar Salt Lake

367

seaweed Ecklonia kurome and their blood-anticoagulant activities. Carbohydr. Res. 186: 119-129 Norton CF and Grant WD (1988). Survival of halobacteria within fluid inclusions in salt crystals. J. Gen. Microbiol. 134:1365-1373 National Wetland Atlas (2010). Rajasthan, AC/EPSA/AFEG/NWIA/ATLAS/31/2010 Space Applications Centre (ISRO), Ahmedabad, India, 214p. Oren A (2002). Diversity of halophilic microorganisms: environments, phylogeny, physiology, and applications. J. Ind Microbiol Biotechnol. 28:56-63 Oren A (1994). The ecology of the extremely halophilic archaea, Federation of European Materials Societies. Microbiology Reviews. 13: 415-439 Oren A (2010). Industrial and environmental applications of halophilic microorganisms. Environ. Technol. 31:825-834 Rahaman AA, Ambikadevi M and Sosamma E (1993). Biological Management of Sambhar Lake Saltworks (Rajasthan, India). 7th Symp. on Salt. 1:633-643. Rodriguez-Valera F (1993). Introduction to saline environments, in The Biology of Halophilic Bacteria, (Eds.) RH Vreeland and LI Hochstein, CRS Press, Boca Raton, Fla, USA. pp. 1-23 Rodriguez-Valera F, Ruiz-Berraquero F and Ramos-Connenzana A (1980). Behaviour of mixed populations of halophilic bacteria in continuous culture. Can. J. Micrbiol. 26: 1259-1263 Rodriguez-Valera F, Ruiz-Berraquero F and Ramos-Cormenzana A (1981). Characteristics of the heterotrophic bacterial populations in hypersaline environments of different salt concentrations. Microb. Ecol. 7: 235-243 Sahay H, Mahfooz S, Singh AK, Singh S, Kaushik R, Saxena AK Arora DK (2012). Exploration and characterization of agriculturally and industrially important haloalkaliphili bacteria from environmental samples of hypersaline Sambhar lake, India. World J Microbiol Biotechnol. 28:3207-3217 Schleper C, Puhler G, Kuhlmorgen B and Zillig W (1995). Life at extremely low pH. Nature. 375: 741-742 Shun Ichi S, Hiroyuki S and Hiroaki T (1996). Voltage-dependent absorbance change of carotenoids in halophilic Archaebacteria. Biochimica ET Biophysica Acta. 1284: 79-85 Upasani V and Desai S (1990). Sambhar Salt Lake. Archives of Microbiology. 154: 589-593 Upasani VN (2008). Microbiological studies on sambhar lake (salt of Earth) Rajasthan India. Eds. Sengupta M and Dalwani S in proceedings of Taal (2007), 12th world lake conference.pp. 448-450 Valera FR, Ruiz-Berraquero F and Cormenzana AR (1981). Characteristics of the Heterotrophic Bacterial Populations in Hypersaline Envioronments of Different Salt Concentrations. Microbial Ecology. 7: 235-243 Ventosa A (1994). Taxonomy and phylogeny of moderately halophilic bacteria, In: Bacterial diversity and systematics. (Ed.) FG Priest, A Ramos-Cormenzana, and BJ Tindall Plenum Press, New York, NY pp.231-241 Williams WD (1996) The largest, highest and lowest lakes of the world: saline lakes. Verhandlungen Internationale Vereinigung fürLimnologie. 26: 61-79 Yanhe Ma, Erwin A, Galinski, William D, Grant, Oren A and Ventosa A (2010). Halophiles:Life in Saline Environments. Appl. Environ. Microbiol. 76:6971-6981 Zheng, Chen C, Cheng Q, Wang Y and Chu C (2006). Oral administration of exopolysaccharide from Aphanothece halophytica (Chroococcales) significantly inhibits influenza virus (H1N1)-induced pneumonia in mice. Int. Immuno-pharmacol. 6: 10931099

CHAPTER 23 RNA Interference and its Application in Plant Disease Management Rakesh Pathak1, S K Singh1 and Praveen Gehlot2 1

Central Arid Zone Research Institute, Jodhpur-342003 India Department of Botany, Jai Narain Vyas University, Jodhpur- 342001 India Corresponding author: [emailprotected]

INTRODUCTION Pathogens are the major agents of plant diseases and cause significant yield loss in most of the agricultural and horticulture crops. Plant diseases have been addressed by several conventional methods including crop protection and resistant varieties to combat infection in plants. Various attempts have been made in the field of plant disease management since inception of green revolution. Development of disease resistant varieties has been considered the best way for disease management but this process is time consuming and availability of limited genetic resources for most of the crops has also been bottleneck for development of robust varieties (Hoisington et al., 1999). Use of chemical is one of the effective measures for pathogen control, but they are often non-specific in its effects and kill beneficial organisms along with pathogens. Besides this chemical control may have undesirable effects on health, safety and causes environmental risks (Manczinger et al., 2002). Much attention has been paid on integrated disease management practices in last 25 years which make disease control comparatively inexpensive and safe (Mandal et al., 2012). Over the past few years breeding possibility have been broadened by genetic engineering and gene transfer technologies including transcriptomics, proteomics and metabolomics for understanding plant metabolic pathways, association of key genes and their regulations. Manipulation in plant genome is an emerging method to develop resistant cultivars combating plant diseases and facilitate new insights into the complex metabolism that give rise to a desired phenotype. It may allow discovery of new target genes to modify the pathways. Such genes can then be subjected to new metabolic engineering efforts and applications (Wani et al., 2010). Molecular biology has the potential of exploiting the traditional breeding and biotechnological methods viz., identification, mapping, cloning of pest and disease resistant genes and their utilization by introgression, pyramiding and development of transgenics (Man et al., 2008; Shanghera et al., 2011) for resistant crop varieties. Ribonucleic acid (RNA) mediated functions have been increased with the discovery of small non-coding RNAs. RNA interface (RNAi) has recently been

370

Microbes: In Action

recognized as an important phenomenon of co-suppression of specific genes before its translation. It is a biological process in which RNA molecules inhibit gene expression by destructing the specific mRNA molecules. Historically, it was known by other names i.e. co-suppression, post transcriptional gene silencing, and quelling. Andrew Fire and Craig C. Mello won the Nobel Prize in Physiology or Medicine for their work on RNAi in the nematode worm Caenorhabditis elegans in 2006. RNAs are the direct products of genes and these small RNAs can bind to other specific messenger RNA (mRNA) molecules and affect their activity. microRNA (miRNA) and small interfering RNA (siRNA) are small RNA molecules and make central to RNAi. The actual molecules that led to RNAi are short double stranded RNA (dsRNA) oligonucleotides proceeded internally by an enzyme called Dicer. RNAi is a process of post transcriptional mRNA degradation that is triggered by dsRNA or 21–26 nucleotide siRNA (Vance and Voucheret, 2001; Waterhouse et al., 2001; Hannon, 2002; Pickford and Cogoni, 2003). The RNA-mediated gene silencing has been demonstrated in model eukaryotic organisms (Fire et al., 1998; Waterhouse et al., 1998; Misquitta and Paterson, 1999; Elbashir et al., 2001; Jacque et al., 2002; Schramke and Allshire, 2003). RNAi has an important role in defending cells against parasitic nucleotide sequences, viruses and transposons. It also influences the development and is a valuable tool used for large-scale screens that systematically shut down the genes in the cell and help to identify the components necessary for a particular cellular process or cell division. RNAi is controlled by the RNA induced silencing complex (RISC) and is initiated by dsRNA molecules in the cytoplasm of cell where they interact with the catalytic RISC component argonaute. RNAi enables a more confined spatial disruption of the target mRNA expression and is useful for the dissection of gene function for organ formation by silencing the gene throughout the organism or in specific tissue (Islam et al., 2005). Tissue or organ-specific RNAi is useful not only for gene function research but also for the improvement of plant-derived products. RNAi technology can be used to identify and assess thousands of genes within the genome that potentially participate in disease phenotypes and provide an efficient means for blocking expression of a specific gene and evaluating it's to chemical compounds for changes in signalling pathways. RNAi operates both in plants and animals by using dsRNA and triggers the target hom*ologus mRNAs for degradation or inhibiting its transcription or translation (Wani et al., 2010; Younis et al., 2014; Kirigia et al., 2014). RNAi allows the study of function of huge number of genes (Dang et al., 2014) and therefore, has emerged as a method of choice for gene silencing in fungi (Ghag et al., 2014), viruses (Wani and Sanghera, 2010; Hajeri et al., 2014; Kirigia et al., 2014), bacteria (Nakashima and Kentaro 2014), nematode (Wani et al., 2010; et al., 2014; Ajjappala et al., 2014) and plants (Numata et al., 2014). The present review provides brief information on the application of RNAi in plant disease management. METHODS TO INDUCE RNA INTERFERENCE IN PLANTS Induction of RNAi in plants involves delivery of the active molecules that triggers the RNAi pathway in plants. It has been achieved by expressing hairpin

RNA Interference and its Application

371

RNA (hpRNA) that creates a dsRNA (Wesley et al., 2001). These hpRNAs are potent inducers of post transcriptional gene silencing (PTGS) and give rise to siRNAs derived from the dsRNA. Number of RNAi vectors for delivery of dsRNA or siRNA in to different cell or tissue for selected gene (s) have been developed during recent years but differ in cloning strategies, selectable markers and other elements (Wesley et al., 2001; Jaskiewicz and Filipowicz, 2008; Wani et al., 2010; Younis et al., 2014; Numata et al., 2014). The RNAi-mediated gene silencing in plants includes transforming plants with hpRNA producing vectors by Agrobacterium mediated plant transformation or particle bombardment to produce stable transgenic plants and infiltration of Agrobacterium cultures (Shang et al., 2007; Senthilkumar et al., 2010). Besides these, artificial micro RNA (Warthmann et al., 2008) based vectors, direct siRNA delivery (Tang et al., 2006) and exogenous dsRNA spray (Tenllado et al., 2004) are also shown to be effective for gene silencing. Among these, the most reliable and commonly used methods for transfer of dsRNA to plants are agro-infiltration (Mlotshwas et al., 2002; Kirigia et al., 2014), micro-bombardment (Klahre et al., 2002) and virus induced gene silencing (VIGS) (Kumagai et al., 1995; Mallory et al., 2002; Kirigia et al., 2014; Younis et al., 2014). Mechanism of RNAi In the past decades, understanding of silencing mechanism such as pathogen– derived resistance, post-transcriptional gene silencing and miRNA regulation has already been identified. The determination of the mechanism is the observation that the plants under silencing genes in an RNAi-related process produced about 20–25 nucleotides long, short RNAs that match with the gene being silenced (Basavaprabhu et al., 2011). RNA silencing has sequence specific mechanism of supressing the gene expression. Mechanism of RNAi starts when a dsRNA is introduced in a cell either naturally or artificially (Fire et al., 1998; Bernstein et al., 2001; Wesley et al., 2001; Jaskiewicz and Filipowicz, 2008). An endo-ribonuclease enzyme cleaves the long dsRNA into small pieces of RNA i.e. miRNA or siRNA depending upon the origin of long dsRNA. The dsRNA may be generated either by RNA dependent RNA polymerase or bidirectional transcription of transposable elements or physically introduced. The dsRNAs trigger RNA silencing (Nuria et al., 2011) and result in sequence specific inhibition of gene expression at the transcription, mRNA stability or translational levels. The unifying features of this phenomena are the production of small RNAs (21-26 nucleotides) that act as specific determinants for down-regulating gene expression (Waterhouse et al., 2001; Hannon, 2002; Pickford and Cogoni, 2003) and the requirement for one or more members of the Argonaute family of proteins (Hammond et al., 2000). There are two small RNAs in the RNAi pathway i.e. siRNAs and miRNAs that are generated through processing of longer dsRNA and stem loop precursors (Dunoyer et al., 2010). Dicer enzymes play a critical role in their formation and cleave long dsRNAs and stem loop precursors into siRNAs and miRNAs in an ATP-dependent manner, respectively (Praveen et al., 2012). Gene transcript levels are being regulated either by TGS or PTGS and they degrade the target mRNA. This degradation is mediated through the production of siRNAs from the

372

Microbes: In Action

dsRNA. Once produced, these small RNA molecules or short interfering RNAs (siRNAs) are incorporated in a multi-subunit complex called RISC (Hammond et al., 2000; Tang et al., 2003) in conjunction with the argonaute multi-domain protein, which contains an RNAse domain responsible for target degradation (Martinez, 2002, Filipowicz, 2005). The synthesised dsRNA is then acted on by the dicer enzymes to generate new secondary siRNAs. The newly synthesized siRNA again joins the cycle for the production of long double stranded RNA and sustains the amplification process. Thus, once a dsRNA is introduced into a cell, its effect can persist over the gene knockout effect through the organism development (Daniel and John, 2008). RNAi in Plant Diseases Management Our global food supply is still vulnerable due to number of pathogens and pests in spite of several advances in plant disease management strategies and this situation stresses the combination of conventional, unconventional and frontier technologies. The effects of gene silencing in plants were used in efforts to develop resistance to diseases caused by viruses, fungi, nematode and bacteria. RNAi technology has emerged as one of the most potential and promising strategies to develop resistance in plants combating various fungal, bacterial, viral and nematode diseases. The pathogen derived resistance has been achieved by transforming plants with genes, or sequences, derived from the pathogen, with the aim of blocking a specific step in the life or infection cycle of the pathogen (Karthikeyan et al., 2013). The nature of this biological phenomenon has been evaluated in a number of host-pathogen systems and effectively used to silence the action of pathogen. Bacteria The development of resistance to crown gall formation through RNAi mediated oncogene silencing is one of the best examples of bacterial disease management through this technique (Nakashima and Kentaro 2014). For this purpose expression of iaaM and ipt oncognes is a prerequisite for wild type tumour formation and has shown resistance to crown gall disease in transgenic Arabidopsis thaliana and Lycopersicon esculentum transformed with RNAi. The genes effectively shut down the expression of the corresponding bacterial gene during infection and the invading bacteria remain unable to produce hormones required to cause tumours thus preventing the spread of infection. The plants deficient in silencing were hyper-susceptible to Agrobacterium tumefaciens (Dunoyer et al., 2007). The procedure can be exploited to develop broad spectrum resistance in ornamental and horticultural plants which are susceptible to crown gall tumorigenesis. This approach can be advocated for the effective management of those pathogens which multiply very rapidly and results in tumor formation such as Albugo candida, Synchytrium endobioticum, Erwinia amylovora etc. (Wani et al., 2010). Agarwal et al. (2007) reported a new class of sRNA (lsiRNAs) found associated with Pseudomonas syringae infection. One of these lsiRNAs, AtlsiRNA1, contributes to plant bacterial resistance by silencing AtRAP, a negative regulator of plant defense.

RNA Interference and its Application

373

Virus Plant viruses are difficult to combat due to the scarcity of effective counter measures and are responsible for major diseases. RNAi application has resulted in successful control of many economically important viral diseases in plants (Francisco et al., 2004, Cakir and Tör, 2010). Modified viruses as RNA silencing triggers are used as a mean for inducing RNAi in plants. The virus resistant plants was first reported to PVY in potato using this technology with the help of harbouring vectors for simultaneous expression of both sense and antisense transcripts of the helper-component proteinase (HC-Pro) gene (Waterhouse et al., 1998). The P1/HC-Pro suppressors from the potyvirus inhabited silencing at a step down stream of dsRNA processing (Chapman et al., 2004). Different viruses have been modified to serve as vectors for gene expression (Timmermans et al., 1994; Pogue et al., 2002) and some viruses viz., tobacco mosaic virus (TMV), potato virus X (PVX) and tobacco rattle virus (TRV) can be used for both protein expression and gene silencing (Kumagai et al., 1995; Angell and Baulcombe, 1999; MacFarlane and Popovich, 2000; Mallory et al., 2002). Virus induced gene silencing (VIGS) is one of the commonly used RNA silencing methods to control the plant viruses (Senthilkumar and Mysore, 2011). RANi technology has been successfully utilized in inducing immunity reaction against several other viruses in different plant-virus systems viz., bean pod mottle virus in soybean (Zhang and Ghabrial, 2006; Zhang et al., 2009); poplar mosaic virus (Naylor et al., 2005), tomato bushy shunt virus (Hou and Qiu, 2003), tomato golden mosaic virus (Peele et al., 2001) in tobacco; tobacco rattle virus in tobacco, Arabidopsis, tomato, Solanum species, Aquilegia, opium poppy, chilli pepper (Ratcliff et al., 2001; Brigneti et al., 2004; Chung et al., 2004; Hileman et al., 2005; Gould and Kramer, 2007); potato virus x in tobacco and potato (Ruiz et al., 1998; Faivre-Rampant et al., 2004); barley stripe mosaic virus in barley and wheat (Holzberg et al., 2002; Scofield et al., 2005; Cakir and Tör, 2010); brome mosaic virus in barley, rice and maize (Ding et al., 2006) etc. More than 40 viral suppressors have been identified in plant viruses (Ruiz and Voinnet, 2007). Results from some of the well-studied virus suppressors indicated that they interfere with systemic signaling for silencing (Mlotshwas et al., 2002). p69 gene encoded by Turnip yellow mosaic virus has been identified as a silencing suppressor and prevents secondary dsRNA synthesis (Chen et al., 2004). P14 protein encoded by Aureus viruses suppressed both virus and transgene-induced silencing by sequestering both long dsRNA and siRNA (Merai et al., 2005). Multiple suppressors have also been reported in the Citrus tristeza virus, where p20 and coat protein play important roles in the suppression of silencing signal (Lu et al., 2004). These suppressors of gene silencing are often involved in viral pathogenicity, mediate synergism among plant viruses and result in the induction of more severe disease. Simultaneous silencing of such diverse plant viruses can be achieved by designing hairpin structures that can target different viruses in a single construct (Díaz-Pendón and Ding, 2008). Fungi The fungi kingdom is estimated to include more than 1 million species, with enormous diversity in ecology, morphology and life cycles. RNAi works as a tool

374

Microbes: In Action

for reverse genetics in fungi and has the ability to regulate the expression of several genes (Tomer et al., 2011; Yunkun et al., 2011). The functionality of absorbed exogenous RNAi molecules and the small RNAs found in fungi offer great adaptability and plasticity in acquiring the desired effects on gene expression (Nakayashiki and Nguyen, 2008). Studies of the filamentous fungus Neurospora crassa and the fission yeast Schizosaccharomyces pombe have uncovered key RNAi components and functions (Dang et al., 2011). hom*ology based gene silencing induced by dsRNA, transgenes or antisense has successfully been demonstrated in pathogenic fungi viz., Cladosporium fulvum (Bolton et al., 2008), Neurospora crassa (Nolan et al., 2008), Aspergillus nidulans (Hammond, 2005), Schizosaccharomyces pombe (Volpe et al., 2002), Magnaporthe oryzae (Nunes, 2011). RNAi elucidates gene functions also in phytopathogenic fungi and expresses it by hpRNA delivered through plasmids, sequences integrated in fungal or plant genomes. These approaches have drawbacks ranging from instability of hairpin construction to difficulties in preparing and handling transgenic plants to silence hom*ologous sequences in fungi grown on these plants (Mascia et al., 2014). They expressed RNAi in phytopathogenic fungi by direct transfection with a plant virus-based vector and suggested that the approach also can be used to obtain foreign protein expression in fungi. Nematodes Parasitic nematodes belong to the most wide spread pathogens, interacting with other pathogenic microorganisms in disease complexes that cause damage to plants and reduces yields, degrade the quality, prevent the successful development of plant (Chitwood, 2003). It measure through conventional approaches is difficult. Therefore, a natural, eco-friendly and a cost-effective defense strategy for the control of plant parasitic nematodes is needed. The origin of RNAi technology by delivering dsRNA has been very successful in the model non-parasitic nematode Caenorhabditis elegans resulted in to the possibilities of this mechanism for protecting plants from nematode damage (Fire et al., 1998). Since RNAi is induced in C. elegans by feeding it dsRNA, hence it was reasoned that expressing hpRNAs containing sequences of vital nematode genes in the host plant might deliver dsRNA to a feeding nematode to disable or kill it. Therefore, the use of RNAi has rapidly emerged as the technique for plant nematologists to put their efforts, especially for nematode management in agriculture as majority of its genes have been characterised using this technique (Kamath et al., 2003). RNAi-mediated suppression of a gene plays a crucial role in hindering the nematode growth and may adversely affect the advancement of pathogenesis. There are number of evidences for the efficacy of RNAi in plant parasitic nematode management and a wide range of genes have been targeted for silencing in cyst and root knot nematode species (Mann et al., 2008; Wani et al., 2010). Fanelli et al. (2006) achieved expression of chitin synthase gene by soaking intact eggs of plant parasitic nematode within their gelatinous matrix in a solution containing dsRNA. The enzyme plays a key role in the synthesis of the chitinous layer in the eggshell. The RNAi depleted its transcript leading to delay in hatching of juveniles from treated eggs. Similarly, Urwin et al. (2002) reported that RNAi targeting for cysteine proteinase transcripts have not reduced

RNA Interference and its Application

375

the parasitic population of established nematodes on plants however it resulted into the alteration of their sexual fate in favour of males at 14 days after invasion. On the other hand the sexual fate of Heterodera glycines exposed to dsRNA corresponding to a protein with hom*ology to C-type lectins was not affected but 41% fewer nematodes were recovered from the plants. The studies suggest that resistance in crop plants may be created with the help of RNAi technology against cyst nematodes. CHALLENGES AND FUTURE PROSPECTS The RNAi has ability to silence gene expression in a sequence specific manner. Therefore, this technique has great prospective in agriculture specifically for the management of plant diseases. Tissue or organ-specific RNAi vectors have already been proven to be useful for targeted gene expression in specific plant tissues with negligible interference with the normal life cycle of the plant. RNAi has enormous potential for control of gene expression, as well as for the use of a tool in functional genomics. RNAi technology has emerged to combat plant pathogens in the near future as it has already added new dimensions in the chapter of plant disease management. However, the major challenge associated with it is the selection of silencing targets for a particular disease and efficient delivery of siRNAs into the specific cell types. The effectiveness of RNAi strategies might be achieved by utilising multiple targets. Development of finely tuned RNAi based gene silencing vectors will be of immense importance for operating the genes in temporally and spatially controlled manner. Such vectors could be based on RNA silencing suppressors and their derivatives. Studies should be focused on other areas i.e., microRNAs, hpRNA and promoter methylation for better and comprehensive understanding of RNAi to work effectively and efficiently in order to manage various invaders of crop plants. Further, the knowledge of changes in the mRNA, protein and cellular metabolites after virus infestation will lead to a greater understanding of the plant-virus interaction and its management. Although, there is a rapid development in the field of RNAi but many mysteries yet to be solved associated with the silencing of the small RNAs genes. CONCLUSION Plant diseases have remained critical problems in agriculture since civilization. Classical plant breeding is a powerful approach to develop the resistant plants varieties to combat these diseases but it is usually costly and time consuming and sometimes crop quality and quantity may be compromised for resistance. The genetic manipulation is comparatively rapid method to introduce disease resistance in the plants. RNAi is a technique to engineer plants by specifically silencing target genes or their promoters. The recent advances have brought high expectations for the future role of this technique in this field of crops resistance. Once the technology will attain the expectations of novel resistance performances it will definitely create a new era in plant disease management. Besides this, with the improvement of our knowledge about this fascinating mechanism of gene regulation, more avenues to effectively harness RNAi for experimental and therapeutic approaches will be revealed.

376

Microbes: In Action

REFERENCES Agarwal SK, Gao S, Vivian-Smith A and Jin H (2007). A novel class of bacteria-induced small RNAs in Arabidopsis. Genes and Development. 21:123-3134 Ajjappala H, Chung HY, Sim JS, Choi I and Hahn BS (2014). Disruption of prefoldin-2 protein synthesis in root-knot nematodes via host-mediated gene silencing efficiently reduces nematode numbers and thus protects plants. Planta. DOI 10.1007/s00425-0142211 Angell SM and Baulcombe DC (1999). Technical advance: potato virus X amplicon mediated silencing of nuclear genes. Plant Journal. 20:357-362 Basavaprabhu LP, Emmanuel O, Henry W, Ibrahim U, Mohammed JS, Basavaraj B and Nigel JT (2011). RNAi-mediated resistance to diverse isolates belonging to two virus species involved in Cassava brown streak disease. Molecular Plant Pathology. 12:31-41 Bernstein E, Caudy AA, Hammond SM and Hannon GJ (2001). Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature. 409:363-366 Bolton MD, van Esse HP, Vossen JH, de Jonge R, Stergiopoulos I, Stulemeijer IJ, van den Berg GC, Borras-Hidalgo O, Dekker HL, de Koster CG, de Wit PJ, Joosten MH and Thomma BP (2008). The novel Cladosporium fulvum lysin motif effector Ecp6 is a virulence factor with orthologues in other fungal species. Molecular Microbiology. 69(1):119-136 Brigneti G, Martin-Hernandez AM, Jin H, Chen J, Baulcombe DC, Baker B and Jones JD. (2004). Virus induced gene silencing in Solanum species. The Plant Journal. 39: 264-272 Cakir C and Tor M (2010). Factors influencing barley stripe mosaic virus mediated gene silencing in wheat. Physiology and Molecular Plant Pathology. 74:246-253 Chapman EJ, Prokhnevsky AI, Gopinath K, Dolja VV and Carrington JC (2004). Viral RNA silencing suppressors inhibit the micro-RNA pathway at an interphase step. Genes and Development. 18:1179-1186 Chitwood DJ (2003). Research on plant-parasitic nematode biology conducted by the United States Department of Agriculture. Agricultural Research Service. Pest Management Science. 59:748-753 Chung E, Seong E, Kim YC, Chung EJ, Oh SK, Lee S, Park JM, Joung YH and Choi D (2004). A method of high frequency virus induced gene silencing in chilli pepper (Capsicum annuum L. cv. Bukang). Molecular Cell. 17:377-380 Dang TVT, Windelinckx S, Henry IM, De Coninck B, Cammue BPA, Swennen R and Remy S (2014). Assessment of RNAi-induced silencing in banana (Musa spp.). BMC Research Notes. 7:655. doi:10.1186/1756-0500-7-655 Dang Y, Yang Q, Xue Z and Liu Y (2011). RNA interference in Fungi: Pathways, functions, and applications. Eukaryote Cell. 10(9):1148-1155 Daniel HK and John JR (2008). RNAi mechanisms and applications. Biotechniques. 44:613616 Diaz-Pendon JA and Ding SW (2008). Direct and indirect roles of viral suppressors of RNA silencing in pathogenesis. Annual Review of Phytopathology. 46:303-326 Ding XS, Schneider WL, Chaluvadi SR, Rouf Mian RM and Nelson RS (2006). Characterization of a brome mosaic virus strain and its use as a vector for gene silencing in monocotyledonous hosts. Molecular Plant Microbe Interaction. 19:1229-1239 Dunoyer P, Christopher AB, Gregory S, Wang Y, Florence J, Abdelmalek A, Christophe H and Olivier V (2010). An endogenous, systemic RNAi pathway in plants. EMBO Journal. 29:1699-1712 Dunoyer P, Himber C, Ruiz-Ferrer V, Alioua A and Voinnet O (2007). Intra- and intercellular RNA interference in Arabidopsis thaliana requires components of the microRNA and heterochromatic silencing pathways. Nature Genetics. 39:848-856 Elbashir SM, Lendeckel W and Tuschl T (2001). RNA interference is mediated by 21- and 22nucleotide RNAs. Genes and Development. 15:188-200 Faivre-Rampant O, Gilroy EM, Hrubikova K, Hein I, Millam S, Loake GJ, Birch P, Taylor M and Lacomme C (2004). Potato virus x induced gene silencing in leaves and tubers of potato. Plant Physiology. 134:1308-1316

RNA Interference and its Application

377

Fanelli E, Di Vito M, Jones JT and De Giorgi C (2005). Analysis of chitin synthase function in a plant parasitic nematode, Meloidogyne artiellia, Using RNAi. Gene. 349:87-95 Filipowicz W (2005). RNAi: the nuts and bolts of the RISC machine. Cell. 122:17-20 Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE and Mello CC (1998). Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391:806811 Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE and Mello CCC (1998). Potent and specific genetic interference by double stranded RNA in Caenorhabditis elegans. Nature. 391:806-811 Francisco T, Cesar L, Ramon L and Ruiz D (2004). RNA interference as a new biotechnological tool for the control of virus diseases in plants. Virus Research. 102(1):85-96 Ghag SB, Shekhawat UK and Ganapathi TR (2014). Host-induced post-transcriptional hairpin RNA-mediated gene silencing of vital fungal genes confers efficient resistance against Fusarium wilt in banana. Plant Biotechnol J. 12(5):541-553 Gould B and Kramer EM (2007). Virus induced gene silencing as a tool for functional analyses in the emerging model plant Aquilegia (columbine, Ranunculaceae). BMC Plant Methods. 12:6 Hajeri S, Killiny N, El-Mohtar C, Dawson WO and Gowda S (2014). Citrus tristeza virus-based RNAi in citrus plants induces gene silencing in Diaphorina citri, a phloem-sap sucking insect vector of citrus greening disease (Huanglongbing). J Biotechnol. 176:42-49 Hammond SM (2005). Dicing and slicing–The core machinery of the RNA interference pathway. FEBS Letter. 579:5822–5829 Hammond SM, Bernstein E, Beach D and Hannon GJ (2000). An RNA directed nuclease mediates post-transcriptional gene silencing in Drosophila Cells. Nature. 404:293-296 Hannon GJ (2002). RNA interference. Nature. 418: 244-251 Hileman LC, Drea S, Martino G, Litt A and Irish VF (2005). Virus induced gene silencing is an effective tool for assaying gene function in the basal eudicot species Papaver somniferum (Opium poppy). The Plant Journal. 44:334-341 Hoisington D, Khairallah M, Reeves T, Ribaut JM, Skovmand B, Taba S and Warburton M (1999). Plant genetic resources: what can they contribute toward increased crop Productivity. Proceedings of the National Academy of Sciences of the USA. 96:5937-5943 Holzberg S, Brosio P, Gross C and Pogue GP (2002). Barley stripe mosaic virus-induced gene silencing in a monocot plant. The Plant Journal. 30:315-327 Hou H and Qiu W (2003). A novel co-delivery system consisting of a tomato bushy stunt virus and a defective interfering RNA for studying gene silencing. Journal of Virology Methods. 111:37-42 Islam SMS, Miyazaki T, Tanno F and Itoh K (2005). Dissection of gene function by RNA silencing. Plant Biotechnology. 22:443-446 Jacque JM, Triques K and Stevenson M (2002). Modulation of HIV-1 replication by RNA interference. Nature. 418: 435-438 Jaskiewicz L and Filipowicz W (2008). Role of Dicer in posttranscriptional RNA silencing. Current Topic in Microbiology and Immunology. 320:77-97 Karthikeyan A, Deivamani M, Shobhana VG, Sudha M and Anandhan T (2013). RNA interference: evolutions and applications in plant disease management. Archives of Phytopathology and Plant Protection. 46(12):1430-1441 Kirigia D, Runo S and Alakonya A (2014). A virus-induced gene silencing (VIGS) system for functional genomics in the parasitic plant Striga hermonthica. Plant Methods. 2014 10:16. doi:10.1186/1746-4811-10-16 Klahre U, Crete P, Leuenberger SA, Iglesias VA and Meins F (2002). High molecular weight RNAs and small interfering RNAs induce systemic post transcriptional gene silencing in plants. Proceedings of the National Academy of Sciences of the USA. 99:11981-11986 Kumagai MH, Donson J, della-Cioppa G, Harvey D, Hanley K and Grill LK (1995). Cytoplasmic inhibition of carotenoid biosynthesis with virus-derived RNA. Proceedings of the National Academy of Sciences of the USA. 92:1679-1683

378

Microbes: In Action

Lu R, Folimonov A, Shintaku M, Li WX, Falk BW, Dawson WO and Ding SW (2004). Three distinct suppressors of RNA silencing encoded by a 20-Kb viral RNA genome. Proceedings of the National Academy of Sciences of the USA. 101:15742-15747 MacFarlane SA and Popovich AH (2000). Efficient expression of foreign proteins in roots from tobravirus vectors. Virology. 267:29-35 Mallory AC, Parks G, Endres MW, Baulcombe D and Bowman LH (2002). The amplicon-plus system for high-level expression of transgenes in plants. Nature Biotechnology. 20:622-625 Manczinger L, Antal Z and Kredics L (2002). Ecophysiology and breeding of mycoparasitic Trichoderma strains: A review. Acta Microbiologica et Immunologica Hungarica. 49:1-14 Mandal AK, Kashyap PL, Gurjar MS, Sanghera GS, Kumar S and Dubey SC (2013). Recent biotechnological achievements in plant disease management. In: Current Concepts in Crop Protection (Ed. Susanta B). Studium Press India Pvt Ltd. pp. 101-129 Mann SK, Kashyap PL, Sanghera GS, Singh G and Singh S (2008). RNA Interference: An ecofriendly tool for plant disease management. Transgen. Plant J. 2(2):110-126 Martinez J (2002). Single-stranded antisense siRNAs guide target RNA cleavage in RNAi. Cell. 110:563-574 Mascia T, Nigro F, Abdallah A, Ferrara M, Stradis AD, Faedda R, Palukaitis P and Gallitelli D (2014). Gene silencing and gene expression in phytopathogenic fungi using a plant virus vector. Proceedings of the National Academy of Sciences of the USA. 111(11):4291-4296 Merai Z, Kerenyi Z, Molnar A, Barta E, Valcozi A, Bistray G, Havelda Z, Burgyan J and Silhavy D (2005). Aureusvirus P14 is an efficient RNA silencing suppressor that binds double stranded RNAs without size specificity. Journal of Virology. 79:7217-7226 Misquitta L and Paterson BM (1999). Targeted disruption of gene function in Drosophila by RNA interference (RNA-i): a role for nautilus in embryonic somatic muscle formation. Proceedings of the National Academy of Sciences of the USA. 96: 1451-1456 Mlotshwas S, Voinnet O, Mette MF, Matzke M, Vaucheret H, Ding SW, Pruss G and Vance GB (2002). RNA silencing and its mobile silencing signal. Plant Cell. 14:289-301 Nakashima N and Kentaro M (2014). Bacterial Cellular Engineering by Genome Editing and Gene Silencing. Int J Mol Sci. 15(2): 2773-2793 Nakayashiki H and Nguyen QB (2008). RNA interference: roles in fungal biology. Current Opinion in Microbiology. 11:1-9 Naylor M, Reeves J, Cooper JI, Edwards ML and Wang H (2005). Construction and properties of a gene silencing vector based on poplar mosaic virus (Genus Carlavirus). Journal of Virology Methods. 124:27-36 Nolan T, Cecere G, Mancone C, Alonzi T, Tripodi M, Catalanotto C and Cogoni C (2008). The RNA-dependent RNA polymerase essential for post-transcriptional gene silencing in Neurospora crassa interacts with replication protein A. Nucleic Acids Research. 36:532-538 Numata K, Ohtani M, Yoshizumi T, Demura T and Kodama Y (2014). Local gene silencing in plants via synthetic dsRNA and carrier peptide. Plant Biotechnology Journal. 12:1027-1034 Nunes CC, Gowda M, Sailsbery J, Xue M, Chen F, Brown DE, Oh YY, Mitchell TK and Dean RA (2011). Diverse and tissue-enriched small RNAs in the plant pathogenic fungus Magnaporthe oryzae. BMC Genomics. 12:288 Nuria S, Carmen F, Sinda C, Carmelo L, Pedro M, Luis N, Ricardo F and Leandro P (2011). RNAi mediated protection against citrus Tristeza virus in transgenic citrus plants. Non coding RNAs in Plants. 8:447-460 Peele C, Jordan CV, Muangsan N, Turnage M, Egelkrout E, Eagle P, Hanley-Bowdoin L and Robertson D (2001). Silencing of a meristematic gene using geminivirus- derived vectors. Plant Journal. 27:357-366 Pickford AS and Cogoni C (2003). RNA-mediated gene silencing. Cellular and Molecular Life Science. 60: 871-882 Pogue GP, Lindbo JA, Garger SJ and Fitzmaurice WP (2002). Making an ally from an enemy: plant virology and the new agriculture. Annual Review of Phytopathology. 40:45-74 Praveen G, Deepmala G, Monika M, Vinay Kumar, Jyoti B and Sudesh KY (2012). Micronics and their role in plants during abiotic stresses. Environmental adaptations and stress tolerance of plants in the era of climate change. 12:265-278

RNA Interference and its Application

379

Raponi M and Arndt GM (2003). Double-stranded RNA-mediated gene silencing in fission yeast. Nucleic Acids Research. 31: 4481-4489 Ratcliff F, Martin-Hernandez AM and Baulcombe DC (2001). Tobacco rattle virus as a vector for analysis of gene functions by silencing. Plant Journal. 25:237-245 Ruiz FV and Voinnet O (2007). Roles of plant small RNAs in biotic stress responses. Annual Review of Plant Biology. 60: 485-510 Ruiz MT, Voinnet O and Baulcombe DC (1998). Initiation and maintenance of virus-induced gene silencing. Plant Cell. 10:937-946 Sanghera GS, Kashyap PL, Singh G and Teixeira da Silva JA (2011). Transgenics: fast track to plant stress amelioration. Transgen. The Plant Journal. 5(1):1-26 Sanghera GS, Kashyap PL, Singh G and Teixeira da Silva JA (2011). Transgenics: fast track to plant stress amelioration. Transgen. Plant J. 5(1):1-26 Schramke V and Allshire R (2003). Hairpin RNAs and retrotransposon LTRs effect RNAi and chromatin-based gene silencing. Science. 301:1069-1074 Scofield SR, Huang L, Brandt AS and Gill BS (2005). Development of a virus-induced gene silencing system for hexaploid wheat and its use in functional analysis of the Lr21mediated leaf rust resistance pathway. Plant Physiology. 138: 2165-2173 Senthilkumar M and Mysore KS (2011). Virus-induced gene silencing can persist for more than two years and also be transmitted to progeny seedlings in Nicotiana benthamiana and tomato. Plant Biotechnology Journal. 9:797-806 Senthil-Kumar M, Hema R, Suryachandra TR, Ramegowda HV, Gopalakrishna R, Rama N, Udayakumar M and Mysore KS (2010). Functionalcharacterization of three water deficit stress-induced genes in tobacco and Arabidopsis: An approach based on gene down regulation. Plant Physiology and Biochemistry. 48:35-44 Shang Y, Schwinn K, Bennett M, Hunter D, Waugh T, Pathirana N, Brummell D, Jameson P and Davies K (2007). Methods for transient assay of gene function infloral tissues. Plant Methods. 3:1 Tang G, Reinhart BJ, Bartel D and Zamore PD (2003). A biochemical framework for RNA silencing in plants. Genes and Development. 17:49-63 Tang W, Weidner DA, Hu BY, Newton RJ and Hu XH (2006). Efficient delivery of small interfering RNA to plant cells by a nanosecond pulsed laser-induced stress wave for posttranscriptional gene silencing. Plant Science. 171:375-381 Tenllado F, Llave C and Diaz-Ruiz JR (2004). RNA interference as a new biotechnological tool for the control of virus diseases in plants. Virus Research. 102:85-96 Timmermans M, Das O and Messing J (1994). Geminivirus and their uses as extrachromosomeal replicons. Annual Review on Plant Physiology. 45:79-112 Tomer MS, Carmit Z, Yitzhak H and Oded Y (2011). RNAi as a potential tool for biotechnological applications in fungi. Applied Microbiology and Biotechnology. 89:501512 Urwin PE, Lilley CJ and Atkinson HJ (2002). Ingestion of double-stranded rna by pre-parasitic juvenile cyst nematodes leads to RNA interference. Molecular Plant-Microbe Interactions. 15:747-752 Vance V and Vaucheret H (2001). RNA silencing in plants-defense and counter defense. Science. 292:2277-2280 Volpe TA, Kidner C, Hall IM, Teng G, Grewal SIS and Martienssen RA (2002). Regulation of heterochromatic silencing and histone H3 lysine-9 methylation by RNAi. Science. 297:1833-37 Wani SH and Sanghera GS (2010). Genetic engineering for viral disease management in plants. Notulae Scientia Biologicae. 2:20-28 Wani SH, Sanghera GS and Singh NB (2010). Biotechnology and plant disease control- Role of RNA interference. American Journal of Plant Sciences. 1:55-68 Warthmann N, Chen H, Ossowski S, Weigel, D and Herve P (2008). Highlyspecific gene silencing by artificial miRNAs in rice. PLoS ONE 3:e1829 Waterhouse P, Graham M and Wang M (1998). Virus resistance and gene silencing in plants can be induced by simultaneous expression of sense and antisense RNA. Proceedings of the National Academy of Sciences of the USA. 95: 13959-13964

380

Microbes: In Action

Waterhouse PM, Wang MB and Lough T (2001). Gene silencing as an adaptive defense against viruses. Nature. 411: 834-842 Wesley SV, Helliwell CA, Smith NA, Wang MB, Rouse DT, Liu Q, Gooding PS, Singh SP, Abbott D, Stoutjesdijk PA, Robinson SP, Gleave AP, Green AG, and Waterhouse P (2001). Construct design for efficient, effective and high-throughput gene silencing in plants. The Plant Journal. 27: 581-590 Younis A, Siddique MI, Kim C and Lim K (2014). RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding. International Journal of Biological Sciences. 10(10): 1150-1158 Yunkun D, Qiuying Y, Zhihong X and Liu Y (2011). RNA interference in fungi: pathways, functions and applications. Eukaryote Cell. 10:1148-1155 Zhang C and Ghabrial SA (2006). Development of bean pod mottle virus based vectors for stable protein expression and sequence-specific virus-induced gene silencing in soybean. Virology. 344:401-411 Zhang C, Yang C, Whitham SA and Hill JH (2009). Development and use of an efficient DNA based viral gene silencing vector for soybean. Molecular Plant Microbe Interaction. 22:123131

CHAPTER 24 Association and Impact of AM Fungi on some Economic Important Medicinal Plants of Rajasthan K K Srivastava, Divya Keswani, Sangeeta Singh , Neelam Verma, K C Jedia and Lokendra Singh Forest Protection Division, Arid Forest Research Institute-Jodhpur -342001 India Corresponding author: [emailprotected]

INTRODUCTION Rajasthan is a rich state in tribal population and it has about 9 percent of the tribal population of India. There are large number of medicinal plants naturally growing in Rajasthan. The herbaceous flora of the general surface of the hills is rich during rains and is composed mainly of small herbs. Some of the prostrate herbs growing during this period are Triumfetta rhomboidea, Boerhavia diffusa, Lepidagathis trinervis, Cassia pumila, Indigofera cordifolia, Tephrosia pauciflora, T. strigosa etc. Some of the erect form are Crotalaria triquetra, Cassia absus, Bidens biternata, Solanum indicum, Dicoma tomentosa, Achyranthesaspera, Acalypha ciliataetc. Majority of hills in Jaipur are almost barren. However, Hills in the Amber region have Anoegissus pendula, Boswellia serrata and Sterculia urens along with Butea monosperma. The World Health Organization (WHO) estimates that 80 percent of the population of some Asian and African countries presently use herbal medicine for some aspect of primary health care. Studies in the United States and Europe have shown that their use is less common in clinical settings, but has become increasingly more in recent years as scientific evidence about the effectiveness of herbal medicine has become more widely available. Medicinal plants have natural healing power. They are nature's chemical industry for the production of vital medicinal compounds. Growth improvement and quality improvement of medicinal plants is very necessary because it is used for treatment of many diseases. To avoid the residual toxicity in the raw drugs, it is always advisable to raise the medicinal plants through organic cultivation practices. The cultivation of medicinal and herbal plants has assumed greater importance in recent years due to their tremendous potential in modern and traditional medicine. They are also used as raw materials for pharmaceuticals, cosmetic and fragrance industries. Indian system of medicine (ISM) uses 25,000 species belonging to more than 1000 genera. About 25% species are used by industries. Inoculation of AM fungi during an early stage of acclimatization process has

382

Microbes: In Action

become an alternative strategy for better establishment by improving the plant growth. The AM fungi association has not only enhanced the growth of medicinal plants but also improve the productivity of medicinal compounds. Hence, there is a need for research in improving the quality and quantity of drugs produced from native medicinal plants in relatively shorter period and at lower expense by using AM fungi. The proposed project is based on study of AM association and their impact on enhancing growth and vigour of economically important medicinal plants viz., Datura stramonium, Euphorbia hirita, Ocimum sanctum and Asparagus racemosus of Rajasthan. ISOLATION OF AM FUNGAL SPORES FROM SOILS The soil samples were collected from 10-15 cm depth near the plant (rhizosphere soil) after removing the top 1 to 2 cm soil. 100 g of soil was mixed with 2000 ml of water and stirred properly. For isolation of AM fungal spores from the soil wet sieving and decanting technique of Gerdemann and Nicolson (1963) was used. The soil suspension kept for 1.1 to 1.5 h to settle soil particles at the bottom. The soil then was passed through a series of sieves of various microns was decanted the suspension through 850 μm sieve and the roots and organic matter on sieve were washed with fine jet of water and separated. Filtrate was sieved through 105 μm mesh sieve. The 105 μm sieve yielded maximum spores as their size lied between 110 to 200 μm and spores smaller than 100 μm which often occurred in clusters, were trapped on 105μm sieve. The suspended materials was subsequently, sieved through 53 μm mesh sieve. Small detached spores were picked up from sieves of 53 μm. Each sieve was thoroughly washed with fine jet of water to remove soil particles. The residue was then collected in whatman no. 2 filter paper in funnels. Filter paper spreaded over the petridishes and examined under stereo zoom microscope (Leica kombistereo). Semi-permanent slides were prepared by mounting the spores in lactophenol and polyvinyl lactophenol. The photographs were taken by Nikon optiphot-2-compound microscope. The AM spores obtained through the above technique were identified on the basis of colour, size, shape, surface nature of spore cell and hyphal attachment with the help of synoptic keys of the Schenck and Perez (1987) and Raman and Mohankumar (1988). ROOT COLONIZATION Root samples collected along with rhizosphere soils was separated and suitably processed to investigate the mode of infection of AM, development of vesicles, arbuscules spores and mycorrhizae. Standard staining method given by Phillips and Hayman (1970) was followed. The root samples were washed thoroughly and placed in glass vial. The roots were cut into 1-2 cm pieces and immersed in 10 per cent Potassium hydroxide solution at 90°c for 15-30 minutes (depending upon hardness of the tissues). The KOH solution clears host cytoplasm and nuclei, and readily allows stain penetration. The KOH solution was drained and the samples were washed with distilled water till brown colour disappeared. After thorough washing, the sample was added to the alkaline H2O2 (30 per cent) solution and treated for 2-3 minutes or till the roots were bleached. The

Association and Impact of AM Fungi

383

samples were again rinsed with distilled water to remove H2O2. After thorough washing, roots were immersed in 2 per cent HCl and again rinsed with distilled water to remove HCl. These samples were stained in 0.2 per cent trypan blue for rapid assay of endomycorrhizal association. Root pieces were selected randomly and finally pressed in lactophenol. Semi-permanent slides were prepared. The AM fungul infection was examined by using Optiphot-2 "Nikon" compound microscope. Percentage of root colonization was assessed by the following formula (Giovannetti and Mosse, 1980). Percentage of root infection = No. of root segments infected  Total no. of root segment examined ×100 CULTURING AND INOCULUMS PRODUCTION The indigenous mycorrhizal endophytes which were collected from the rhizosphere soil of datura, euphorbia, tulsi and shatawari were used for preparing starter culture. The composition of native consortium/mixed inoculums was Glomus (70%), Gigaspora (14%), Sclerocystis (6%), Scutellospora (5%) and Acaulospora (5%). The spores collected by sieves were examined under stereo zoom microscope. About 500 spores were surface sterilized with Chloramine-T (0.2%) and 200 ppm streptomycin for 15 minutes and washed in sterile distilled water 3 to 4 times. The starter culture was prepared by soil funnel technique (Nicolson, 1967). The funnel was filled with ¾ th autoclaved soil and sand (1:1) and the end of the funnel was plugged with glass wool. In some cases, autoclaved vermiculite was also used. The funnel was kept over conical flask filled with sterilized water to touch the end of the funnel. Spores suspension was spread over and covered with thin layer of soil. The seeds of Cenchrus ciliaris were sown and covered with soil. In some cases, Pearl millet (Pennisetum glaucum) seeds were also used for spore multiplication. After 20-25 days of inoculation, roots were examined for AM Fungal infection. Inoculum thus prepared through the funnel technique was transferred into small plastic pots (soil was mixed with root pieces) filled with sterilized and soil in ratio of 1:2. The seeds of Cenchrus ciliaris were sown. The indigenous inoculums were generated in AFRI model nursery, Jodhpur. These pots were kept in the green house and watered in alternate days. Similar procedure was adopted for transferring the inoculums to bigger pots. After 2-3 months, inocula were ready for further experimentation. The inoculums were preserved in refrigerator at 4°C in air tight polybags/containers with 30-40 % humidity for further experimental use. AM INOCULATION EXPERIMENTS The experiments were laid out on two months old root trainer raised seedlings of datura, euphorbia, tulsi and shatawari. The number of plants per replication was taken 10 per root trainer. The 20gm of inoculums containing 500 viable propagules/100g were given in each plant by side banding method. Untreated plants were kept as control. The initial observation was recorded at the time of lay out the experiment. Observations were recorded on shoot height, collar diameter and number of branching after 15 days of lay out the experiment.

384

Microbes: In Action

Initial and final observations were recorded and compared. 1. Datura stramonium AM Fungi Associated with Datura stramonium Rhizosphere soil samples collected from naturally grown datura plants from in and around Jodhpur and processed as mentioned in material and methods. The important genera viz., Glomus, Gigaspora, Aculospora, Sclerocystis and Scutellospora. Glomus was found dominant genera and G. fasiculatum as dominant species. Amongs the species Glomus fasciculatum, G. macrocarpum, G. microcarpum, G. mossea and G. aggregatum were found ln all the sites studied. Distribution of AM Fungi in D. stramonium The distribution of AM fungi was determined in 100 g rhizosphere soils of datura plants in three replications. The spores were isolated and identified as described above.(Materials and Methods). It was observed that Glomus was dominant genera at all the natural growing areas of datura. The pattern of distribution recorded as Glomus > Acaulospora > Scelrocystis > Scutellospora > Gigospora. The dominant genera recorded as Glomus (76 per cent), Acaulospora (8 per cent), Sclerocystis (6 per cent), Scutellospora (8 per cent) and Gigospora (2per cent). Spore Population The spore population was studied in 100g rhizosphere soil samples by following procedure of the Gerdemann and Nicolson (1983). The soil samples were replicated three times by adopting gridline intersect method. The spore counting and spore isolation was performed using Leica combi stereo microscope. The spore identification was performed using Nikon Stero zoom microscope. The spore population varied from species to species. The spore population in Datura stramonium was found to be 127 spores/100g, of rhizosphere soil. Root Infection All the root samples collected from naturally and from nursery D. stramonium were processed and stained in trypane blue-lactophenol stain, root infection showed typical vesicular, arbuscular and hyphal infections. Hyphae were broader and inter as well as intracellular. Vesicles were globose to sub- globose and were abundant in the root sample. The arbuscles were finger like structures which works as haustoria like which absorb nutrients from the host. 2. Euphorbia hirta AM Fungi associated with Euphorbia hirta In case of Euphorbia hirta, the AM fungi were isolated and identified by adopting similar procedure as mentioned above. The important genera, Glomus, Acaulospora, Gigaspora and Scutellospora and Sclerocystis were isolated and identified. Among the species Glomus fasciculatum, G. aggregatum and G, macrocarpum were identified. Glomus was found dominant genera and G. fasciculatum as dominant species in all the samples studied.

Association and Impact of AM Fungi

385

Distribution of AM Fungi in Euphobia hirta The distribution of AM fungi was determined in 100 g rhizosphere soils of Euphorbia plants in three replications by adopting similar procedure. The distribution distribution of various AMF genera were recorded as Glomus>Acaulospora>Gigaspora>Scutellospora> Sclerocystis. The dominant genera Glomus (70%), Acaulospora (17%), Gigaspora (6%) Scutellospora (5%) and Sclerocystis (2%). Spore Population The spore population was studied in 100g rhizosphere soil samples by following procedure of the Gerdemann and Nicolson (1983). The spore counting and spore isolation was performed using Leica combi stereo microscope. The spore identification was performed using Nikon Stero zoom microscope. The spore population varied from species to species. The spore population in Euphorbia hirta was found to be 159 spores/100g, of rhizosphere soil. Root Infection All the root samples from seedling of Euphorbia hirta were collected, processed and stained in trypane blue- lactophenol stain root infection showed typical vesicular, arbuscular or both and hyphalstructures. Hyphae were broader and inter as well as intracellular. In later stage they formed vesicles and arbuscular structures in cortical region of root. Vesicles were globose to sub- globose and were abundant in the root sample. The arbuscles were finger like structures which works as haustoria like which absorb nutrients from the host. 3. Ocimum sanctum AM Fungi Associated with Ocimum sanctum A total no. of four genera namely, Glomus, Scuttelospora, Acaulospora and Sclerosystis and ten (10) species viz., Glomus aggregatum, G. mosseae, G. fasciculatum, G. macrocarpum, G. microcarpum, G. constrictum, Glomus sp., Sclerosystis indica, Scutellospora bionarta and Acaulospora biculata were isolated and identified the Glomus was found most dominant genera and among species. Glomus fasciculatum and G. aggregatum were found most dominant species in all the samples studied. Disribution of AM Fungi in Ocimum sanctum In Ocimum sanctum, the distribution of various AMF genera observed that Glomus was dominant genera at all the samples studied. The pattern of distribution recorded as Glomus > Acaulospora > Scelrocystis > Scutellospora. The dominant genera recorded as Glomus (65%), Acaulospora (20 %), Sclerocystis (7%), Scutellospora (8 %). Spore Population The spore population was studied in 100g rhizosphere soil samples by following procedure of the Gerdemann and Nicolson (1983). The spore counting and spore isolation was performed using Leica combi stereo microscope. The spore

386

Microbes: In Action

identification was performed using Nikon Stero zoom microscope. The spore population varied from species to species. The spore population was higher in Ocimum sanctum as compared to other three species that have been studied. The spore population in Ocimum sanctum was found to be 300spores / 100g, of rhizosphere soil. Root Infection The roots of Tulsi were proccesed by method given by Phillips and Hayman and stained using tryphan blue- lactophenol stain. The roots were found to be infected with vesicles, arbuscles and hyphae. The hyphae penetrated the roots and formed branches called trunk which penetrated a few cells by stretching the host cell wall. The tip of the trunk showed repeated dichotomous branching to form arbuscles which covers more than half of the root cell these arbuscles have storage function. The hyphae tip penetrated the root and swelled to form vesicles which were abundant as compared to arbuscles. The vesicles are thin or thick walled, globose to sub- globose and inter as well as intracellular. The hyphal infection was found to be 100%, the vesicular infection was found to be 70% and the arbuscular infection was only 20%. 4. Asparagus racemosus AM Fungi Associated with Asparagus racemosus In Asparagus, the major AMF genera namely, Glomus, Gigaspora, Sclerocystis and Acaulospora were isolated and identified. Amongs the species, Glomus mosseae, Glomus fasciculatum, Glomus macrocarpum, Glomus aggregatum, Gigaspora gigantea, Gigaspora margarita, Sclerocystis sinuosa and Acaulospora scrobiculata were observed. The Glomus was found dominant genera and G. aggregatum was found dominant species. Distribution of AM Fungi in Asparagus racemosus In Asparagus racemosus, the distribution of various AMF genera observed that Glomus was dominant genera at all the samples studied. The pattern of distribution recorded as Glomus > Gigaspora > Acaulospora > Scelrocystis. The dominant genera recorded as Glomus (65 per cent), Acaulospora (15 per cent), Gigaspora (15%) Sclerocystis (5%). Spore Population The spore population was studied in 100g rhizosphere soil samples by following procedure of the Gerdemann and Nicolson (1983). The spore counting and spore isolation was performed using Leica combi stereo microscope. The spore identification was performed using Nikon Stero zoom microscope. The spore population varied from species to species. The spore population in Asparagus was found to be spores137/100g, of rhizosphere soil. Root Infection The roots of A. racemosus were stained using tryphan blue-lactophenol stain. The roots were infected with vesicles, arbuscles or both and hyphae. The vesicles developed terminally on the hyphae inter as well as intracellularly. Intercalary

Association and Impact of AM Fungi

387

vesicles i.e. vesicles in groups were also observed. They were thin as well as thick walled globose to sub- globose. The inter as well intracellular hyphae were present and. The arbuscles that are finger like structures which works as haustoria like and absorb nutrients from the plant were also observed. The root infection and spore population in various species were found as follows: Root Infection in Various Species Species

Hyphae

Vesicles

Arbuscles

D. stramonium E. hirta O. sanctum A. racemosus

75% 90% 100% 91.6%

58.3% 70% 70% 58.3%

16.6% 30% 20% 25%

FIG.: Comparative Analysis of Root Infection

Spore Population in various Species Species Spore count/100g of soil

D. stramonium

E. hirta

O. sanctum

A. racemosus

127

159

300

137

388

Microbes: In Action

Comparative Analysis of Spore Population

Effect of AM Fungi on Datura, Euphorbia, Tulsi and Shatawari The experiments were laid out to see the effect of AM inoculation on growth and vigour of seedlings of Datura, Euphorbia, Tulsi and Shatawari in root trainer raised seedlings. The months old seedlings were selected for the study. Root trainer containers having 10 seedlings of each plant out of which 5 were kept as control (un-inoculated). The rhizosphere soil containing pot culture containing AMF propagules was applied in root trainer raised seedlings by side banding method. The root trainer was kept in shade house and watering was done whenever required. The observations were taken on shoot height, collar diameter and number of branching at 15 days interval. Impact of AM Inoculums on D. stramonium Effect of AM Fungi on Shoot Height, Number of Branches and Collar Diameter of D. stramonium It is evident from the tables given below that all the inoculated seedlings of Datura performed better then the un-inoculated seedlings even after 15 days of inoculation. The intial mean of shoot height of un-inoculated seedlings was 46.8 and the final mean was 52.1 where as in inoculated seedlings the initial mean of shoot height was 42.2 and the final mean was 48.7. So, it was found that the mean difference between the initial and final readings was higher in inoculated seedlings. The increase% difference was found to be 23.07%. Similarly there was an increase % difference in number of branches and collar diameter also. Mean difference in number of branches in uninoculated seedling was found to be 1 and between inoculated seedling was found to be 5. So increase % difference was found to be 80%. The mean difference in collar diameter in un-inoculated seedlings was found to be 0.9 cm and the mean

Association and Impact of AM Fungi

389

difference in Inoculated seedlings was found to be 1.6 cm. So, increase % difference was found to be 43.75%. Impact of AM Inoculums on E. hirta Effect of AM Fungi on Shoot Height, Number of Branches and Collar Diameter of E. hirta It is evident from the tables given below that all the inoculated seedlings of Euphorbia performed better then the un-inoculated seedlings even after 15 days of inoculation. It was found that the mean difference between the initial and final readings in inoculated seedlings was higher than un-inoculated seedlings. The mean difference in shoot height between un-inoculated seedlings before and after 15 days was found to be 2.2cm and between inoculated seedlings was found to be 2.6cm. The increase% difference was found to be 15.38%. Similarly there was an increase (%) difference in number of branches and collar diameter also. Mean difference in number of branches between uninoculated seedlings was found to be 1 and between inoculated seedling was found to be 5. So, increase percent difference was found to be 80 percent. The mean difference in collar diameter between un-inoculated seedlings was found to be 1.1cm and the mean difference in Inoculated seedlings was found to be 1.5cm. So, increase percent difference was found to be 26.66 percent. Impact of AM Inoculums on O. sanctum Effect of AM Fungi on Shoot Height, Number of Branches and Collar Diameter of O. sanctum It is concluded from the tables given below that all the inoculated seedlings of tulsi showed an enhanced growth as compared to un-inoculated seedlings even after 15 days of inoculation. It was found that the mean difference between the initial and final readings of shoot height in inoculated seedlings was higher then un-inoculated seedlings. The mean difference in un-inoculated seedlings was 2.7cm and in inoculated seedlings was 8.7cm. The increase (%) difference was found to be 68.96 percent. There was also an increase (%) difference in number of branches and collar diameter. Mean difference in number of branches in un-inoculated seedlings was found to be 1 and in inoculated seedling was found to be 2. So, increase (%) difference was found to be 50 per cent. The mean difference in collar diameter in uninoculated seedlings was found to be 1.3cm and the mean difference in Inoculated seedlings was found to be 2.2cm. So, increase (%) difference was found to be 40.90% Impact of AM Inoculums on A. racemosus Effect of AM Fungi on Shoot Height, Number of Branches and Collar Diameter of A. racemosus It is observed from the tables given below that after 15 days of treatment all the inoculated seedlings of Shatawari were superior to un-inoculated seedlings. The intial mean of shoot height of uninoculated seedlings was 91.6 and the final mean was 93.3 where as in inoculated seedlings the initial mean of shoot height

390

Microbes: In Action

was 85 and the final mean was 92.7 and the mean difference between the initial and final readings was higher in inoculated seedlings. The increase (%) difference was found to be 77.9 percent. Similarly there was an increase % difference in number of shoots arising from single root. The mean difference in number of shoots in un-inoculated seedlings was 1 and in inoculated seedlings it was 3. So, it was concluded that the shoot height and number of shoots both increased vigorously in inoculated seedlings as compared to un-inoculated seedlings. Percentage (%) Increase in Shoot Height of D. stramonium, E. hirta, O. sanctum and A. racemosus D. stramonium

Uninoculated Inoculated

Mean of initial reading

Mean of final reading

Mean difference

Increase (%) difference

46.8 42.2

52.1 48.7

5 6.5

23.07

40.8 27.5

43 30.1

2.2 2.6

15.38

38.2 38.7

40.9 47.4

2.7 8.7

68.96

91.6 85

93.3 92.7

1.7 7.7

77.9

E. hirta Uninoculated Inoculated O. sanctum Uninoculated Inoculated A. racemosus Uninoculated Inoculated

Comparative Analysis of Mean Difference of Shoot Height in given Species

Association and Impact of AM Fungi

391

Percentage (%) Increase in Number of Branches of D. stramonium, E. hirta, O. sanctum and Number of Shoots of A. racemosus D. stramonium

Uninoculated Inoculated

Mean of initial reading

Mean of final reading

Mean difference

Increase (%) difference

5 0

6 5

1 5

80%

30 22

31 27

1 5

6 6

7 8

1 2

16 13

17 16

1 3

66.6

E. hirta Uninoculated Inoculated O. sanctum Uninoculated Inoculated A. racemosus Uninoculated Inoculated

Percentage (%) Increase in Collar Diameter of D. stramonium, E. hirta, O. sanctum D. stramonium Mean of initial reading

Mean of final reading

Mean difference

Increase (%) difference

8.2 8.7

9.1 10.3

0.9 1.6

43.75

Uninoculated Inoculated O. sanctum

4.1 3

5.2 4.5

1.1 1.5

26.66

Uninoculated Inoculated

3.4 4.8

4.7 7

1.3 2.2

40.90

Uninoculated Inoculated E. hirta

392

Microbes: In Action

In the present study clearly showed that all the four medicinal plants viz., D. Stramonium, E. hirta, O. sanctum and A. racemosus selected for the study are highly mycorrhizal in nature. literature also resembles the finding of the various researchers from India. Ratti and Janardhanan (1995) studied the VA mycorrhizal association in some alkaloid bearing plants. They collected the roots with the rhizosphere soils of Datura metel, D. Innoxia, Duboisiamyoporoides, Rauvolfia serpentine, R. Tetraphylla and Catharanthusroseus growing at CIMAP, Lucknow. All the plants were found to be mycorrhizal. The range of infection was between 22.6 (in R. Tetraphylla) to 72.4 (in D. Innoxia). The VAM fungi present in the rhizosphere were identified as Glomus aggregatum, G. fasiculatum, G. geosporum, G. mosseae and one unidentified species of Glomus. Srivastava and Basu (1995) studied the occurrence of vesicular – arbuscular rmycorrhizal fungi in samples of medicinal plants collected from Azamgarh, U.P. Twenty medicinal plants belonging to 14 families were screened. Most of the plants were mycorrhizal but few eg:- Cassia obutsifolia, Asphodelus tenuifalius and Scoparia dulicis were non-mycorrhizal. Homkar et. al. (1998) investigate the development of Vesicular arbuscular mycorrhizas on 30 species of herbaceous and woody medicinal plants growing in the gene bank at the State forest research institute at Jabalpur, MP (India) and the plants categorized in to 4 groups based on their root infection (high, 9 species; moderate, 5 species; low, 13 species; and zero, 3 species) Gupta et al. (2000) studied the VAM fungi associated with Ocimum species (O. basilicum, O. canum [O. americanum], O. gratissinum, O. sanctum (O. tenuiflorum) and O. kilimand- scharicum. Vesicular arbuscular mycorrhizal (VAM) fungi, Glomus aggregatum, Glomus fasiculatum, Glomus geosporum, Glomus mosseae, Gigaspora spp., Sclerocystissinuosa and Acaulosporaspp, were identified and quantified. Glomus aggregatum and Glomus fasiculatum were predominant and associated with all the Ocimum species. Root colonization studies revealed the highest colonization (62.8%) in O. basilicum and the lowest colonization (35.2%) in O. gratissinum.

Association and Impact of AM Fungi

PLATE I : Materials and Method

393

394

PLATE II: Root infection and spores studied in D. stramonium

Microbes: In Action

Association and Impact of AM Fungi

PLATE III:- Root infection and spores studied in E. hirta

395

396

PLATE IV: Root infection and spores studied in O. sanctum

Microbes: In Action

Association and Impact of AM Fungi

PLATE V : Root infection and spores studied in A. racemosus

397

398

Microbes: In Action

Gaur and Kaushik (2011) studied VAM associated with medicnal plants i.e Catharanthus roseus, Ocimum species and Asparagus racemosus from Haridwar, Uttarakand. VAM fungal spores were found in higher abundance from sandy loam soil. The percentage of root colonization levels ranged from 58.22% to 65.43% for Catharanthus roseus, from 76.88% to 95% for Ocimum spp. and from 57.21% to 63.32% for Asparagus racemosus. Thenmozhi et al. (2011) studied VAM on some medicinal plants. VAM spores observed in soil sample includes Glomus and Gigaspora. A maximum spores count of 80 spores/25 gm soil in Bacopa monneiri and a lowest of 15 spores/25 gm soil in Indigofera tinctora. Bhale (2013) studied VAM fungi colonization on some medicinal plants from Marathwada region of Maharathra. The maximum percentage in root colonization was found in Eucalyptus globulous (96%) and minimum in Glossocardia bosvallea (8%). Hundred grams of soil showed 349 spores in Hygrophila schulli was maximum i.e. minimum in Commiphora whitti (30). REFERENCES Gaur S and Kaushik P (2011). Analysis of Vesicular Arbuscular Mycorrhizae associated with medicial plants in Uttarakhand state of India. World Applied Science Journal. 14(4): 645653 Gerdemann JW and Nicolson TH (1963). Spores of mycorrhizal Endogene species extracted from soil by wet sieving and Decanting. Trans. Brit. Myco. Soc. 46: 235-246 Giovannetti M and Mosse B (1980). An evaluation of techniques for measuring vesiculararbuscular mycorrhizal in roots. NewPhytol. 84:489-500 Homkar et. al. (1998) www.scholarsresearchlaibreary.com Nicolson TH (1967) Vesicular arbuscularmycorrhiza-Universal plant symbiosis. Sci. Prog. 55: 561-581 Phillips JM and Hayman DS (1970). Improved procedures for clearing roots and statining parasitic and vesicular arbuscular mycorrhizal fungi for rapid assessment of infection. Brit. Mycol. Soc. Trans. 5(1) 158-161 Raman M and Mohankumar V (1988). Techniques in mycorrhizal research. Centre for Advanced Study in Botany, Univ. of Madras, Madras. Dept. Sci. Technology, Govt. of India Ratti N and Janardhanan KK (1995). Vesicular Arbuscular Mycorrhizae association in some alkaloid bearing plants. In: Mycorrhizae: Biofertlizer for the future (Eds. Alok Adolya and Sujan Singh) TERI, New Delhi: 407-409 Schenck NC and Perez Y (1987). Mannual for identification of VA-mycorrhizal fungi. Univ. of Florida Gainesville. Florida, USA. Srivastava NK and Basu M (1995). Occurrence of vesicular mycorrhizal fungi in some medicinal plants, In a mycorrhizae Biofertilizer for future. (Eds. Alok adolya and Sujan Singh) TERI, New Delhi, pp. 328-330 Bhale UN (2013). Occurrence of Vesicular Arbuscular Mycorrizaes (VAM) in medicinal plants of Marathwada region of Maharahtra, India. Journal of Chemical, Biological and Physical sciences. 3 (3) 1912-1919 www.scholarsresearchlaibreary.com.

CHAPTER 25 Medicinal Flora of the Thar Desert of Rajasthan: Therapeutic and Antimicrobial Importances P D Charan1 and K C Sharma2 1

Department of Environmental Science, Maharaja Ganga Singh University, Bikaner-334004 India 2 Department of Environmental Science, Central University of Rajasthan, Bandarsindari, Ajmer India Corresponding author: [emailprotected]

INTRODUCTION The Thar desert is the most thickly populated desert in the world with an average density of 83 persons/km2, while, the average population density is only 7 persons/km2 in other deserts of the world (Baqri and Kankane 2001). The Thar Desert is ninth largest subtropical deserts of the world. It extends from the Satluj river on north to the Great Rann of Kutch on south and the Indus river on the west while, its eastern border is surrounded by the Aravalli Ranges. The total area of the Thar desert is about 2,00,000 km2, spread in western part of Indian subcontinent between 24° to 28° N latitude and 68° to 71° E longitude (Ramawat, 2010). In India, more than 60% of geographical area of the Thar Desert lies in the Rajasthan state (Krishnan, 1977). It extends into the southern portion of Haryana and Punjab and into northern part of Gujarat state. The Thar Desert has a very rich floral diversity including about 628 species, 352 genera and 87 families (Bhandari, 1995). Most of the plants of the arid zone of Rajasthan are very important for their medicinal properties. Conservation of medicinal plants is receiving increased attention in view of revival of interest in herbal medicines for healthcare all around the world (Singh et. al., 2008). One of the important geological features of the Thar desert is the presence of ephemeral rivers including Luni, Sookdi, Ghaghar, Bandi and Jojri river, which plays an important role on micro-climatic conditions of the regions through which they traverses and hence, they affect the vegetation of these regions of the Thar desert (IIRS report. 2011). This desert is mainly occupied by dry grassland or by grassland intermingled with trees and thorny bushes. There is only one national park and five wildlife sanctuaries in Thar desert which comprises about 16076 km2 area (Rodgers et al., 2002). According to report of the task force on grasslands and deserts (2006), the total protected area network in the Thar region is about 7.45% of total geographical area the desert. The higher density of the most of the medicinal plants is found in these protected area networks. Climate and soil: The Thar desert possesses arid climate which is

400

Microbes: In Action

characterized by low and erratic rainfall, extremes of diurnal and annual temperatures, high wind velocity and low humidity. During summer (March to June), the maximum temperature generally varies between 45°C and 50°C, while temperatures in winters (November-February) ranges between 15°–25°C. More than 88% of total annual rainfall (which is less than 25cm) of Thar desert is received during Monsoon season (July to October) (Sikka, 1997). The seasonal climatic changes since last full glacial in the Thar desert has drastically changed the vegetation of the area (Singh et. al., 1990). The soil of the Thar desert is characterized by poor soil fertility with sandy to sandy-loam in texture with very less organic matter and it is characterised by semi-stabilized to frequently sifting sand dunes. The average pH of soil of the desert ranges from 7.6 to 8.5 (Roy et al., 1978). Salinity and sodicity of the soil in some areas of the desert is higher, which is mostly confined to areas with depressions or 'Playa' and it is depending on the degree of saturation and percentage of exchangeable Na+. PHYTO-DIVERSITY AND STRUCTURE OF PLANT COMMUNITY Structure of plant community: The vegetation of the Thar desert is adapted to xerophytic conditions, as water is the most critical factor for their growth (Shetty and Singh, 1987). Such adaptations are very essential to combat with a variety of environmental stresses including low precipitation, high temperature, extreme aridity, low availability of nutrients and high evapo-transpiration rate (Upadhyay et. al., 2007). The eastern part of the desert receives high rainfall (up to 400 mm) in comparison to western part of the Thar (about 100 mm) desert and hence, vegetation cover is comparatively dense in eastern part (Reddy et. al., 2011). Halophytic vegetation: The Thar desert has many depressions or 'Playa', where salinity is very high. Some of the well known salt dominant area of the Thar region of Rajasthan are Kanod, Pokaran, That, Ujalan-dhudsar (Jaisalmer), Pachpadra, Thob (Barmer), Loonkaransar (Bikaner), Chhapar (Churu) Badopal (Hanumangarh), Didwana, Kuchaman (Nagour) and Bap-Malar (Jodhpur) (Fig.1). The salinity of soil is favourable for many halophytes including Tamarix aphylla, Tamarix dioica, Haloxylon salicornicum, Portulaca oleracea, Portulaca meridiana, Suaeda fruticosa, Salsola baryosma (Saxena and Gupta, 1972; Saxena et. al., 1994). Vegetation on sand dunes: The Thar desert of Indian subcontinent is characterised by semi-stable to frequently shifting sand dunes. Dune dominated area occupies about 44% of total area of Thar and average height these sanddunes varies between 70-120m (Dhir, 2003). The vegetation on such dunes is very low. In the period of Monsoon, some flora including Lasiurus sindicus, Cenchrus setigerus, Cenchrus ciliaris, Panicum turgidum, Mollugo cerviana, Gisekia pharnaceoides, Cyperus rotundus, Crotalaria burhia, Calligonum polygonoides, Acacia jacqumontii, Aerva persica, Aerva pseudotomentosa, Aerva javanica can be observed frequently on the sand dunes (Bhandari, 1978; Rao et. al., 1989; Shetty and Singh, 1991).

Medicinal Flora of the Thar Desert of Rajasthan

401

FIG.1: Expansion of Thar Desert in western Rajasthan

Interdunal flora: Interdunal flats of the desert possess comparatively hard and compacted surfaces, thus these flats retains the rainwater for longer time than sand-dunes. The dominant vegetation of such flats are Aristida funiculata, Indigofera cordifolia, fa*gonia cretica, Heliotropium bacciferum, Tribulus terrestris, Octhocloa compressa, Evolvulus alsinoides, Convolvulus deserti, Tephrosia purpurea, Eragrostis minor, Eragrostis ciliaris, Eragrostis pilosa, Arnebia hispidisima, Farsetia hamiltonii, Crotalaria burhia, Aerva javanica, Aerva persica, Aerva pseudotomentosa, Leptedenia pyrotechnica, Pulicaria crispa, Dactyloctenium sindicum, Indigofera linnaei, Cappais decidua, Calotropis procera, Zizyphus nummularia. The dominant tree of the Thar is Prosopis cineraria. However, in some areas of the desert, other tree flora including Salvedora oleoides, Salvedora persica, Zizyphus mauritiana, Tecomella undulata, Balanites aegyptiaca, Acacia senegal, Acacia nilotica, Acacia tortilis etc are in co-existence with Prosopis cineraea (Bhandari, 1978; Shetty and Singh, 1987; 1991). Some climbers including Citrullus colocynthis, Pergularia daemia, Mukia maderaspatana, Cucumis callosus, Cucumis profetarum and Ipomoea eriocarpa can be observed in the Thar desert (IIRS, 2011) Plantation in IGNP command area: The Indira Gandhi Canal Project (IGNP) is a back-bone of the economy of Thar desert, especially for Ganganagar,

402

Microbes: In Action

Hanumangarh, Bikaner and Jaisalmer district of western Rajasthan. Earlier, in the command area of the Canal, roadside areas and both the sides of canal, Eucalyptus camaldulesis was planted, but after some time, it was reported that Eucalyptus camaldulesis exerted severe impact on water table of the region. This plant is, therefore, known as "Ecological Terrorist" (Singh, 2010) and then the plant was avoided for agro-forestry purposes in the region (Tewari et al., 2001; CAD, 1997). Thereafter, in the social forestry and farm forestry, other tree flora including Tecomella undulata, Dalbergia sissoo, Acacia tortilis, Acacia nilotica, Acacia Senegal, Azadirachta indica, Zizyphus mauritiana etc. were introduced in the region (Singh et. al., 2007). In grasses, Lasiurus sindicus is cultivated at large scale in Jaisalmer, Bikaner and Jodhpur district of Rajasthan to ensure fodder for livestock during drought, which is very frequent in the region (Mertia et. al., 2006; Sinha 1996). Use of medicinal flora in Thar desert: Study of the medicinal properties of plants is not new. Ayurveda, the Indian ancient literature, is based on the medicinal properties of vegetation. Similarly, Homeopathy, Unani and Chinese old medicinal therapies are also directly or indirectly based on the medicinal properties of flora (Jain, 1968). The plants inhabiting the Thar desert are adapted to variety of natural extremities including water stress, low precipitation, negligible humidity, frequent drought prone area as well as high temperature, high evapo-transpiration etc. Most of the plants of the desert are having some medicinal properties (Singh and Kumar, 2013; Sher Mohammed et. al., 2004). Recently, many researchers have done remarkable work on medicinal properties and the uses of medicinal flora at national and international level. These plants contains one or more chemically active components, which are therefore, used to treat different kind of ailments (Table-1). TABLE 1: Different medicinal plants of Thar desert, their major chemical constituent and uses Plant species

Useful part of plant

Major Chemical constituent

Medicinal properties and uses

Abutilon indicum

Leaves, seeds

Antibacterial, antioxidant, antidiarrhoeal, anticonvulsant (Golwala et al., 2010), used to treat tuberculosis (Immanuel and Elizabeth, 2009)

Achyranthes aspera

Leaves, seeds, roots

Aerva javanica

Leaves, seeds flowers

Sitosterol, Various Fatty acids including capric acid, caprylic acid, lauric acid, linoleic acid, oleic acid, stearic acid myristic acid, stearic acid (Rajkumar et al., 2009); Caryophylline, amyrin, geraniol, sesquiterpene lactones, geraniol (Pengelly, 2004) Oleanic acid, Ecdysterone (Aeri et. al., 2010), Achyranthine, triterpinoides, saponins, Nmethyl pyrollidine-3-carboxylic acid (Dwivedi et al., 2008) Steroids, Flavanoide, Glycosides (Rajesh et. al., 2010) Apigenin 7-OGlucuronide, Isoquercetrin (Sharif et al., 2011)

Diuretics and useful in dyspepsia, bronchitis, asthma, irritable bowel syndrome, toothache, piles, night-blindness (Immanuel and Elizabeth, 2009) Useful in treatment of bladder and kidney stone (Sharif et al., 2011), Antibacterial, Anthelmintic, Purgative, relieve toothache (Qureshi et al., 2010),

Medicinal Flora of the Thar Desert of Rajasthan

403

Plant species

Useful part of plant

Major Chemical constituent

Medicinal properties and uses

Amaranthus viridis

Roots, whole plant

Flavonoids including Rutin and Quercetin (Kumar et al., 2009)

Anti-inflammatory (Macharla et. al., 2011), Emollient, used in Snake bite/scorpion sting (Jabeen et al., 2009) Antimicrobial, Helpful in anaemia (Darsini et al., 2009), Blood purifier tonic (Immanuel and Elizabeth, 2009),

Boerhavia diffusa Leaves, roots

Calotropis procera

Roots,

Capparis decidua

Fruits, leaves, stem

Cenchrus ciliaris

Whole plant

Citrullus colosynthis Cleome viscosa

Seeds, fruit, root Whole plant, seeds, leaves

Commiphora wightii

Whole plant

Cressa cretica

Whole plant

Crotalaria burhia

Flowers, leaves

Ursolic acid (Choudhary and Dantu, 2011), punarnavine (Murti et al., 2010), boeravinone (Lami et al., 1992), punarnavoside (Jain and Khanna, 1989), glycoprotein (Verma and Awasthi, 1979) Calotropagenin and Calotropin Antispasmodic, sudorific, tonic, (Sharma et al., 2011) emetic, expectorant, stomachic, purgative, Antibacterial, digestive (Jabeen et al., 2009) Capparisine (Ahmad et al., Antimicrobial, Analgesic, 1989) Anthelmintic, Aphrodisiac, Carminative, Diaphoretic, Laxative and helpful to treat biliousness and cardiac problems, intermittent fever (Dalziel, 1948) Azulene, Campesterol, Myristic Anodyne, emollient and relive acid (Singaria et. al., 2012). kidney pain diuretic (Singaria et. al., 2012; Katewa and Jain, 2003) Citrulline, Cytotoxic Rheumatism, arthritis, Jaundice cucurbitacines (Gry et al.,2006) and hepatitis (Dagar, 2005) Cabralealactone, ursolic acid, Anti-carcinogenic (Bala et al., deacetoxybrachycarpone, 2010), Antimicrobial, relieves Trinortriterpinoid (Ahmad and joint pain and swelling (Qureshi Alvi, 1986) et al.,2010), Analgesic, antiinflammatory, antipyretic (Bose et al.,2007; Narendhirakannan et al., 2006) Used in the treatment of The gum resin is a complex hyperlipidemia, obesity, mixture of steroids, diterpenoides, aliphatic esters, thrombosis, arthritis, inflammatory, antimicrobial, etc. carbohydrates and variety of (Reddy et al., 2012; Heera Lal inorganic ions (Reddy et al., and Kasera, 2010) 2012; Heera Lal and Kasera, 2010) Quercetin, stigmasterol, Anthelmintic, aphrodciac, umbelliferone, ursolic acid, diuretic, stomachic, tonic to treat triacontanoic acid (Hussain et asthema and leprosy (Chopra et al., 2005) al., 2006), anti-tuberculosis agent, antibilious, expectorant (Rizk and El-Ghazaly, 1995) Alkaloids, anthraquinones, Antimicrobial, anti-inflamatory,

404

Plant species

Microbes: In Action

Useful part of plant

Cyperus rotundus

Whole plant

Dalbergia sissoo

Leaves

Eclipta alba

Whole plant

Euphorbia caducifolia

Latex, stem, roots

fa*gonia cretica

Whole plant

Gisekia pharnacinoides

Whole plant

Haloxylon salicornicum

Stem

Leptadenia pyrotechnica

Stem, seeds, flower

Mollugo cerviana Whole plant

Major Chemical constituent

Medicinal properties and uses

flavonoides, phenols, polyphenols, steroids, saponins, tannins, triterpenes (kataria et al., 2010) Cyperol, iso-cyperol, cyperone, pinene, rotundene, rotundenol, rotundone, selinatriene, sitosterol (Huang and Peng, 2003)

anti-oxidents, usefull in wound healing (kataria et al., 2010)

Alkaloids, flavonoides, polysterols, saponins, tannins, carbohydrates, glycosides (Brijesh et. al, 2006) -Amyrin, Ecliptal, luteolin-7-Oglucoside, heptacosanol, stigmasterol (Jadhav et al.,2009) Diterpene polyesters (Duarte and Ferreira, 2007; Valentene et. al., 2003), terpenes (Miyata et. al., 2005) Alkeloids, glycosides, saponins, sterols, cyanogenic glycosides, irodoids, coumarins, flavonoids, triterpenoids (Gazanfar and AlSabahi, 1993) Citric, Oxalic, Succinic, Tarteric acids; Dotriacontane, Triacontane, Tetracosano and Myristone (Stella et al., 2004)

Carnegine, dipterine, nicotine, tryptamine, isosalsoline, salsolidine, oxedrine, coumarins, tyramine (Ahmad and Eram, 2011), Haloxymene, haloxine, halosaline, anabasin, piperidine (El-Shazly et. al.,2005) Beta-sitosterols, fernenol, taxaserol, triterpenoids (Verma et. al., 2014) Alkeloids, glycosides, saponins, tannins (Pavithra et. al., 2010)

Diuretics and useful to treat stomach ache, indigestion, dysentery and blood disorders (Kumar et. al., 2010) cough, Epilepsy and diarrhoea (Immanuel and Elizabeth, 2009). Aphrodisiac, expectorant (Singh et al., 2010), to treat nose bleeding (Kumar et. al.,2010) Athlete's Foot Disease, ringworm (Kumar et al., 2010), Burns and ulcers (Katewa et al., 2004) Allergies (Qureshi et al.,2010), Antibacterial, diuretics, anthelmintic, purgative (Natarajan et. al.,2005) Skin eruption, breast cancer (Matt Lam, 2014; Qureshi et al.,2010)

Used in rhinitis, bronchitis, cardiac pain, mental disorders, Leprosy, used in the treatment of chest pain (Nandagopalan et. al., 2011), Astringent, Anthelmintic and Aperient (Stella et. al., 2004), Worm infestation, tonic for hepatic disorders and hepatoprotective agent, Jaundice and hepatitis (Ahmed and Eram, 2011), useful as antioxidant and anti-inflammatory (Saleh et al., 2012) Purgative, skin diseases (Verma et. al., 2014; Goyal and Sharma, 2009) Blood purifier tonic (Immanuel and Elizabeth, 2009), Antiseptic and useful in treatment of cough and improve eyesight

Medicinal Flora of the Thar Desert of Rajasthan

Plant species

Useful part of plant

Phyla nodiflora

Whole plant

Prosopis cineraria

Fruit, seeds

Salsola baryosma

Stem, leaves

Suaeda fruticosa Leaves Tamarix aphylla

Leaves, seeds

Trianthema portulacastrum

Whole plant

Tribulus terrestris

Fruit, leaves, roots

Tephrosia purpurea

Seeds, leaves

Withania somnifera

Roots, stem, leaves

Ziziphus mauritiana

Fruits

Major Chemical constituent

405

Medicinal properties and uses

(Parvathamma and Shanthamma, 2000) -sitosterol, nodiflorin (Dodoala Used in diarrhoea et. al., 2010) (Nandagopalan et al.,2011), muscular pains (Biswas et al., 2011) and urinary probles, micturation and dysurea (Qureshi et al., 2010) Hydroxybenzoic acid, methyl Used to treat respiratory and heptacosanoate, heneicosanoic digestive problems, blood acid (Dharani et. al., 2011). purifier, (Goyal and Sharma, 2009), Gastrointestinal disorders (Davidow, 1999), used in fever and other disease like muscular tremors, some skin diseases including scabies, leucoderma, leprosy (Kirtikar and Basu, 1975) Sterols, coumarins (Rizk, 1986) To treat cardiac disorders, hypertension (Hameed et al., 2011; Hammiche and Mirza, 2006), Phenolic compounds, Anti-bacterial, Ophthalmia naringenin (Naija et. al., 2014). (Rashid et al., 2000) Aromatic hydrocarbons, Used as astringent, stimulus of oxirane, benzofuranone (Mughal perspiration, aperitif, diureticds et al., 2011) (Naija et. al., 2014) Catalase, glutathione, Anti-hepatotoxic agent (Chitra thiobarbituric acid, glutathione and Nithyanandhi, 2007) peroxidase (Chitra and Nithyanandhi, 2007) Flavonoids, alkaloids, amides, In sexual disorder treatment steroidal saponins, lignanamids including spermatorrhoea, urino(El-Sayed et. al., 2008) genital disease (Qureshi et al.,2010) Rutin and rotenoids (Sharma et. Inflammation of spleen and liver, al., 2011) piles, boils and pimples (Sharma et. al., 2011) Antimicrobial, Useful to treat Cytotoxic lactones, anaferine, digestive disorders and hiccups, anahygrine, withanolides, sore eyes, Gynic disorders, piperidine, various alkeloids (Mahesh and Satish, 2008), including somniferine, tropine, somnine, withanine (Verma and Kumar,2011; Mirjalili et. al., 2009.) Blood purifier (Padmavasthy and Oleic acid, Linoleic acid, Anbarashan, 2011), used in the Vitamin B1 and Vitamn C, treatment of chest pain, phenolics, flavemoids, abdominal pain (Mahesh and triterpenic acid and polysaccharides (Priti and Tripathi, Satish, 2008)

406

Microbes: In Action

Plant species

Useful part of plant

Zygophyllum simplex

Whole plant

Major Chemical constituent

Medicinal properties and uses

2014). Glucoside, sitosterol, Isorhamnetin, quinovic acid (Hassanean and Desoky,1992)

Used in Helminthiases (Hammiche and Maiza, 2006)

A number of herbs and shrubs are being used by inhabitants of the Thar desert to cure different diseases. Some plants including Aloe barbadensis, Tephrosia purpurea, Tecomella undulata and Peganum harmala are are used to treat lever diseases, jaundice, Spleen diseases and used as anti-inflammatory agent (Sharma et al., 2011). Similarly, Cressa cretica, Gisekia pharnaceoide and Achyranthes aspera are used as folk remedies for treatment of ailments related to respiratory tract including asthma, bronchitis, common cold and cough (Stella et al., 2004). The role of Aerva javanica, Leptadenia pyrotechnica, Euphorbia hirta and Mukea maderaspatana are well known for their medicinal properties to cure wounds, ache and muscular pain (Quershi et al., 2010; Goyal and Sharma, 2009; Immanuel and Elizabeth, 2009; Mahesh and Satish, 2008). It is reported that hypertension and leprosy can be treated effectively by using Cressa cretica and Gisekia pharnaceoides (Nandagopalan et. al., 2011; Chopra et. al., 2006). fa*gonia cretica is well known in western part of Thar desert for its herbal tea to cure breast cancer (Pareek and Nagori, 2012). Disorders related to eyes including ophthalmia, sore eyes, night blindness and to improve eye sight, some plants like Suaeda fruticosa, Withania somnifera, Achyranthes aspera and Mollugo cerviana are very effective as folk remedies (Immanuel and Elizabeth, 2009; Mahesh and Satish, 2008; Parvathamma and Shanthamma, 2000 and Rashid et. al., 2000). Some hilly area of Barmer, Jaisalmenr, Jodhpur and Jalore are having some patches of Commiphora wightii shrub, which is a source of guggal-gum and it is traditionally used by ethnic tribes as well as in Ayurveda system of medicines for centuries as antimicrobial, anti-arthritis and inflammatory agent and also for the treatment of obesity, hyperlipidemia, thrombosis (Reddy et. al., 2012; Heera Lal and Kasera, 2010). Threats to floral diversity of Thar desert: The Thar desert possesses highest density of the human as well as cattle population among all other deserts. Habitat degradation due to infrastructure developments, industrialization as well as agricultural practices has geared up the degradation of natural resources including floral diversity of Thar desert. For production of food grain and other crops, farmers remove the native flora of the region, which is 'undesirable' for them (Hameed et. al., 2011). It is reported that the population of ruminants including sheep and goats, cattles, camel etc. is highest in Thar desert with comparision to other desert of the world and it is 46-226 cattles/km2 in different district in India (Sharma and Kankane, 2012) and hence, overgrazing is another major factor responsible for plant biodiversity loss. Some exotic species, especially Prosopis juliflora, has severely degraded the habitat of native flora. It is observed that P. Juliflora exerts some phyto-chemicals, which inhibit the growth of native flora (Mertia and Sinha, 2011). In the rural areas, the inhabitants of the Thar desert uses local flora to meet their need for fuel, fodder and construction of huts and houses. Plants like Tecomella undulata and Calligonum polygonoides are

Medicinal Flora of the Thar Desert of Rajasthan

407

being used extensively for commercial purposes and they are now under endangered category (Sher Mohammed and Kansara, 2014). The local people of the desert are rely on medicinal plants of the region for the treatment of many diseases as they do not cause any side effect and also the cost of these herbs are negligible (Kavishankar et. al., 2011; Agarwal, 2005). Therefore, Phyto-diversity loss has inspired an urgent need to conserve natural habitat and promote traditional ecological knowledge and documentation of medicinally important floral species. Strategies for Sustainable Exploration and Conservation of Medicinal Plants A number of stakeholders are involved in the medicinal plant sector in Thar desert including material collectors and herb sellers, local traders, herbal practitioners, wholesalers, manufactures of drugs. It is reported that about 70% of allopathic medicines are derived directly or indirectly by plant materials and these medicinal plants play a vital role for the development of new drugs (Verma and Singh, 2008). Sustainable farming and improved cultivation practices of such medicinally important plants may play a key role in minimising the over-exploitation of these valuable natural resources as well as it may fulfil the rising demand of these plants in national and global market. Central Arid Zone Research Institute (CAZRI), Arid Forest Research Institute (AFRI) and such other organisation are playing important role to develop improved varieties and conservation of some medicinally important plants like Acacia Senegal, Commiphora wightii, Zizyphus mauritiana, Tecomella undulata, Calligonum polygonoides, Cyamopsis tetragonoloba, Cenchrus setigerus etc. But many other native plants are still not conserved and therefore, policymakers, forest department and government should take initiatives to conserve these natural resources. The traditional ecological knowledge of tribes and inhabitants of the Thar desert must be utilized for sustainable exploration of medicinal plants and incentives should be given to farmers involved in cultivation of medicinal plants in the region. REFERENCES Aeri V, Khan MI and Alam S (2010). A validated HPLC method for the quantification of oleanolic acid in the roots of Achyranthes aspera Linn. and marketed formulation. Int. J. Pharm. Pharmaceut. Sci. 2: 74-78 Agarwal A (2005). Current issues in quality control of natural products. Pharma Times. 37: 911 Ahmad M and Eram S (2011). Hepatoprotective studies on Haloxylon salicornicum: A plant from Cholistan desert. Pak. J. Pharm. Sci. 24: 377-382 Ahmad VU and Alvi KA (1986). Deacetoxybrachycarpone, a trinortriterpenoid from Cleome brachycarpa. Phytochemistry. 26: 315-316 Ahmad VU, Ismail N and Ambe A (1989). Iso-codonocarpine from Capparis decidua. Phytochemistry. 28: 2493-2495 Bala A, Kar B, Haldar PK Mazumder UK and Bera S (2010). Evaluation of anticancer activity of Cleome gynandra on Ehrlich's Ascites Carcinoma treated mice. J. Ethnopharm. 129: 131134 Baqri QH and Kankane PL (2001). Desert: Thar. Pp. 94-109. In: Ecosystems of India (J.R.B. Alfred, AK Das and AK Sanyal, eds.), ENVIS, Zoological Survey of India, Kolkata, India. Bhandari MM (1978). Flora of Indian Desert, Scientific Publishers, Jodhpur, pp 466 Bhandari MM (1995). Flora of Indian Desert. Jodhpur, India: MPS Repros Publisher, Jodhpur.

408

Microbes: In Action

Biswas R, Khan T, Monalisa MN, Swarna A, Ishika T, Rahman M and Rahmatullah M (2011). Medicinal plants used by folk medicinal practitioners of four adjoining villages of Narail and Jessore districts, Bangladesh Kakoli, American- Eurasian J. Sust. Agri. 5: 23-33 Bose A, Mondal S, Gupta JK, Ghosh T and Dash GK (2007). Analgesic, anti-inflammatory and antipyretic activities of the ethanolic extract and its fractions of Cleome rutidosperma. Fitoterapia. 78: 515-520 Brijesh S, Daswani G, Tetali P and Antia NH (2006.) Studies on Dalbergia sissoo (Roxb.) leaves: Possible mechanism(s) of action in infectious diarrhoea. Birdi Ind. J. Pharmacol. 38: 120124 CAD (Command Area Development) (1997). Monitoring of water table in IGNP command 1996-97 Bikaner, India: Ground Water Wing, CAD Department, Indira Gandhi Nahar Pariyojana. Chaudhary G and Dantu PK (2011). Morphological, phytochemical and pharmacological studies on Boerhavia diffusa L. J. Med. Plants Res. 5: 2125-2130 Chitra M and Nithyanandhi K (2007). Radical scavenging activity of Trianthema triquetra in male albino rats intoxicated with CCl4. J. Environ. Biol. 28: 283-285 Chopra RN, Nayar SL and Chopra IC (2006). Glossary of Indian Medicinal Plants. National Institute of Science Communication and Information Resources, New Delhi. pp. 80 Dagar JC (2005). Ecology, management and utilization of halophytes. Bull. Nat. Inst. Ecol. 15: 81-97 Dalziel JM (1948). Useful Plants of West Tropical Africa. Crown Agents for the Colonies, London, pp. 178-180 Darsini TPD, Sasikumar JM and Kulandhaivel M (2009). In vitro antioxidant and cytotoxic analysis of Boerhavia diffusa Linn. Ethnobot. Leaflets. 13: 263-268 Davidow J (1999). Infusions of Healing: A Treasury of Mexican-American Herbal Remedies. Simon and Schuster Inc. pp.149 Dharani B, Sumathi S, Shivaprabha J and Padma PR (2011). In Vitro antioxidant potential of Prosopis cineraria leaves. J. Nat. Prod. Plant Resour. 3(1): 26-32 Dhir RP (2003). Thar desert in retrospect and prospect. Proc. Indian Natn. Sci. Acad. 69 (2): 167-184 Dodoala S, Diviti R, Koganti B and Prasad KVSRG (2010). Effect of ethanolic extract of Phyla nodiflora (Linn.) Greene against calculi producing diet induced urolithiasis. Ind. J. Nat. Prod. Resour. 1: 314-321 Duarte N and Ferreira MJ (2007). Lagaspholones A and B: two new jatropholane-type diterpenes from Euphorbia lagascae. Org. Lett. 21(9): 489-492 Dwivedi S, Dubey R and Mehta K (2008). Achyranthes aspera Linn. (Chirchira): a magic herb in folk medicine. Ethnobot. Leaflets. 12: 670-676 El-Sayed AA, Razin AM, Swaefy HMF, Mohamed SM and Abou-Aitah KEA (2008). Effect of water stress on yield and bioactive chemical constituents of Tribulus species. J. Appl. Sci. Res. 4: 2134-2144 El-Shazly AM, Dora G and Wink M (2005). Alkaloids of Haloxylon salicornicum (Moq.) Bunge ex Boiss.(Chenopodiaceae). Pharmazie. 60: 949-952 Ghazanfar SA and Al-Sabahi AM (1993). Medicinal plants of Northern and Central Oman (Arabia). Econ. Bot. 47: 89-98 Golwala DK, Patel LD, Vaidya SK, Bothara SB, Mani M and Patel P (2010). Anticonvulsant activity of Abutilon indicum leaf. Int. J. Pharm. Pharmaceut. Sci. 2: 66-71 Goyal M and Sharma SK (2009). Additional wisdom and value addition prospects of arid foods of desert region of North West India. Ind. J. Trad. Knowl. 8: 581-585 Gry J, Soborg I and Andersson HC (2006). Cucurbitacins in plant food. Nordic Council of Ministers. Copenhagen, pp. 68 Hameed M, Ashraf M, Al-Quriany F, Nawaz T, Ahmad MSA, Younis A and Naz N (2011). Medicinal flora of the Cholistan desert: A Review. Pak. J. Bot. 43: 39-50 Hammiche V and Maiza K (2006). Traditional medicine in Central Sahara: Pharmacopoeia of Tassili Najjer. J. Ethnopharm. 105: 358-367

Medicinal Flora of the Thar Desert of Rajasthan

409

Hassanean HA and Desoky EK (1992). An acylated isorhamnetin glucoside from Zygophyllum simplex. Int. J. Plant Biochem. 31: 3293-3294 Heera Lal and Kasera PK (2010). Status and Distribution Range of Guggal: A Critically Endangered Medicinal Plant from the Indian Thar Desert. Science and Culture. 76(11-12): 531-533 Huang X and Peng G (2003). Advances in the study of chemical constituents and pharmacology of Cyperus rotundus L. Zhong Yao Cai. 26: 65-68 Hussain S, Ahmed E, Malik A, Jabbar A and Arshad M (2005). Photochemical Studies on Cressa cretica. J. Chem. Soc. Pak. 27: 296-298 Immanuel RR and Elizabeth LL (2009). Weeds in agroecosystems: A source of medicines for human healthcare. Int. J. Pharm. Tech. Res. 1: 375-385 Indian Institute of Remote Sensing (2011). Biodiversity characterisation at landscape level in North-West India and Lakshadweep islands using Remote Sensing and Geographical Information System. Shiva offst Press, Dehra Dun, India. Jabeen A, Khan MA, Ahmad M, Zafar M and Ahmad F (2009). Indigenous uses of economically important flora of Margallah Hills National Park, Islamabad, Pakistan. Afr. J. Biotechnol. 8: 763-784 Jadhav VM, Thorat RM, Kadam VJ and Salaskar KP (2009). Chemical composition, pharmacological activities of Eclipta alba. J. Pharm. Res. 2: 1129-1231 Jain GK and Khanna NM (1989). Punarnavoside: A new antifibrinolytic agent from Boerhavia diffusa Linn. Ind. J. Chem. 28:163-166 Jain SK (1968). Medicinal Plants, National Book Trust, New Delhi. Kataria S, Shrivastava B, Khajuria RK, Suri, KA and Sharma P (2010). Antimicrobial activity of Crotalaria burhia Buch.-Ham. roots. Ind. J. Nat. Prod. Resour. 1: 481-484 Katewa SS and Jain A (2003). Aromatic and medicinal grasses of Aravalli hills of Rajasthan. In: Ethnomedicine and Pharmacognosy II. Recent Progress in Medicinal Plants Series. (Eds.): VK Singh, Govil JN, Hashmi S, Singh, G Sci Tech Pub. USA, 7: 57-68 Katewa SS, Chaudhary BL and Jain A (2004). Folk herbal medicines from tribal area of Rajasthan, India. Journal of Ethnopharmacology. 92: 41-46 Kavishankar GB, Lakshmidevi N and Murthy SM (2011). Diabetes and medicinal plants - A review. Int. J. Pharm. Biomed. Sci. 2: 65-80 Kirtikar KR and Basu BD (1975). Indian Medicinal Plants. 4 vols. 2nd ed. Jayyed Press, New Delhi. Krishnan A (1977). A climatic analysis of the arid zone of North-western India. In: Desertification and its control. ICAR, New Delhi, pp 69-76 Kumar BSA, Lakshman K, Jayaveera KN, Nandeesh R, Tripathi SNM, Krishna NV, Manjunath M and Suresh MV (2009). Estimation of rutin and quercetin in Amaranthus viridis L., by high performance layer chromatography (HPLC). Ethnobot. Leaflets. 13: 437-42 Kumar RP, Rajesh K, Yogender M, Dharmesh S and Karthiyagini T (2010). Standardization and preliminary phytochemical investigation on Cyperus rotundus Linn. rhizome. Int. J. Res. Ayurveda Pharm. 1: 536-542 Lami N, Kadota S and Kikuchi T (1992). Constituents of the roots of Boerhavia diffusa Linn. IV. Isolation and structure determination of boeravinones D, E and F. Chem. Pharmaceut. Bull. 39: 1863-1865 Macharla SP, Goli V, Bhasker KV, Devi PS, Dhanalakshmi C and Snajusha C (2011). Effects of anti-inflammatory activity of Amaranthus viridis Linn., Annals of Biological Research. 2(4): 435-438 Mahesh B and Satish S (2008). Antimicrobial activity of some important medicinal plants against plant and human pathogens. World J. Agric. Sci. 4: 839-843 Matt Lam, Carmichael AR and Griffiths HR (2012). An Aqueous Extract of fa*gonia cretica Induces DNA Damage, Cell Cycle Arrest and Apoptosis in Breast Cancer Cells via FOXO3a and p53 Expression. PLoS ONE, 9(7): e102655. doi: 10.1371/journal.pone.0102655.

410

Microbes: In Action

Mertia RS and Sinha NK (2011). Invasion of Prosopis julijlora in Indian Thar desert: Curse or Boon, National seminar on Prosopis juliflora: Past, present and future, 23-24, March, 2011, Central Arid Zone Research Institute (CAZRI), Jodhpur. Mertia RS, Prasad R, Kandpal BK and Narain P (2006). Regeneration of Lasiurus sindicus in relation to grazing pressure and root-zone soil moisture in arid rangelands of western Rajasthan (India). Tropical Grasslands. 40: 40-44 Mirjalili MH, Moyano E, Bonfill M, Cusido RM and Palazon J (2009). Steroidal lactones from Withania somnifera, an ancient plant for novel medicine. Molecules. 14: 2373-2393 Miyata S, Wang LY, Yoshida C and Kitanaka S (2005). Inhibition of cellular proliferation by diterpenes, topoisomerase II inhibitor. Bioorg. Med. Chem. 14: 2048-2051 Mughal T, Shahid S and Qureshi S (2011). Antifungal studies of Withania coagulans and Tamarix aphylla. J. App. Pharm. 3: 289-294 Murti K, Panchal MA and Lambole V (2010). Pharmacological properties of Boerhavia diffusa a review. Int. J. Pharmaceut. Sci. Rev. Res. 5: 107-110 Naija DS, Bouzidi A, Boussaada O, Helal AN, Mahjoub MA, Echafai N and Mighri Z (2014). The antioxidant and free radical scavenging activities of Tamarix boveana and Suaeda fruticosa and related active compound. Europian Scientific Journal. 10(18): 201-219 Nandagopalan V, Anand SP, Selvakumar U and Doss A (2011). An ethnobotanical study in the Pudukkottai District, South India. Asian J. Exp. Biol. Sci. 2: 412-421 Narendhirakannan RT, Subramanian SK and Aswamy M (2006). Anti-inflammatory and lysosomal stability actions of Cleome gynandra L. studied in adjuvant induced arthritic rats. Food Chem. Toxicol. 45: 1001-1012 Natarajan D, Britto SJ, Srinivasan K, Nagamurugan N, Mohanasundari C and Perumal G (2005). Anti-bacterial activity of Euphorbia fusiformis-a rare medicinal herb. J. Ethnopharmacol. 102: 123-126 Padmavathy A and Anbarashan M (2011). Phytomedicinal study of coastal sand dune floras in Puduch*erry. J. Med. Plants Res. 5: 2566-2571 Pareek A and Nagori BP (2012). In-Vitro Anti-oxidative profiling of different extract of fa*gonia schweinfurthii (hadidi). Int. J. Res. Ayurveda Pharma. 4(4): 533-541 Parvathamma S and Shanthamma C (2000). Antimicrobial activity of Mollugo cerviana Ser. (Molluginaceae). Ancient Sci. Life. 20: 1-4 Pavithra PS, Janani VS, Charumathi KH, Indumathy R, Potala S and Verma RS (2010). Antibacterial activity of plants used in Indian herbal medicine. Int. J. Green Pharmacy. 4: 22-28 Pengelly A (2004). Triterpinoids and Saponins, in the Constituent of Medicinal Plants. CABI publishing, USA, Pp. 74 Priti and Rripathi Shalini (2014). Ziziphus jujuba: A phyto-pharmacological review. International Journal of Research and Development in Pharmacy and Life Sciences. 3(3): 959966 Qureshi R, Bhatti GR and Memon RA (2010). Ethnomedicinal uses of herbs from northern part of Nara desert, Pakistan. Pak. J. Bot. 42: 839-851 Rajesh R, Chitra K and Paarakh MP (2010). In vitro anthelmintic activity of aerial parts of Aerva lanata (L.) Juss. ex Schult. Int. J. Pharmaceut. Sci. Drug Res. 2: 269-271 Rajurkar R, Jain R, Matake N, Aswar P and Khadbadi SS (2009). Anti-inflammatory action of Abutilon indicum (L.) Sweet leaves by HRBC membrane stabilization. Res. J. Pharm. Tech. 2: 415-416 Ramawat KG (2010). Desert Plants: Biology and Biotechnology. XXI, pp 503 Springer Verlag. Rao AR, Arshad M and Shafiq M (1989). Perennial Grass Germplasm of Cholistan Desert and its Phytosociology. Cholistan Institute of Desert Studies, Islamia University, Bahawalpur, Pakistan, pp. 160 Rashid S, Iftekhar Q, Arshad M and Iqbal J (2000). Chemical composition and antibacterial activity of Suaeda fruticosa Forsk. from Cholistan, Pakistan. Pak. J. Biol. Sci. 3: 348-349 Reddy CS, Harikrishna P, Meena SL, Bhardwaj R and Sharma KC (2011). Composition of life form and biological spectrum along climatic gradient in Rajasthan, India. International Journal of Environmental Sciences. 1(7): 1632-1639

Medicinal Flora of the Thar Desert of Rajasthan

411

Reddy CS, Meena SL, Hari Krishna P, Charan PD and Sharma KC (2012). Conservation Threat Assessment of Commiphora wightii (Arn.) Bhandari - an Economically Important Species. Taiwania. 57 (3): 288-293 Report of the Task Force on Grasslands and Deserts (2006). The Planning Commission (Environment and Forests Division) for the Eleventh Five Year Plan (2007-2012). Government of India, New Delhi. Rizk AM and El-Ghazaly GA (1995). Medicinal and Poisonous Plants of Qatar. University of Qatar. Scientific and Applied Research Centre, pp. 101 Rizq AM (1986). The Phytochemistry of the Flora of Qatar. Vol 29. Kingprint, Richmond, UK. Rodgers WA, Panwar HS and Mathur VB (2002). Wildlife protected area network in India: a review (executive summary). Wildlife Institute of India, Dehradun. Roy BB, Dhir RP and Kolarkar AS (1978). Soils of Rajasthan desert and their characteristics. Proc. Indian National Sci. Aca. 4: 161-167 Saleh IA, Gamal AEHS, Amani SA, Abd ER and Mohammed D (2012). Anti-inflammatory activity, safety and protective effects of Leptadenia pyrotechnica, Haloxylon salicornicum and Ochradenus baccatus in ulcerative colitis. Phytopharmacology. 2(1): 58-71 Saxena SK and Gupta RK (1972). Vegetation of Pachpadra salt basin in western Rajasthan. Journal of Bombay Natural History. 70(1): 104-127 Saxena SK, Squire VR and Ayub AT (1994). Halophytes of Indian desert communities on the various 'ranns'. In: Squire, VR and Ayub, AT (ed.), Kluwer Academic Publisher, Dordretcht. Tasks for Vegetation Science. 32: 211-215 Sharif A, Ahmed E, Malik A, Mukhtar-ul-Hassan, Munawar MA, Farrukh A, Nagra SA, Anwar J, Ashraf M and Mahmood Z (2011). Antimicrobial constituents from Aerva javanica. J. Chem. Soc. Pak. 33: 439-443 Sharma A, Sharma MS, Mishra A, Sharma S, Kumar B and Bhandari A (2011). A review on Thar plants used in liver diseases. International Journal of Research in Pharmacy and Chemistry. 1(2): 224-236 Sharma G and Kankane PL (2012). Fauna of Ecosystems of India Thar Desert. Zoological Surveys of India, Government of India. Pp. 1-18 Sher Mohammed and Kasera PK (2014). Biodiversity conservation and ecological assessments of arid zone plants in Thar Desert of India. 3rd International conference on Biodiversity and sustainable energy development, June 24-26, 2014, Valencia Conference Centre, Valencia, Spain. Sher Mohammed, Kasera PK and Shukla JK (2004). Unexploited plants of potential value from the Indian Thar desert. Natural Product Radiance . 3(2): 69-74 Shetty BV and Singh V (1987). Flora of Rajasthan, Vol.-I, Botanical Surveys of India, Calcutta. Shetty BV and Singh V (1991). Flora of Rajasthan, Vol.-II, Botanical Surveys of India, Calcutta. Sikka DR (1997). Desert climate and its dynamics. Current Science . 72(1): 36-46 Singaria P, Kumar P and Mourya KK (2012). An active guided isolation and evaluation of various solvent extracts of the leaves of Anjan grass. Hygeia. J. D. Med. 4(2): 49-56 Singh A (2010). Survey of suitable exotic trees for revegetation of mine spoils in Singrauli coalfields. Indian Forester. 559-561 Singh B, Gupta V, Bansal P, Singh R and Kumar D (2010). Pharmacological potential of plants used as aphrodisiacs. Int. J. Pharm. Sci. Rev. Res. 5: 104-113 Singh G, Bala N and Kumar P (2007). Challenges and strategies for sustainable development of Indira Gandhi Nahar area of Rajasthan. Presented in Seminar on Revisiting Indira Gandhi Canal Command, CAZRI, Jodhpur on 15-16 December 2007 pp. 30 Singh G, Wasson RJ and Agarwal DP (1990). Vegetation and seasonal climatic changes since the last full glacial in the Thar Desert, NW India, Rev. Palaeobot. Palynol. 64: 351-358 Singh M and Kumar A (2013). Traditional medicinal plants of Rajasthan used in tribal medicine: a review. International Journal of Life Science and Pharma Research. 3(2): 38-42 Singh RV, Singh P, Hansen LA and Graudal Lars (2008). Medicinal plants, their conservation, use and production in southern India. Forest and Landscape, University of Copenhagen. (Development and Environment, Vol. 11/2008)

412

Microbes: In Action

Sinha RK (1996). Making aridlands productive: Conservation and utilization of Thar desert biodiversity for sustainable development in India. Desertification Control Bulletin. 29: 1722 Stella UY, Sasikala E, Rao GS and Sangeetha J (2004). Pharmacognostic studies on Gisekia pharnacioides Linn. Ancient Sci. Life. 23: 1-7 Tewari VP, Singh B and Kishan Kumar VS (2001). Volume Equations for Eucalyptus camaldulensis in Indira Gandhi Nahar Pariyojana. Indian Forester. 127(12):1367-70 Upadhyay PB, Shikha R and Kumar A (2007) Traditional uses of medicinal plants among the rural communities of Churu district in the Thar Desert, India. Journal of Ethnopharmacology. 113: 387-399 Valente C, Ferreira MJ, Abreu PM, Pedro M, Cerqueira F and Nascimento MS (2003). Three new jatrophane-type diterpenes from Euphorbia pubescens. Planta Med. 69: 361-366 Verma HN and Awasthi LP (1979). Antiviral activity of Boerhavia diffusa root extract and physical properties of virus inhibitor. Can. J. Bot. 57: 926-932 Verma N, Jha KK, Choudhary S, Singh O and Kumar A (2014). Phytochemistry, Pharmacology and traditional uses of Leptadenia pyrotechnica- An important medicinal plant. Indian Journal of Pharmaceutical and Biological Research. 2(1): 128-134 Verma S and Singh SP (2008). Current and future status of herbal medicines. Vet World. 1(11): 347-350 Verma SK and Kumar A (2011). Therapeutic uses of Withania somnifera (ashwagandha) with a note on Withanolides and its pharmacological actions. Asian Journal of Pharmaceutical and Clinical Research. 4(1): 1-4.